Isolation, pure culture and characterization of Serratia symbiotica sp. nov., the R-type of secondary endosymbiont of the black bean aphid Aphis fabae

Symbiosis is a common feature in insects, especially in insects feeding on exclusive and unbalanced diets (Buchner, 1965). For aphids, an association with an endosymbiotic bacterium Buchnera aphidicola combats the lack of essential amino acids in the phloem sap. In addition to this obligate symbiont, many aphids harbour facultative endosymbionts that enable them to expand their ecological niches and also help to provide protection against microbial and parasitoid attacks (Oliver et al., 2003; Tsuchida et al., 2004; Scarborough et al., 2005). Both primary and secondary symbionts are maternally inherited over aphid generations and can reside intracellularly in specialized cells and organs (Buchner, 1965; Baumann et al., 2000).

As they live in a nutrient-rich environment, many endosymbionts have relatively inactive biochemical profiles compared with those of their free-living relatives (Hypša & Dale, 1997; Dale & Maudlin, 1999; Pontes & Dale, 2006). Consequently, most of them are difficult to isolate using conventional in vitro culture conditions and their phenotypic and genetic characterization is mostly incomplete (Hypša & Dale, 1997; Darby et al., 2005). To date, only a few of these symbionts have been successfully characterized and currently a trivial nomenclature system is in use to allow their distinction and classification (Gherna et al., 1991; Hypša & Dale, 1997; Dale & Maudlin, 1999).

‘Candidatus Serratia symbiotica’ is currently described as an endosymbiont from multiple aphid families. Recent studies have demonstrated that it plays different roles in the heat tolerance of the host and in their protection against parasitoids (Chen et al., 2000; Montllor et al., 2002; Oliver et al., 2003; Burke et al., 2010). In the aphid subgenus Cinara, ‘Ca. S. symbiotica’ has a long-term relationship with its hosts and appears to be in a transition phase from a facultative to an obligate symbiont for host survival and reproduction (Gil et al., 2002; Gómez-Valero et al., 2004; Pérez-Brocal et al., 2006; Lamelas et al., 2008; Burke et al., 2009).

In this study, the first isolation and in vitro culture of an endosymbiotic strain of ‘Ca. S. symbiotica’ from the flora of a natural clone of the aphid Aphis fabae is described. This strain is proposed as the type strain of the secondary endosymbiont Serratia symbiotica sp. nov.

The novel strain, designated CWBI-2.3^T, was isolated during the characterization of the microbiota of several laboratory and natural aphids collected in Belgium. The strain was among the flora of the natural clone of the black bean aphid Aphis fabae collected over a period corresponding to the first parthenogenetic generations (May 2009).

For strain isolation, 40 specimens were surface-sterilized and extracted with 863 medium containing (l⁻¹ distilled water) 10 g each of glucose, yeast extract and casein peptone. The extract was then plated on 868 agar medium (corresponding to 863 medium with 1.7 % agar). Colonies of strain CWBI-2.3^T were visible after 2 weeks of incubation at 20 °C and the prevalence was about 10³ c.f.u. mg⁻¹. The flora of the collected A. fabae clone contained two other bacteria identified as Acinetobacter calcoaceticus (1.3×10³ c.f.u. mg⁻¹) and Pseudomonas viridiflava (0.7×10³ c.f.u. mg⁻¹).

Colonies of strain CWBI-2.3^T were circular, uniform in size with entire edges, not pigmented and appeared off-white, smooth and shiny. Morphological features were examined by light microscopy and transmission electron microscopy (100-SX; JEOL) (Fig. 1). The strain was motile, rod-like (0.5×0.8–1.3 µm) and appeared mainly as single cells or in pairs.

The novel strain was maintained in the laboratory for several months and used for all of the subsequent experiments described in this study. Long-term preservation was possible by freezing at −80 °C in culture medium with 20 % (w/v) glycerol.

For strain identification, genomic DNA was extracted from cells grown at 20 °C for 120 h in 868 medium and purified by using a Wizard Genomic DNA purification kit (Promega). The primers used for PCR amplification of the 16S rRNA gene were the universal primers 16SP0 GAAGAGTTTGATCCTGGCTCAG and 16SP6 CTACGGCTACCTTGTTACGA (Ventura et al., 2001). The PCR product was purified using GFX PCR DNA and a Gel Band kit (GE Healthcare). Sequencing was achieved using a Big Dye v.3.1 kit and a 3730 DNA Analyzer (Applied Biosystems). The primers used for sequencing were F1 (CTGGCTCAGGAYGAACG), F2 (GAGGCAGCAGTRGGGAAT), F3 (ACACCARTGGCGAAGGC) and F4 (GCACAAGCGGYGGAGCAT) for the coding DNA segment, and R1 (CTGCTGGCACGTAGTTAG), R2 (AATCCTGTTYGCTMCCCA), R3 (CCAACATCTCACGACACG) and R4 (TGTGTAGCCCWGGTCRTAAG) for the non-coding DNA segment. The sequences obtained (400–600 bp) were then assembled by using the BioEdit program. The resulting sequence (1478 bp) of strain CWBI-2.3^T was deposited in GenBank database with the accession number GU394001. The sequence of strain CWBI-2.3^T was compared with other sequences in GenBank by using the blastn program (Altschul et al., 1997).

The 16S rRNA gene sequence of the novel strain shared 99.9 % similarity with that of ‘Ca. Serratia symbiotica’ strains found in Aphis craccivora (1463/1464 bp) (Tsuchida et al., 2006). It was also closely related to ‘Ca. Serratia symbiotica’ strains found in Acyrthosiphon pisum (99.7 %) and Cinara cupressi (99.6 %) (Unterman et al., 1989; Fukatsu et al., 2000; Tsuchida et al., 2006; Lamelas et al., 2008; Burke et al., 2009).

A comparison with 16S rRNA gene sequences of the type strains of free-living members of the genus Serratia showed that strain CWBI-2.3^T shared 97.7 % similarity with Serratia ficaria, 97.5 % with Serratia entomophila, 97.4 % with Serratia plymuthica, 97.1 % with Serratia proteamaculans, 97.0 % with Serratia grimesii, 96.9 % with Serratia nematodiphila, 96.8 % with Serratia odorifera, 96.7 % with Serratia marcescens, 96.4 % with Serratia fonticola, 96 % with Serratia ureilytica, 96 % with Serratia glossinae and 95.6 % with Serratia rubidaea.

Phylogenetic analysis was conducted by using mega 4.0 software (Tamura et al., 2007). Sequence similarity was estimated using the likelihood method and phylogenetic trees were constructed with the neighbour-joining method (Saitou & Nei, 1987). Bootstrap analysis (1000 resamplings) was used to evaluate the topology of the trees (Felsenstein, 1985).

Recent phylogenetic reconstructions of lineages of symbiotic members of the genus Serratia have revealed the existence of two groups of ‘Ca. S. symbiotica’ in aphids (Lamelas et al., 2008; Burke et al., 2009). The first (cluster A) encompasses S-symbionts belonging to different subfamilies of the family Aphididae; Aphidinae, Chaitophorinae, Eriomatinae and some members of the subfamily Lachninae. The second (cluster B) comprises only endosymbionts of the genus Serratia from the subfamily Lachninae which are considered to be primary-type endosymbionts (Lamelas et al., 2008). The phylogenetic tree (Fig. 2) showed that strain CWBI-2.3^T belonged to cluster A of the S-symbiont lineages.

For free-living species of the genus Serratia, phylogenetic affinities revealed two clusters. The first cluster (cluster II) included S. marcescens, S. rubidaea, S. liquefaciens, S. ureilytica, S. nematodiphila and S. odorifera. The second cluster (cluster I) included S. proteamaculans, S. grimesii, S. plymuthica, S. fonticola, S. entomophila and S. ficaria. Strain CWBI-2.3^T clearly belonged to the second cluster (cluster I, Fig. 3).

DNA–DNA hybridizations were performed with strain CWBI-2.3^T and the three most closely related species in the second cluster (cluster I); S. ficaria, S. entomophila and S. plymuthica. The analysis was performed fluorometrically according to the method of Ezaki et al. (1989) using photobiotin-labelled DNA probes and microdilution wells. Strain CWBI-2.3^T showed DNA–DNA relatedness values of 23 %, 22 % and 21 % with S. ficaria, S. entomophila and S. plymuthica, respectively. This indicated that the secondary symbiont of the aphid, strain CWBI-2.3^T, represented a distinct species of the genus Serratia according to the criteria used for the delineation of bacterial species (Wayne et al., 1987).

For DNA G+C analysis, genomic DNA was extracted and purified according to Gevers et al. (2001) and the G+C content was determined by HPLC (Mesbah et al., 1989). The DNA G+C content of CWBI-2.3^T strain was 52.7 mol% and was similar to that found for S. liquefaciens (51.9 mol%) and S. fonticola (51.5 mol%), but was less than that determined for most free-living species of the genus Serratia (Grimont et al., 1982; Gavini et al., 1979). Genome size reduction and a low G+C content of the genomic DNA are common characteristics of endosymbiotic bacteria (Moran et al., 2008). The G+C content of the strain CWBI-2.3^T was relatively low when compared with that of many free-living species of the genus Serratia; however, it was much higher than that reported for several other insect endosymbionts, in which the DNA G+C content is often below 33 mol% (Moran et al., 2008).

The novel strain was able to grow aerobically and microaerobically at 0–4 % (w/v) NaCl and at 10–30 °C, with an optimum growth temperature of 25 °C. In an attempt to define a minimal medium for the growth of the novel strain, it was found that the strain was unable to grow on a mineral medium (MM) [0.2 % (NH₄)₂SO₄; 0.2 % Na₂SO₄; 1.5 % K₂HPO₄; 0.05 % KH₂PO₄; 0.01 % MgSO₄ . 7H₂O and 0.003 % CaCl₂] containing glucose (1 %) and the 20 amino acids (0.01 % each) (OD₆₀₀>0.1). However, it was able to grow on MM containing 1 % glucose and 1 % casein peptone instead of pure amino acids (OD₆₀₀ = 0.6). Weak growth was obtained on MM containing only casein peptone (1 %) (OD₆₀₀ = 0.2). On 863 medium (containing 1 % each of glucose, casein peptone and yeast extract), growth reached an OD₆₀₀ of 1.4.

For the assimilation and acidification tests, API 20E, API 20NE and API 50CH strips (bioMérieux) were used and the incubation times were about 2 weeks for strain CWBI-2.3^T and 24 h for the free-living Serratia strains. For the assimilation tests (API 20NE strips), the novel strain gave a positive result only for the assimilation of glucose and N-acetylglucosamine as a carbon source. However, the novel strain was unable to grow on arabinose, mannose, mannitol, maltose, gluconate, caprate, adipate, malate, citrate or phenylacetate. In acidification tests (API 50CH strips), strain CWBI-2.3^T was weakly positive for acid production from glucose, sucrose and aesculin, but was unable to produce acid from the 46 remaining carbohydrates present on the strips (Table 1). With the API 20E strips, strain CWBI-2.3^T was positive for the Voges–Proskauer reaction but gave a negative result for β-galactosidase, arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase, urease, tryptophan deaminase and gelatinase. The novel strain was also unable to reduce nitrate or produce H₂S or indole. The strain was also negative in tests for DNase, lipase (Tween 80), lecithinase, chitinase and in the methyl red test.

Phenotypic characterization revealed that strain CWBI-2.3^T was characterized by a highly restricted metabolic profile in comparison with the free-living members of the genus Serratia (Grimont et al., 1988; Ajithkumar et al., 2003; Bhadra et al., 2005; Zhang et al., 2009; Geiger et al., 2010). Indeed, in general, members of the genus Serratia are able to produce a wide range of hydrolases and to develop on many carbon sources. They are usually distinguished from other members of the family Enterobacteriaceae by their growth on mineral medium without growth factors, as well as by their acid production from maltose, mannitol and trehalose and by their ability to produce DNase, lipase, and gelatinase (Farmer et al., 1985). It appears that strain CWBI-2.3^T has lost all these characteristics during its adaptation to its symbiotic life. In the genus Serratia, this kind of adaptation, with loss of metabolic diversity, has been previously reported for the biogroup 1 of S. marcescens. The latter has lost some of its metabolic activities through the natural selection of strains adapted to the human urinary tract (Farmer et al., 1985). For mutualistic intracellular bacteria in general, the loss of metabolic and genetic diversity is usually a consequence of evolution in a closed environment in which many molecules can be obtained from the host (Andersson & Kurland, 1998; Dale & Maudlin, 1999; Moran & Wernegreen, 2000; Dale & Moran, 2006). This loss of metabolic and genetic diversity is probably the main reason why many insect endosymbionts are difficult to isolate and characterize.

For quantitative analysis of the cellular fatty acid composition, cells were grown aerobically for 24 h at 28 °C on TSA medium (BBL 11768). Inoculation and harvesting of cells were performed as described by the Microbial Identification System, Inc. (MIDI). The extraction and analysis were performed as prescribed by the MIDI system and the whole-cell fatty acid composition was determined using GC.

The fatty acid profile of strain CWBI-2.3^T was compared with those of some related free-living species of the genus Serratia (Table 2). Summed features 2 and 3 (comprising C_12 : 0 alde, an unknown fatty acid with equivalent length 10.928 and C_14 : 0 3-OH/C_16 : 1 iso I, and C_16 : 1ω7c/ iso C_15 : 0 2-OH, respectively) were also among the predominant fatty acids of most of the strains, except for S. nematodiphila, in which summed feature 3 was present only in trace amounts but the amount of C_19 : 0 cyclo ω7c was particularly high. The most marked differences between strain CWBI-2.3^T and the free-living strains tested concerned the fatty acid C_17 : 0 cyclo, which was absent from strain CWBI-2.3^T and present in large amounts in most tested strains. The content of summed feature 3 was particularly high in strain CWBI-2.3^T when compared with the level in the other species tested. Such differences confirmed that strain CWBI-2.3^T represented a distinct and separate species within the genus Serratia.

Strain CWBI-2.3^T was highly sensitive to rifampicin, tetracycline and chloramphenicol (<10 µg ml⁻¹). It was sensitive to streptomycin (10 µg ml⁻¹), kanamycin (20 µg ml⁻¹), ampicillin (20 µg ml⁻¹), erythromycin (30 µg ml⁻¹) and gentamicin (40 µg ml⁻¹), but resistant to vancomycin.

Due to their inability to grow axenically, no strain of ‘Ca. S. symbiotica’ has been isolated and characterized previously, as required for formal description of the species. Consequently, the taxon has previously been named under the Candidatus provision for the informal naming of uncultured representatives of new genera and species (Moran et al., 2005). As strain CWBI-2.3^T is the first strain of ‘Ca. S. symbiotica’ to be purified and characterized, it is designated as the type strain of Serratia symbiotica sp. nov.

The availability of a pure culture of S. symbiotica sp. nov. will provide valuable opportunities to promote the position of the species in the genus Serratia. The provisional name ‘Candidatus Serratia symbiotica’ has been assigned to many strains residing in several aphid species mainly on the basis of morphological observations and 16S rRNA gene sequence similarities. Even though the 16S rRNA gene sequences of strains of ‘Ca. S. symbiotica’ have shown very high similarities, they may actually belong to separate species and so warrant further investigation. The isolation of strain CWBI-2.3^T should also stimulate further studies on the role of this species in aphids.

The inactive biochemical profile of the novel species suggests that the loss of metabolic diversity could be gradual and it may be that phenotypic diversity may exist between strains of S. symbiotica. This diversity is probably a result of an overall evolution within the species which forms a continuum from partially free-living strains, such as strain CWBI-2.3^T, to the highly host-dependent strain recently described in Cinara aphids (Pérez-Brocal et al., 2006).