Proteobacteria

Isolation, pure culture and characterization of Serratia symbiotica sp. nov., the R-type of secondary endosymbiont of the black bean aphid Aphis fabae

  • 1CWBI, University of Liege B40, 4000 Liege, Belgium
  • 2Department of Functional and Evolutionary Entomology, Gembloux Agro-Bio Tech, 5030 Gembloux, Belgium
  • 3Unité d’Ecologie et de Biogéographie, 1348 Louvain-la-Neuve, Belgium
  • Correspondence
    Ahmed Sabri a.sabri{at}ulg.ac.be Philippe Thonart p.thonart{at}ulg.ac.be
  • International Journal of Systematic and Evolutionary Microbiology 2011; 61(9):2081–2088 · https://doi.org/10.1099/ijs.0.024133-0

    View at publisher PubMed

    With thanks to our partners for supporting this archive.

    Abstract

    An intracellular symbiotic bacterium was isolated from the flora of a natural clone of the black bean aphid Aphis fabae. The strain was able to grow freely in aerobic conditions on a rich medium containing 1 % of each of the following substrates: glucose, yeast extract and casein peptone. Pure culture was achieved through the use of solid-phase culture on the same medium and the strain was designated CWBI-2.3T. 16S rRNA gene sequence analysis revealed that strain CWBI-2.3T was a member of the class Gammaproteobacteria, having high sequence similarity (>99 %) with ‘Candidatus Serratia symbiotica’, the R-type of secondary endosymbiont that is found in several aphid species. As strain CWBI-2.3T ( = LMG 25624T = DSM 23270T) was the first R-type symbiont to be isolated and characterized, it was designated as the type strain of Serratia symbiotica sp. nov.

    • The GenBank/EMBL/DDBJ accession number for the 16S rRNA gene sequence of strain CWBI-2.3T is GU394001.

    Symbiosis is a common feature in insects, especially in insects feeding on exclusive and unbalanced diets (Buchner, 1965). For aphids, an association with an endosymbiotic bacterium Buchnera aphidicola combats the lack of essential amino acids in the phloem sap. In addition to this obligate symbiont, many aphids harbour facultative endosymbionts that enable them to expand their ecological niches and also help to provide protection against microbial and parasitoid attacks (Oliver et al., 2003; Tsuchida et al., 2004; Scarborough et al., 2005). Both primary and secondary symbionts are maternally inherited over aphid generations and can reside intracellularly in specialized cells and organs (Buchner, 1965; Baumann et al., 2000).

    As they live in a nutrient-rich environment, many endosymbionts have relatively inactive biochemical profiles compared with those of their free-living relatives (Hypša & Dale, 1997; Dale & Maudlin, 1999; Pontes & Dale, 2006). Consequently, most of them are difficult to isolate using conventional in vitro culture conditions and their phenotypic and genetic characterization is mostly incomplete (Hypša & Dale, 1997; Darby et al., 2005). To date, only a few of these symbionts have been successfully characterized and currently a trivial nomenclature system is in use to allow their distinction and classification (Gherna et al., 1991; Hypša & Dale, 1997; Dale & Maudlin, 1999).

    Candidatus Serratia symbiotica’ is currently described as an endosymbiont from multiple aphid families. Recent studies have demonstrated that it plays different roles in the heat tolerance of the host and in their protection against parasitoids (Chen et al., 2000; Montllor et al., 2002; Oliver et al., 2003; Burke et al., 2010). In the aphid subgenus Cinara, ‘Ca. S. symbiotica’ has a long-term relationship with its hosts and appears to be in a transition phase from a facultative to an obligate symbiont for host survival and reproduction (Gil et al., 2002; Gómez-Valero et al., 2004; Pérez-Brocal et al., 2006; Lamelas et al., 2008; Burke et al., 2009).

    In this study, the first isolation and in vitro culture of an endosymbiotic strain of ‘Ca. S. symbiotica’ from the flora of a natural clone of the aphid Aphis fabae is described. This strain is proposed as the type strain of the secondary endosymbiont Serratia symbiotica sp. nov.

    The novel strain, designated CWBI-2.3T, was isolated during the characterization of the microbiota of several laboratory and natural aphids collected in Belgium. The strain was among the flora of the natural clone of the black bean aphid Aphis fabae collected over a period corresponding to the first parthenogenetic generations (May 2009).

    For strain isolation, 40 specimens were surface-sterilized and extracted with 863 medium containing (l−1 distilled water) 10 g each of glucose, yeast extract and casein peptone. The extract was then plated on 868 agar medium (corresponding to 863 medium with 1.7 % agar). Colonies of strain CWBI-2.3T were visible after 2 weeks of incubation at 20 °C and the prevalence was about 103 c.f.u. mg−1. The flora of the collected A. fabae clone contained two other bacteria identified as Acinetobacter calcoaceticus (1.3×103 c.f.u. mg−1) and Pseudomonas viridiflava (0.7×103 c.f.u. mg−1).

    Colonies of strain CWBI-2.3T were circular, uniform in size with entire edges, not pigmented and appeared off-white, smooth and shiny. Morphological features were examined by light microscopy and transmission electron microscopy (100-SX; JEOL) (Fig. 1). The strain was motile, rod-like (0.5×0.8–1.3 µm) and appeared mainly as single cells or in pairs.

    Figure image not available in archive
    Fig. 1.

    (a) Transmission electron micrograph (TEM) of cells of strain CWBI-2.3T after incubation for 7 days on 868 agar medium. (b) TEM of a thin section of Aphis fabae showing the secondary symbiont (arrows) located in the bacteriosome in the cytoplasm of sheath cell (shc), (ss) secondary symbionts, (ps) primary symbionts. Bars, 1 µm (a); 5 µm (b).

    The novel strain was maintained in the laboratory for several months and used for all of the subsequent experiments described in this study. Long-term preservation was possible by freezing at −80 °C in culture medium with 20 % (w/v) glycerol.

    For strain identification, genomic DNA was extracted from cells grown at 20 °C for 120 h in 868 medium and purified by using a Wizard Genomic DNA purification kit (Promega). The primers used for PCR amplification of the 16S rRNA gene were the universal primers 16SP0 GAAGAGTTTGATCCTGGCTCAG and 16SP6 CTACGGCTACCTTGTTACGA (Ventura et al., 2001). The PCR product was purified using GFX PCR DNA and a Gel Band kit (GE Healthcare). Sequencing was achieved using a Big Dye v.3.1 kit and a 3730 DNA Analyzer (Applied Biosystems). The primers used for sequencing were F1 (CTGGCTCAGGAYGAACG), F2 (GAGGCAGCAGTRGGGAAT), F3 (ACACCARTGGCGAAGGC) and F4 (GCACAAGCGGYGGAGCAT) for the coding DNA segment, and R1 (CTGCTGGCACGTAGTTAG), R2 (AATCCTGTTYGCTMCCCA), R3 (CCAACATCTCACGACACG) and R4 (TGTGTAGCCCWGGTCRTAAG) for the non-coding DNA segment. The sequences obtained (400–600 bp) were then assembled by using the BioEdit program. The resulting sequence (1478 bp) of strain CWBI-2.3T was deposited in GenBank database with the accession number GU394001. The sequence of strain CWBI-2.3T was compared with other sequences in GenBank by using the blastn program (Altschul et al., 1997).

    The 16S rRNA gene sequence of the novel strain shared 99.9 % similarity with that of ‘Ca. Serratia symbiotica’ strains found in Aphis craccivora (1463/1464 bp) (Tsuchida et al., 2006). It was also closely related to ‘Ca. Serratia symbiotica’ strains found in Acyrthosiphon pisum (99.7 %) and Cinara cupressi (99.6 %) (Unterman et al., 1989; Fukatsu et al., 2000; Tsuchida et al., 2006; Lamelas et al., 2008; Burke et al., 2009).

    A comparison with 16S rRNA gene sequences of the type strains of free-living members of the genus Serratia showed that strain CWBI-2.3T shared 97.7 % similarity with Serratia ficaria, 97.5 % with Serratia entomophila, 97.4 % with Serratia plymuthica, 97.1 % with Serratia proteamaculans, 97.0 % with Serratia grimesii, 96.9 % with Serratia nematodiphila, 96.8 % with Serratia odorifera, 96.7 % with Serratia marcescens, 96.4 % with Serratia fonticola, 96 % with Serratia ureilytica, 96 % with Serratia glossinae and 95.6 % with Serratia rubidaea.

    Phylogenetic analysis was conducted by using mega 4.0 software (Tamura et al., 2007). Sequence similarity was estimated using the likelihood method and phylogenetic trees were constructed with the neighbour-joining method (Saitou & Nei, 1987). Bootstrap analysis (1000 resamplings) was used to evaluate the topology of the trees (Felsenstein, 1985).

    Recent phylogenetic reconstructions of lineages of symbiotic members of the genus Serratia have revealed the existence of two groups of ‘Ca. S. symbiotica’ in aphids (Lamelas et al., 2008; Burke et al., 2009). The first (cluster A) encompasses S-symbionts belonging to different subfamilies of the family Aphididae; Aphidinae, Chaitophorinae, Eriomatinae and some members of the subfamily Lachninae. The second (cluster B) comprises only endosymbionts of the genus Serratia from the subfamily Lachninae which are considered to be primary-type endosymbionts (Lamelas et al., 2008). The phylogenetic tree (Fig. 2) showed that strain CWBI-2.3T belonged to cluster A of the S-symbiont lineages.

    Figure image not available in archive
    Fig. 2.

    Phylogenetic position of strain CWBI-2.3T among ‘Ca. S. symbiotica’ strains of aphids. The evolutionary history was inferred using the neighbour-joining tree based on analysis of 16S rRNA gene sequence data. Endosymbionts are referenced by their aphid host taxa and by the GenBank accession numbers for their 16S rRNA gene sequences. Bootstrap values >50 % (expressed as percentages of 1000 replications) are shown at branch points. Bar, 0.01 substitutions per nucleotide position.

    For free-living species of the genus Serratia, phylogenetic affinities revealed two clusters. The first cluster (cluster II) included S. marcescens, S. rubidaea, S. liquefaciens, S. ureilytica, S. nematodiphila and S. odorifera. The second cluster (cluster I) included S. proteamaculans, S. grimesii, S. plymuthica, S. fonticola, S. entomophila and S. ficaria. Strain CWBI-2.3T clearly belonged to the second cluster (cluster I, Fig. 3).

    Figure image not available in archive
    Fig. 3.

    Phylogenetic position of strain CWBI-2.3T among related free-living species of the genus. The tree was generated using the neighbour-joining method and based on 16S rRNA gene sequence data analysis. Species are referenced by strain numbers and GenBank accession numbers for their 16S rRNA sequences. Bootstrap values are expressed as percentages of 1000 replications and are shown at branch points. Bar, 0.005 substitutions per nucleotide position.

    DNA–DNA hybridizations were performed with strain CWBI-2.3T and the three most closely related species in the second cluster (cluster I); S. ficaria, S. entomophila and S. plymuthica. The analysis was performed fluorometrically according to the method of Ezaki et al. (1989) using photobiotin-labelled DNA probes and microdilution wells. Strain CWBI-2.3T showed DNA–DNA relatedness values of 23 %, 22 % and 21 % with S. ficaria, S. entomophila and S. plymuthica, respectively. This indicated that the secondary symbiont of the aphid, strain CWBI-2.3T, represented a distinct species of the genus Serratia according to the criteria used for the delineation of bacterial species (Wayne et al., 1987).

    For DNA G+C analysis, genomic DNA was extracted and purified according to Gevers et al. (2001) and the G+C content was determined by HPLC (Mesbah et al., 1989). The DNA G+C content of CWBI-2.3T strain was 52.7 mol% and was similar to that found for S. liquefaciens (51.9 mol%) and S. fonticola (51.5 mol%), but was less than that determined for most free-living species of the genus Serratia (Grimont et al., 1982; Gavini et al., 1979). Genome size reduction and a low G+C content of the genomic DNA are common characteristics of endosymbiotic bacteria (Moran et al., 2008). The G+C content of the strain CWBI-2.3T was relatively low when compared with that of many free-living species of the genus Serratia; however, it was much higher than that reported for several other insect endosymbionts, in which the DNA G+C content is often below 33 mol% (Moran et al., 2008).

    The novel strain was able to grow aerobically and microaerobically at 0–4 % (w/v) NaCl and at 10–30 °C, with an optimum growth temperature of 25 °C. In an attempt to define a minimal medium for the growth of the novel strain, it was found that the strain was unable to grow on a mineral medium (MM) [0.2 % (NH4)2SO4; 0.2 % Na2SO4; 1.5 % K2HPO4; 0.05 % KH2PO4; 0.01 % MgSO4 . 7H2O and 0.003 % CaCl2] containing glucose (1 %) and the 20 amino acids (0.01 % each) (OD600>0.1). However, it was able to grow on MM containing 1 % glucose and 1 % casein peptone instead of pure amino acids (OD600 = 0.6). Weak growth was obtained on MM containing only casein peptone (1 %) (OD600 = 0.2). On 863 medium (containing 1 % each of glucose, casein peptone and yeast extract), growth reached an OD600 of 1.4.

    For the assimilation and acidification tests, API 20E, API 20NE and API 50CH strips (bioMérieux) were used and the incubation times were about 2 weeks for strain CWBI-2.3T and 24 h for the free-living Serratia strains. For the assimilation tests (API 20NE strips), the novel strain gave a positive result only for the assimilation of glucose and N-acetylglucosamine as a carbon source. However, the novel strain was unable to grow on arabinose, mannose, mannitol, maltose, gluconate, caprate, adipate, malate, citrate or phenylacetate. In acidification tests (API 50CH strips), strain CWBI-2.3T was weakly positive for acid production from glucose, sucrose and aesculin, but was unable to produce acid from the 46 remaining carbohydrates present on the strips (Table 1). With the API 20E strips, strain CWBI-2.3T was positive for the Voges–Proskauer reaction but gave a negative result for β-galactosidase, arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase, urease, tryptophan deaminase and gelatinase. The novel strain was also unable to reduce nitrate or produce H2S or indole. The strain was also negative in tests for DNase, lipase (Tween 80), lecithinase, chitinase and in the methyl red test.

    Table 1. Biochemical and physiological characteristics of strain CWBI-2.3T compared with the most closely related type strains of free-living taxa

    Taxa: 1, strain CWBI-2.3T; 2, S. ficaria LMG 7881T; 3, S. entomophila LMG 8456T; 4, S. plymuthica LMG 7886T; 5, S. grimesii LMG 7883T; 6, S. proteomaculans LMG 7887T. All strains were rod-shaped, motile and non-spore-forming. All strains were negative for indole and H2S production and for tryptophan deaminase, oxidase and urease. All strains assimilated N-acetylglucosamine. All strains were unable to grow on adipate and phenylacetate. All strains were able to produce acid from N-acetylglucosamine, aesculin, d-fructose, d-glucose and sucrose. All strains were unable to produce acid from erythritol, d-arabinose, l-xylose, d-adonitol, methyl β-d-xylopyranoside, l-sorbose, l-rhamnose, dulcitol, methyl α-d-mannopyranoside, methyl α-d-glucopyranoside, inulin, glycogen, xylitol, d-lyxose, d-tagatose, d-fucose, l-fucose or l-arabitol.

    Phenotypic characterization revealed that strain CWBI-2.3T was characterized by a highly restricted metabolic profile in comparison with the free-living members of the genus Serratia (Grimont et al., 1988; Ajithkumar et al., 2003; Bhadra et al., 2005; Zhang et al., 2009; Geiger et al., 2010). Indeed, in general, members of the genus Serratia are able to produce a wide range of hydrolases and to develop on many carbon sources. They are usually distinguished from other members of the family Enterobacteriaceae by their growth on mineral medium without growth factors, as well as by their acid production from maltose, mannitol and trehalose and by their ability to produce DNase, lipase, and gelatinase (Farmer et al., 1985). It appears that strain CWBI-2.3T has lost all these characteristics during its adaptation to its symbiotic life. In the genus Serratia, this kind of adaptation, with loss of metabolic diversity, has been previously reported for the biogroup 1 of S. marcescens. The latter has lost some of its metabolic activities through the natural selection of strains adapted to the human urinary tract (Farmer et al., 1985). For mutualistic intracellular bacteria in general, the loss of metabolic and genetic diversity is usually a consequence of evolution in a closed environment in which many molecules can be obtained from the host (Andersson & Kurland, 1998; Dale & Maudlin, 1999; Moran & Wernegreen, 2000; Dale & Moran, 2006). This loss of metabolic and genetic diversity is probably the main reason why many insect endosymbionts are difficult to isolate and characterize.

    For quantitative analysis of the cellular fatty acid composition, cells were grown aerobically for 24 h at 28 °C on TSA medium (BBL 11768). Inoculation and harvesting of cells were performed as described by the Microbial Identification System, Inc. (MIDI). The extraction and analysis were performed as prescribed by the MIDI system and the whole-cell fatty acid composition was determined using GC.

    The fatty acid profile of strain CWBI-2.3T was compared with those of some related free-living species of the genus Serratia (Table 2). Summed features 2 and 3 (comprising C12 : 0 alde, an unknown fatty acid with equivalent length 10.928 and C14 : 0 3-OH/C16 : 1 iso I, and C16 : 1ω7c/ iso C15 : 0 2-OH, respectively) were also among the predominant fatty acids of most of the strains, except for S. nematodiphila, in which summed feature 3 was present only in trace amounts but the amount of C19 : 0 cyclo ω7c was particularly high. The most marked differences between strain CWBI-2.3T and the free-living strains tested concerned the fatty acid C17 : 0 cyclo, which was absent from strain CWBI-2.3T and present in large amounts in most tested strains. The content of summed feature 3 was particularly high in strain CWBI-2.3T when compared with the level in the other species tested. Such differences confirmed that strain CWBI-2.3T represented a distinct and separate species within the genus Serratia.

    Table 2. Cellular fatty acid compositions of strain CWBI-2.3T and the type strains of some related free-living members of the genus Serratia

    Taxa: 1, strain CWB1-2.3T; 2, S. ficaria LMG 7881T; 3. S. entomophila LMG 8456T; 4, S. plymuthica LMG 7886T; 5, S. nematodiphila DZ0503SBS1T (data from Zhang et al., 2009); 6, S. odorifera LMG 7885T (data from the Sherlock MIS TSBA50 identification library); 7, S. marcescens DSM 30121T. tr, Trace amount (<1.0 %); −, not detected; nd, not determined.

    Strain CWBI-2.3T was highly sensitive to rifampicin, tetracycline and chloramphenicol (<10 µg ml−1). It was sensitive to streptomycin (10 µg ml−1), kanamycin (20 µg ml−1), ampicillin (20 µg ml−1), erythromycin (30 µg ml−1) and gentamicin (40 µg ml−1), but resistant to vancomycin.

    Due to their inability to grow axenically, no strain of ‘Ca. S. symbiotica’ has been isolated and characterized previously, as required for formal description of the species. Consequently, the taxon has previously been named under the Candidatus provision for the informal naming of uncultured representatives of new genera and species (Moran et al., 2005). As strain CWBI-2.3T is the first strain of ‘Ca. S. symbiotica’ to be purified and characterized, it is designated as the type strain of Serratia symbiotica sp. nov.

    The availability of a pure culture of S. symbiotica sp. nov. will provide valuable opportunities to promote the position of the species in the genus Serratia. The provisional name ‘Candidatus Serratia symbiotica’ has been assigned to many strains residing in several aphid species mainly on the basis of morphological observations and 16S rRNA gene sequence similarities. Even though the 16S rRNA gene sequences of strains of ‘Ca. S. symbiotica’ have shown very high similarities, they may actually belong to separate species and so warrant further investigation. The isolation of strain CWBI-2.3T should also stimulate further studies on the role of this species in aphids.

    The inactive biochemical profile of the novel species suggests that the loss of metabolic diversity could be gradual and it may be that phenotypic diversity may exist between strains of S. symbiotica. This diversity is probably a result of an overall evolution within the species which forms a continuum from partially free-living strains, such as strain CWBI-2.3T, to the highly host-dependent strain recently described in Cinara aphids (Pérez-Brocal et al., 2006).

    Description of Serratia symbiotica sp. nov.

    Serratia symbiotica [sym.bi.o′ti.ca. N.L. fem. adj. symbiotica (from Gr. n. sumbios a companion, partner) living together].

    Cells are motile, Gram-negative-staining rods (0.5×0.8–1.3 µm). Grows axenically on a rich medium containing glucose, casein peptone and yeast extract. Growth is optimal in aerobic conditions but growth also occurs in microaerobic conditions. On nutrient agar, colonies are circular, non-pigmented, off-white and smooth and shiny with entire margins. Cells grow at 10–30 °C (optimum, 25 °C), pH 6–8 (optimum, 7) and with 0–4 % (w/v) NaCl. Positive in tests for catalase and the Voges–Proskauer reaction. Negative result in tests for β-galactosidase, arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase, gelatinase, DNase, lipase (Tween 80), lecithinase, chitinase, caseinase and for the methyl red test. Assimilation and acidification tests, performed on API 20NE and API 50CH strips, give a positive result for the assimilation of glucose and N-acetyl-glucosamine. Weakly positive for acid production from glucose, sucrose and aesculin. Negative result for all remaining tests present on API 20NE and API 50CH strips. Whole-cell fatty acids are C10 : 0, C12 : 0, C14 : 0, an unknown fatty acid with equivalent length 14.502, C15 : 0 anteiso, C16 : 1ω5c, C16 : 0, C18 : 1ω7c, summed feature 2 (comprising C12 : 0 alde, unknown fatty acid with equivalent length 10.928, and C14 : 0 3-OH/C16 : 1 iso I) and summed feature 3 (comprising C16 : 1ω7c/C15 iso 2-OH).

    The type strain is CWBI-2.3T ( = LMG 25624T = DSM 23270T). The type strain is the R-type of the secondary endosymbiont associated symbiotically with a natural clone of Aphis fabae collected in Belgium. The bacterium lives in the host body and can be found in some host tissues and fluids, mostly in the bacteriosome in the cytoplasm of the sheath cells. The DNA G+C content of the type strain is 52.7 mol%.

    Acknowledgements

    This work was supported by ‘la Région Wallonne de Belgique’ convention Waleo2 no. 061/6288. We thank Dr V. Dhennin from the genotranscriptomics platform, GIGA, University of Liege () for 16S rRNA gene sequencing. We are indebted to Dr S. Van Trappen from the BCCM/LMG Bacterial Collection for their support in the characterization of the strain.

    References