Research Article

Transcriptional activation of human TR3/nur77 gene expression by human T-lymphotropic virus type I Tax protein through two AP-1-like elements

Journal of General Virology 1999; 80(12):3073

PubMed

With thanks to our partners for supporting this archive.

Abstract

The Tax transactivator of human T-lymphotropic virus type I (HTLV-I) is capable of inducing expression of the human immediate-early TR3/nur77 gene. Deletion and mutation analyses of the TR3/nur77 promoter demonstrated that multiple transcription elements in the 121 bp sequence proximal to the transcription start site are required for full Tax transactivation. Mutations of CArG-like, Ets and RCE motifs in this region severely decreased Tax transactivation. Mutation of either of the two identical AP-1-like elements (NAP 1 and 2) immediately upstream of the TATA box caused around 80% reduction of Tax transactivation. Mutation of both NAP elements blocked Tax-mediated activation totally. These two NAP elements could confer Tax-responsiveness on a heterologous basal promoter. Furthermore, the specific NAP-binding complex was only observed in HTLV-I-infected cells. Formation of this specific NAP-binding complex was correlated directly with Tax expression, as demonstrated in JPX-9 cells upon induction of Tax expression. The specific NAP binding could be competed for by consensus AP-1 and CREB elements, indicating that the NAP-binding proteins probably belong to the AP-1 and CREB/ATF transcription factor families. Supershift analysis with antibodies to both the AP-1 and CREB/ATF transcription factor families revealed that only anti-JunD antibody could partially shift this NAP-binding complex, indicating that JunD is a component of the NAP complex. This work suggests that JunD is involved in Tax-regulated TR3/nur77 expression.
Human T-lymphotropic virus type I (HTLV-I) is associated with adult T-cell leukaemia/lymphoma and tropical spastic paraparesis/HTLV-I-associated myelopathy (Gessain et al., 1985 ; Osame et al., 1986 ; Poiesz et al., 1980 ). The 3' region of the HTLV-I genome encodes a unique regulatory protein, Tax, which is essential for virus replication and also acts to deregulate numerous cellular genes (for reviews see Franchini, 1995 ; Yoshida, 1996 ). Tax regulates gene expression through interactions with cellular DNA-binding proteins. At present, several cellular transcription factors have been found to mediate Tax-dependent transactivation. The members of the cyclic AMP-responsive element-binding protein (CREB)/activating transcription factor (ATF) family, including CREB/CREM and ATF4, have been shown to interact with Tax to mediate HTLV-I expression through cAMP-responsive elements (CRE) in the HTLV-I long terminal repeats (LTR) (Adya & Giam, 1995 ; Franklin et al., 1993 ; Reddy et al., 1997 ; Suzuki et al., 1993b ; Zhao & Giam, 1992 ). ATF3, another member of the CREB/ATF transcription factor family, has been shown to interact with Tax at the CREs of the human proenkephalin promoter (Low et al., 1994 ). Tax can interact with several NF-κB/Rel proteins and mediate transactivation of many cellular genes in HTLV-I-infected cells, such as IL-2Rα, IL-1α, GM-CSF, c-myc and vimentin (Duyao et al., 1992 ; Hirai et al., 1992 , 1994 ; Leung & Nabel, 1988 ; Lilienbaum & Paulin, 1993 ; Mori & Prager, 1996 ; Nimer et al., 1989 ; Suzuki et al., 1993a ). Serum response factor (SRF), another major Tax-binding protein, mediates transactivation of several immediate-early genes in HTLV-I-infected cells, such as c-fos, egr-1 and egr-2 (Fujii et al., 1991 , 1992 , 1995 ; Suzuki et al., 1993a ). Tax has also been shown to interact with Ets, SP-1 and the B subunit of NF-Y transcription factor and to transactivate the PTHrP, c-sis/PDGF-B and MHC class II promoters (Dittmer et al., 1997 ; Pise-Masison et al., 1997 ; Trejo et al., 1996 , 1997 ).

Another immediate-early gene that can be upregulated by the Tax transactivator is TR3/nur77 (the human homologue of nur77, NGFI-B, N10 and TIS1, also termed NAK-1; in this report we use TR3/nur77) (Chen et al., 1998 ). TR3/nur77 has been found to be involved mainly in induction of T-cell apoptotic death (Liu et al., 1994 ; Woronicz et al., 1994 ). In particular, it has been shown to be activated by mitogenic serum growth factors in fibroblasts (Hazel et al., 1988 ; Ryseck et al., 1989 ), by nerve growth factor (NGF) and membrane depolarization in the pheochromocytoma cell line PC12 (Milbrandt, 1988 ; Yoon & Lau, 1993 , 1994 ) and by T-cell receptor signalling in immature thymocytes and T-cell hybridomas (Liu et al., 1994 ; Woronicz et al., 1994 ). Comparison of the 5'-flanking region of TR3/nur77 from different species (human, mouse and rat) shows that sequences within 250 bp of the promoter region from the transcription start site are well conserved. In this region, there are four AP-1-like elements, five consensus Sp1 motifs and also Ets, CArG and Egr motifs (Ryseck et al., 1989 ; Uemura et al., 1995 ; Watson & Milbrandt, 1989 ). In fibroblast cells, activation of TR3/nur77 by serum growth factors requires multiple transcription elements in the 126 bp promoter sequence immediately upstream of transcription start site and involves immediate-early and delayed-early biphasic transcriptional regulation. Activation by phorbol esters requires enhancer elements between nt -126 and -72 of the promoter region (Williams & Lau, 1993 ). In the rat pheochromocytoma-derived cell line PC-12, activation of TR3/nur77 by both NGF and membrane depolarization involves two AP-1-like elements and Sp1 elements between nt -60 and -30 of the promoter region. The two AP-1-like elements confer inducibility by NGF and membrane depolarization (Yoon & Lau, 1993 , 1994 ). In T lymphocytes, activation of TR3/nur77 by phorbol esters requires a promoter sequence between nt -378 and -162. The exact responsive elements in this region have not been confirmed because of two controversial results (Liu et al., 1994 ; Woronicz et al., 1994 ). Activation of TR3/nur77 by apoptotic signals delivered through T-cell receptor signalling requires the promoter sequence between nt -322 and -151 (Liu et al., 1994 ; Woronicz et al., 1994 ).

We have recently analysed the differential expression and regulation by Tax of TR3/nur77, NOR-1 and NOT in HTLV-I-infected cells (Chen et al., 1998 ). TR3/Nur77, NOR-1 and NOT are three closely related transcription factors that constitute the Nur77 subfamily belonging to the steroid/thyroid hormone receptor superfamily (Hazel et al., 1988 ; Mages et al., 1994 ; Milbrandt, 1988 ; Nakai et al., 1990 ; Ohkura et al., 1996 ; Ryseck et al., 1989 ; Watson & Milbrandt, 1989 ). We have demonstrated that only TR3/nur77 is highly expressed in HTLV-I-infected cells and that Tax is able to induce TR3/nur77 expression dramatically in JPX-9 cells, in which tax expression is under the control of an inducible promoter (Nagata et al., 1989 ). In continuation of our previous study, we sought to specify the mechanisms involved in Tax-regulated TR3/nur77 expression in more detail.

Cells.
The human T cell leukaemia cell line Jurkat (clone E6-1) and the acute lymphoblastic leukaemia cell line Molt-4 were obtained from ATCC (Mannassas, VA, USA). The HTLV-I-transformed lines MT-2 and C8166-45 were obtained through the NIH AIDS Research and Reference Reagent Program (Rockville, MD) and grown in RPMI-1640 medium supplemented with 10% foetal calf serum (Harada et al., 1985 ; Salahuddin et al., 1983 ). The Tax-inducible JPX-9 and control JPX/M lines were grown in RPMI-1640 medium supplemented with 10% foetal calf serum. Expression of biologically active Tax protein or a non-functional Tax mutant was induced by addition of CdCl2 to 10 µM final concentration (Nagata et al., 1989 ).

Plasmids.
Construction of deletion mutants of the human TR3/nur77 promoterchloramphenicol acetyltransferase (CAT) reporter vector was described previously (Uemura et al., 1995 ). pGL2-TR3P-124 was constructed by cutting p-151TR3CAT with SmaI and XmnI and inserting the promoter sequence into the SmaI site of the pGL2-basic plasmid (Promega). The correct orientation of the promoter sequence was confirmed by automated fluorescent-label sequencing. For construction of the basic luciferase (Luc) reporter vector pE1b-Luc, complementary oligonucleotides containing a minimal promoter of the adenovirus E1b gene (sense: 5' CTCGAGCTGCAGGGTATATAATGCGCCAGCTCAAGCTT) were synthesized, annealed and cloned into the XhoI/HindIII site of the pGL2-basic vector. To obtain the pE1b-NAP-Luc and pE1b-mu-NAP-Luc plasmids, complementary oligonucleotides containing a tandem repeat (underlined) of the wild-type (sense: 5' CCGGGCCTGCGTCAGTGGCGCTGCGTCACGGAGC) or mutated (sense: 5' CCGGGCCTGCAGAAGTGGCGCTGCAGAACGGAGC) NAP sites from the TR3/nur77 promoter were synthesized, annealed and cloned into the XmaI/XhoI site of pE1b-Luc. The control pCMV and Tax-expressing pCMV-Tax plasmids were described previously (Smith & Greene, 1990 ).

Site-directed in vitro mutagenesis of the human TR3/nur77 promoter.
The pGL2-TR3P-124 plasmid was used as a template for construction of the mutated promoters with the QuikChange site-directed mutagenesis kit (Stratagene). The following oligonucleotides were used for mutagenesis (substituted bases are underlined): CArG-like (5' CGCCCCCACGCGCCCGCGTATGGCCAAAGCTCG), Egr (5' GCGGCCTGCGTCAGTGGATAACCCGCCCCTCCCCGTGC), Ets (5' GGCCGCCTCCCGCCCTCACCGCACCGCCCCCACG), NAP-1 (5' CGACGGGCGGCCTGCAGAAGTGGCGCCCCCGC), NAP-2 (5' GCCCCTCCCCGTGCAGAACGGAGCGCTTAAGAG), RCE (5' GGAACCGCACCGCCCAAACGCGCCCTTGTATGG) and Sp1 (5' GCCTGCGTCAGTGGCGCCCCAAACCCTCCCCGTGCGTCACGG). All mutations were confirmed by DNA sequencing.

Transfection and reporter gene analysis.
All transfection experiments were performed in 6-well plates in triplicate with serum-free Optimem medium (Life Technologies). Jurkat cells were transfected by applying 4 µl liposome reagent DMRIE-C (Life Technologies) and 4 µg plasmid to 2x106 cells. After 5 h, the cultures were replenished with fresh supplemented medium. The cultures were grown for a further 48 h. Luciferase was extracted according to the manufacturers instructions (Promega) and activity was determined by a bioluminescent assay with an automated microplate luminometer (Labsystems). CAT activity was quantified with an ELISA kit (Boehringer). Activities in individual samples were normalized on the basis of protein content, which was determined by the bicinchoninic acid protein assay (Pierce).

Preparation of nuclear extracts.
Jurkat, Molt-4, C8166-45 and MT-2 cells were washed with PBS and resuspended in buffer A [10 mM HEPESKOH, pH 7·9; 1·5 mM MgCl2; 10 mM KCl; 1 mM sodium orthovanadate; 0·5 mM DTT; 1x protease inhibitor cocktail (Boehringer); 0·3 M sucrose and 0·1% NP-40]. After incubation for 15 min on ice, plasma membrane disruption was checked under a microscope. Nuclei were collected by centrifuging at 3300 g for 15 min at 4 °C. Pelleted nuclei were resuspended in buffer C (20 mM HEPESKOH, pH 7·9; 1·5 mM MgCl2; 0·4 M NaCl; 1 mM sodium orthovanadate; 0·5 mM DTT; 0·2 mM EDTA; 1x protease inhibitor cocktail and 25% glycerol) on ice with constant shaking for 30 min. Nuclear debris was removed by centrifugation at 25000 g for 30 min. The supernatant was collected and dialysed with buffer D (20 mM HEPESKOH, pH 7·9; 50 mM KCl; 1 mM sodium orthovanadate; 0·5 mM DTT; 0·2 mM EDTA; 1x protease inhibitor cocktail and 20% glycerol) for 60 min at 4 °C with the Microdialyser System 100 (Pierce).

Gel-shift and supershift analyses.
Nuclear extracts (10 µg) were incubated with 500010000 c.p.m. (0·5 ng) 32P-labelled NAP oligonucleotides (see below), 0·5 µg poly(dIdC) and 1 µg BSA in binding buffer (12 mM HEPESKOH, pH 7·9; 60 mM NaCl; 1 mM MgCl2; 1 mM DTT and 12% glycerol) in 10 µl final volume for 25 min at 37 °C. For competition analysis, a 50-fold molar excess of cold double-stranded oligonucleotides was added to the reaction mixture and incubated for 20 min on ice before the addition of the 32P-labelled NAP probe. The oligonucleotides and their corresponding sequences were (binding motifs are underlined): NAP (5' TCGAGCTCTCCATGCGTCACGGAGCGC 3'), mu-NAP (5' CCGGGCCTGCAGAAGTGGCGC 3'), AP-1 (5' CTAGTGATGAGTCAAGCCGGATC 3'), AP-2 (5' GATCGAACTGACCGCCCGCGGGCCCGT 3'), CREB (5' GATTGGCTGACGTCAGAGAGCT 3'), Sp1 (5' GATCGATCGGGGCGGGGCGATC 3'), NF-κB (5' GATCGAGGGGACTTTCCCTAGC 3') and Oct-1 (5' GATCGAATGCAAATCACTAGCT 3').

For supershift analysis, 1 µg anti-CREB, anti-CREM, anti-ATF1, anti-ATF2, anti-ATF3, anti-ATF4(CREB2), anti-c-jun, anti-junB, anti-junD, anti-c-fos, anti-fosB, anti-fra1 or anti-fra2 antibody (all purchased from Santa Cruz Biotechnology) was incubated with 10 µg nuclear extract in 10 µl volume after the addition of NAP probe to the reaction mixture for 25 min at 37 °C. The complexes were resolved by electrophoresis in a 4% polyacrylamide gel (1:40 bisacrylamide/acrylamide) in 0·25x TBE buffer at 4 °C and visualized with an InstantImager (Packard Instruments).

Deletion analysis of the Tax-responsive region in the human TR3/nur77 promoter
We have demonstrated previously that Tax can transactivate the 2149 bp TR3/nur77 promoter in a broad range of cell types (Chen et al., 1998 ). Since the TR3/nur77 promoter sequence contains widely scattered putative transcription factor-binding sites, we performed 5'-end deletion analysis of the TR3/nur77 promoter. A series of 5'-deletants of the TR3/nur77 promoter were co-transfected with control and Tax-expressing pCMV-Tax plasmid. The results showed that each of the six deletants, which covered 121, 151, 199, 314, 427 and 940 bp upstream of the transcription initiation site, displayed responsiveness to Tax comparable to that of the wild-type promoter (Fig. 1). Deletion of the CREB-binding site at position -683 (p-427TR3CAT; numbering is relative to the transcription initiation site according to Uemura et al., 1995 ) had no significant effect even though the CREB pathway has previously been established to be one of the pathways mediating Tax responsiveness. Similarly, neither of the two AP-1-binding site-like elements further downstream at positions -200 and -180 appeared to be effective in Tax transactivation (p-199TR3CAT, p-151TR3CAT). Thus, all indispensable regulatory elements seem to be in the 121 bp sequence upstream of the transcription start site that was encompassed in the shortest promoter (p-121TR3CAT). In order to confirm this result, we recloned this short promoter sequence (-124 to +81 bp of the TR3/nur77 promoter) into the pGL2-basic reporter vector (referred to as pGL2-TR3P-124). Co-transfection of pGL2-TR3P-124 with pCMVTax showed around 1520-fold activation (Fig. 2B), which was comparable to the result with the 2149 bp promoter.



(37K):

Fig. 1. Deletion analysis of the TR3/nur77 promoter sequence responsive to Tax transactivation. The CAT reporter vectors containing 1212149 bp of the TR3/nur77 promoter sequence upstream of the transcription start site were co-transfected together with the control pCMV (open bars) or pCMV-Tax (hatched bars) plasmid in Jurkat cells. Transient expression of the reporter gene was quantified by ELISA after the samples were normalized for protein content. Bars represent means±SEM of three replicates.


(19K):

Fig. 2. Site-directed mutation analysis of theTR3/nur77 promoter. (A) Illustration of the sequence of theTR3/nur77 promoter and its mutations. Putative transcription-enhancer sites are indicated in boxes. Nucleotides are numbered according to Uemura et al. (1995) . The wild-type and mutant TR3/nur77 promoter reporter vectors were co-transfected with the control pCMV or pCMV-Tax plasmid in Jurkat cells and analysed for reporter gene expression. After the background values obtained with pCMV were subtracted, wild-type promoter activity was arbitrarily given a value of 1 and the activities of the mutated promoters were adjusted relative to this activity. (B) Activities of the mutated TR3/nur77 promoters after co-transfection with the control pCMV (open bars) or pCMV-Tax (hatched bars) plasmid. Transient expression of the reporter gene was determined by a standard luciferase bioluminescence assay after the samples were normalized for protein content. Bars represent means±SEM of three replicates.

Site-directed mutation analysis of cis-acting elements of the TR3/nur77 promoter responsive to full Tax transactivation
To define the cis-acting elements required for Tax responsiveness, we analysed the minimal promoter sequence with the TESS program against the transcription factor database TRANSFAC (Heinemeyer et al., 1998 ). Several candidate binding motifs that might possibly respond to Tax transactivation were identified (Fig. 2A). Previously, these motifs have been found to mediate activation by Tax of a number of promoters. In order to pinpoint the specific binding motifs responsive to Tax transactivation, we created a series of point mutations to disrupt the consensus binding motifs. The GC-rich region between the two AP-1-like (NAP) sites contains two Sp1 and one Egr sites overlapping each other; to distinguish whether any of these elements were required for activation, mutations were created to disrupt only one or other of them (Egr and Sp1; Fig. 2A). The activities of the mutated promoters were evaluated in a transient co-transfection assay and compared with that of the wild-type promoter. The results are shown in Fig. 2(B). Mutations of the Egr and Sp1 sites had the least effect and resulted in decreases of 35 and 41% from the original activity, respectively, whereas mutations of CArG-like, Ets and RCE motifs had more significant impact, resulting in decreases of 60, 61 and 71%, respectively. Mutation of either of the two NAP motifs resulted in a decrease of about 78% from the original activity. Furthermore, knocking out both NAP motifs (mutation NAP-1+2) completely abolished Tax transactivation (Fig. 2B). These results provide evidence that several cis-acting elements contribute to transactivation of the TR3/nur77 promoter by Tax. Nevertheless, the two NAP elements immediately upstream of the TATA box appear to play an essential role in Tax-regulated TR3/nur77 expression.

Tax-responsiveness of the NAP elements in a heterologous minimal promoter
In order to characterize further the functional responsiveness of the two NAP elements to Tax transactivation, these two NAP elements and mutated NAP elements with surrounding sequence from the TR3/nur77 promoter were cloned into the pE1b-luc reporter vector, which contains a basal E1b promoter sequence (pE1b-NAP-luc and pE1b-mu-NAP-luc). Co-transfection of pE1b-NAP-luc with Tax showed an increase in luciferase activity of around 7-fold and co-transfection with the mutant NAP reporter (pE1b-mu-NAP-luc) did not show any induction, which indicated the specific response of the NAP elements (Fig. 3). This result further supported the independent Tax responsiveness of these two NAP elements in Tax-regulated TR3/nur77 expression.



(16K):

Fig. 3. Tax-responsiveness of two NAP elements on a heterologous minimal E1b promoter. Tandem repeats of the wild-type and mutated NAP elements from theTR3/nur77 promoter, also containing parts of the adjacentsequence, were cloned upstream of the minimal adenovirus E1b promoter of the Luc-reporter vector pE1b-Luc. All reporter vectors were co-transfected with the control pCMV (open bars) or pCMV-Tax (hatched bars) plasmid in Jurkat cells and analysed for reporter gene expression. Bars represent means±SEM of three replicates.

Gel-shift analysis of NAP binding in Tax-expressing, HTLV-I-infected cells
In order to study the transcription factors that mediate the Tax effect by binding to the NAP element in HTLV-I-infected cells, a DNA probe containing a single NAP motif including the adjacent sequence from the TR3/nur77 promoter was used to perform electrophoretic mobility shift assays. Specific NAP binding was only observed in HTLV-I-infected MT-2 and C8166-45 cells, which express Tax protein, and not in HTLV-I-negative Jurkat or Molt-4 cells (Fig. 4a). In order to analyse the correlation between expression of Tax and the observed NAP binding in HTLV-I-infected cells, we analysed specific NAP-binding activity in JPX-9 and JPX/M cells. These cell lines are both Jurkat-derived, stably transfected with the wild-type (JPX-9) or mutated (JPX/M) tax gene under the control of the inducible metallothionein promoter (Nagata et al., 1989 ). Induction of Tax was achieved upon treatment of cells with 10 µM CdCl2, as shown in Fig. 4(B). No specific NAP binding was observed in JPX/M cells before or after the addition of 10 µM CdCl2. Induction of Tax expression in JPX-9 cells significantly increased NAP binding (Fig. 4B), indicating that this specific NAP binding is correlated with Tax expression in these cells.



(62K):

Fig. 4. NAP-specific electrophoretic mobility shift analysis of HTLV-I-infected and Tax-expressing cells. (A) NAP-binding activities in nuclear extracts from HTLV-I-negative Jurkat and Molt-4 cells and HTLV-I-infected MT-2 and C8166-45 cells. (B) NAP-binding activities in cells of the Jurkat-derivatives JPX/M and JPX-9 stably transfected with mutant or wild-type Tax expression plasmids, respectively, under the control of an inducible promoter. Induction of Tax expression was achieved by addition of 10 µM CdCl2 to the culture medium for 12 h. Expression of Tax in these cells was detected by Western blotting with the Tax-specific antibody Lt-4 (Tanaka et al., 1990 ).

Characterization of the NAP-binding complex in HTLV-I-infected cells
In order to identify specific transcription factors that bind to the NAP elements of the TR3/nur77 promoter in HTLV-I-infected cells, we performed competition analysis with cold probes containing consensus binding motifs of different transcription factors. Competition analysis with MT-2 nuclear extracts showed that NAP binding was effectively abolished by excesses of the AP-1 and CREB probes, but not by cold AP-2, NF-κB, Sp1 or Oct-1 probes (Fig. 5A), thereby suggesting that transcription factors from the AP-1 and CREB families are involved in Tax-regulated TR3/nur77 expression. The same result was obtained with C8166-45 cells (data not shown). This result further corroborates our previous observation that the CREB-defective Tax mutant M47 is unable to transactivate the TR3/nur77 promoter (Chen et al., 1998 ). Next, we employed specific antibodies in supershift analysis to specify in detail which members of the CREB/ATF and AP-1 transcription factor families were bound in complexes with the NAP element (referred to as the NAP-binding complex). Among the antibodies tested, only the anti-JunD antibody partially shifted the NAP-binding complex. None of the CREB/ATF or other AP-1 family members was detected in the NAP-binding complex. Consistent results were obtained from both MT-2 and C8166-45 cells (Fig. 5B; data not shown for C8166-45 cells). Because the responsiveness of CREB to Tax is well-characterized in transactivation of the HTLV-I LTR through CRE-like elements, we performed the supershift analysis carefully with two different CREB-specific antibodies and one CREM-specific antibody (clones C-21 and X-12 for CREB and clone X-12 for CREM; Santa Cruz Biotechnology). None of them shifted the NAP-binding complex (data not shown). We also checked whether members of the NT-AT transcription factor family could bind to the NAP element, since NF-AT has been found to form a complex with AP-1 transcription factors to regulate gene expression through some non-consensus AP-1 elements and NF-AT can mediate Tax-regulated interleukin-2 expression (Good et al., 1997 ). We employed an anti-NF-AT antibody (clone K-18, Santa Cruz Biotechnology) that can recognize NFATc1, NFATc2, NFATc3 and NFATc4 specifically. Our result indicated that the anti-NF-AT antibody could not shift the NAP-binding complex (data not shown), indicating that NF-AT transcription factors are not involved in Tax-regulated TR3/nur77 expression. Combination of the anti-JunD antibody with antibodies against other members of the CREB/ATF, AP-1 and NF-AT transcription factor families did not shift the NAP-binding complex further (data not shown).



(58K):

Fig. 5. Analysis of the specific components of the NAP-binding complex in HTLV-I-infected cells. (A) Competition analysis of NAP-binding activity in MT-2 nuclear extract in the presence of 50-fold molar excesses of cold probes containing the consensus DNA-binding elements indicated; (-), no cold probe added. (B) Supershift analysis of the NAP-binding complex with antibodies against CREB/ATF and AP-1 transcription factor families. Nuclear extracts (10 µg) from MT-2 cells were incubated with specific antibodies as indicated; (-), no antibody added.
HTLV-I Tax transactivates the HTLV-I LTR and numerous cellular genes potently through interaction with cellular transcription factors including CREB/ATF proteins, NF-κB, SRF, Ets, Sp1 and NF-Y (Dittmer et al., 1997 ; Franklin et al., 1993 ; Fujii et al., 1992 , 1995 ; Low et al., 1994 ; Pise-Masison et al., 1997 ; Reddy et al., 1997 ; Suzuki et al., 1993a , b ; Trejo et al., 1996 , 1997 ; Zhao & Giam, 1992 ). In this study, we have investigated the role of Tax and specific cellular transcription factors in transactivation of TR3/nur77 expression in HTLV-I-infected cells. The TR3/nur77 promoter was subjected to deletion and mutation analyses to define Tax-responsive elements. The 121 bp sequence immediately upstream of the transcription initiation site conferred full Tax responsiveness. There are multiple cis-acting elements in this promoter region, including Ets, RCE, CArG-like and Egr motifs, two overlapping Sp1 sites and two AP-1-like (NAP) elements. Mutations of any of these elements decreased Tax transactivation severely, showing that multiple transcription factors are involved in high-level expression of TR3/nur77 in HTLV-I-infected cells. Mutations of both NAP motifs abolished Tax transactivation totally, showing that these two NAP elements are critical for Tax transactivation. By introducing the two NAP elements into the minimal E1b promoter, we showed that these two NAP elements responded to Tax transactivation, indicating that these two NAP elements can essentially confer Tax-regulated TR3/nur77 expression.

In a literature search, we found that the fra-1 and proenkephalin genes are also regulated by Tax through identical NAP elements (Low et al., 1994 ; Tsuchiya et al., 1993 ). The NAP element (TGCGTCA) has also been designated as the CRE-2 or FAP element (Hai & Curran, 1991 ; Velcich & Ziff, 1990 ; Yoon & Lau, 1993 , 1994 ). It closely resembles the consensus AP-1 element (TGAG/CTCA) and the CRE sequence (TGACGTCA). The two NAP elements in the TR3/nur77 promoter are flanked by GC-rich sequences. Recent results of analysis of Tax-mediated HTLV-I LTR activity demonstrated that GC-rich sequences flanking the CRE motif of the HTLV-I LTR are crucial for TaxCREBDNA ternary complex assembly and that Tax can interact directly with the flanking GC-rich sequences (Lenzmeier et al., 1998 ). The GC-rich sequences flanking the NAP motifs in the TR3/nur77 promoter may thus provide direct interaction with the Tax protein. In our work, we have shown that a DNA probe containing the NAP motif and the flanking GC-rich sequence forms a specific DNAprotein-binding complex in Tax-expressing, HTLV-I-infected cells. This specific binding could be competed for efficiently by the consensus AP-1 and CRE elements, showing that the proteins forming a complex with the NAP element may belong to the AP-1 and/or CREB/ATF transcription factor families. As we have shown here, JunD is a part of this complex. JunD is expressed constitutively at high levels in T cells and other tissues (Chiu et al., 1989 ; Hirai et al., 1989 ; Farina et al., 1993 ). Unmodified and in the absence of other factors, JunD forms unstable complexes with DNA (Nakabeppu & Nathans, 1989 ; Ryder et al., 1989 ). JunD can form heterodimers with ATF3 and bind to the NAP element in vitro (Hai & Curran, 1991 ). Earlier work by Low et al. (1994) showed that ATF3 can collaborate with Tax in regulation of proenkephalin expression in F9 cells. Recombinant Tax protein can increase in vitro binding of ATF3 to the NAP element dramatically. However, the authors did not provide any data that showed ATF3 binding in vivo to the NAP element in HTLV-I-infected cells. Our gel-shift analysis indicated that none of the characterized Fos family members (c-Fos, FosB, Fra1 or Fra2) or CREB/ATF members (CREB, CREM, ATF1, ATF2, ATF3, ATF4 and B-ATF) are components of this NAP-binding complex and that none of them collaborates with JunD in response to Tax transactivation of TR3/nur77 expression in F9 cells (data not shown).

The work of Yoon & Lau (1993 , 1994 ) showed that TR3/nur77 can also be induced transiently by NGF and membrane depolarization in PC12 cells through the two NAP elements. JunD can also stimulateTR3/nur77 expression in PC-12 cells, and a JunD dominant-negative mutant blocks TR3/nur 77 activation by NGF and membrane depolarization. However, JunD alone does not bind to the NAP element. Also, these authors could not define a specific JunD partner in response to NGF and membrane depolarization. Earlier work showed that an uncharacterized protein distinct from either Fos, Jun or other known proteins forms a complex with JunD that can be induced rapidly in T cells by phorbol esters in the absence of protein synthesis (Gardner et al., 1994 ; Farina et al., 1993 ). Because unstimulated T cells do not express four characterized Fos-related proteins (c-Fos, FosB, Fra1 and Fra2), it is impossible for JunD to form heterodimers with these proteins to regulate expression of immediate-early genes during the immediate-early stage of T-cell stimulation. Our ongoing work also suggests that a new protein, different from any currently characterized AP-1 or CREB/ATF transcription factor, is a component of the NAP-binding complex in HTLV-I-infected cells. It seems that this uncharacterized JunD-binding protein can form a heterodimer with JunD to bind specifically to the NAP element in response to diverse stimuli.

We are grateful to Warner Greene (San Francisco, CA) for providing Tax-expressing plasmids, Masataka Nakamura (Tokyo, Japan) for providing the JPX-9 and JPX/M cell lines and Yuetsu Tanaka (Kanagawa, Japan) for providing the anti-Tax antibody Lt-4. The following reagents were obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: MT-2 from Douglas Richman; C8166-45 from Robert Gallo. This work was supported by the Danish Cancer Society grant no. 97 215 58 to X.D.L. and in part by EU grant PL 941593. The Aarhus group is a member of the HTLV European Research Network, which is the concerted action program of ECC.

References

Adya, N. & Giam, C. Z. (1995). Distinct regions in human T-cell lymphotropic virus type I Tax mediate interactions with activator protein CREB and basal transcription factors. Journal of Virology 69, 1834-1841.[Abstract]

Chen, X. L., Zachar, V., Chang, C. S., Ebbesen, P. & Liu, X. D. (1998). Differential expression of Nur77 family members in human T-lymphotropic virus type 1-infected cells: transactivation of the TR3/nur77 gene by Tax protein. Journal of Virology 72, 6902-6906.[Abstract/Free Full Text]

Chiu, R., Angel, P. & Karin, M. (1989). Jun-B differs in its biological properties from, and is a negative regulator of, c-Jun. Cell 59, 979-986.[Medline]

Dittmer, J., Pise-Masison, C. A., Clemens, K. E., Choi, K. S. & Brady, J. N. (1997). Interaction of human T-cell lymphotropic virus type I Tax, Ets1, and Sp1 in transactivation of the PTHrP P2 promoter. Journal of Biological Chemistry 272, 4953-4958.[Abstract/Free Full Text]

Duyao, M. P., Kessler, D. J., Spicer, D. B., Bartholomew, C., Cleveland, J. L., Siekevitz, M. & Sonenshein, G. E. (1992). Transactivation of the c-myc promoter by human T cell leukemia virus type 1 tax is mediated by NFκB. Journal of Biological Chemistry 267, 16288-16291.[Abstract/Free Full Text]

Farina, A. R., Davis-Smyth, T., Gardner, K. & Levens, D. (1993). An early response of an AP1junD complex during T-cell activation. Journal of Biological Chemistry 268, 26466-26475.[Abstract/Free Full Text]

Franchini, G. (1995). Molecular mechanisms of human T-cell leukemia/lymphotropic virus type I infection. Blood 86, 3619-3639.[Free Full Text]

Franklin, A. A., Kubik, M. F., Uittenbogaard, M. N., Brauweiler, A., Utaisincharoen, P., Matthews, M. A. H., Dynan, W. S., Hoeffler, J. P. & Nyborg, J. K. (1993). Transactivation by the human T-cell leukemia virus Tax protein is mediated through enhanced binding of activating transcription factor-2 (ATF-2) response and cAMP element-binding protein (CREB). Journal of Biological Chemistry 268, 21225-21231.[Abstract/Free Full Text]

Fujii, M., Niki, T., Mori, T., Matsuda, T., Matsui, M., Nomura, N. & Seiki, M. (1991). HTLV-1 Tax induces expression of various immediate early serum responsive genes. Oncogene 6, 1023-1029.[Medline]

Fujii, M., Tsuchiya, H., Chuhjo, T., Akizawa, T. & Seiki, M. (1992). Interaction of HTLV-1 Tax1 with p67SRF causes the aberrant induction of cellular immediate early genes through CArG boxes. Genes & Development 6, 2066-2076.[Abstract/Free Full Text]

Fujii, M., Chuhjo, T., Minamino, T., Masaaki, N., Miyamoto, K. I. & Seiki, M. (1995). Identification of the Tax interaction region of serum response factor that mediates the aberrant induction of immediate early genes through CArG boxes by HTLV-I Tax. Oncogene 11, 7-14.[Medline]

Gardner, K., Moore, T. C., Davis-Smyth, T., Krutzsch, H. & Levens, D. (1994). Purification and characterization of a multicomponent AP-1·junD complex from T cells. Journal of Biological Chemistry 269, 32963-32971.[Abstract/Free Full Text]

Gessain, A., Barin, F., Vernant, J. C., Gout, O., Maurs, L., Calender, A. & de The, G. (1985). Antibodies to human T-lymphotropic virus type-I in patients with tropical spastic paraparesis. Lancet ii, 407410.

Good, L., Maggirwar, S. B., Harhaj, E. W. & Sun, S. C. (1997). Constitutive dephosphorylation and activation of a member of the nuclear factor of activated T cells, NF-AT1, in Tax-expressing and type I human T-cell leukemia virus-infected human T cells. Journal of Biological Chemistry 272, 1425-1428.[Abstract/Free Full Text]

Hai, T. & Curran, T. (1991). Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proceedings of the National Academy of Sciences, USA 88, 3720-3724.[Abstract/Free Full Text]

Harada, S., Koyanagi, Y. & Yamamoto, N. (1985). Infection of HTLV-III/LAV in HTLV-I-carrying cells MT-2 and MT-4 and application in a plaque assay. Science 229, 563-566.[Abstract/Free Full Text]

Hazel, T. G., Nathans, D. & Lau, L. F. (1988). A gene inducible by serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily. Proceedings of the National Academy of Sciences, USA 85, 8444-8448.[Abstract/Free Full Text]

Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A. E., Kel, O. V., Ignatieva, E. V., Ananko, E. A., Podkolodnaya, O. A., Kolpakov, F. A., Podkolodny, N. L. & Kolchanov, N. A. (1998). Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Research 26, 362-367.[Abstract/Free Full Text]

Hirai, S. I., Ryseck, R. P., Mechta, F., Bravo, R. & Yaniv, M. (1989). Characterization of junD: a new member of the jun proto-oncogene family. EMBO Journal 8, 1433-1439.[Medline]

Hirai, H., Fujisawa, J., Suzuki, T., Ueda, K., Muramatsu, M., Tsuboi, A., Arai, N. & Yoshida, M. (1992). Transcriptional activator Tax of HTLV-1 binds to the NF-κB precursor p105. Oncogene 7, 1737-1742.[Medline]

Hirai, H., Suzuki, T., Fujisawa, J., Inoue, J. & Yoshida, M. (1994). Tax protein of human T-cell leukemia virus type I binds to the ankyrin motifs of inhibitory factor κB and induces nuclear translocation of transcription factor NF-κB proteins for transcriptional activation. Proceedings of the National Academy of Sciences, USA 91, 3584-3588.[Abstract/Free Full Text]

Lenzmeier, B. A., Giebler, H. A. & Nyborg, J. K. (1998). Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter. Molecular and Cellular Biology 18, 721-731.[Abstract/Free Full Text]

Leung, K. & Nabel, G. J. (1988). HTLV-1 transactivator induces interleukin-2 receptor expression through an NF-kappa B-like factor. Nature 333, 776-778.[Medline]

Lilienbaum, A. & Paulin, D. (1993). Activation of the human vimentin gene by the Tax of human T-cell leukemia virus. I. Mechanism of regulation by the NF-kappa B transcription factor. Journal of Biological Chemistry 268, 2180-2188.[Abstract/Free Full Text]

Liu, Z. G., Smith, S. W., McLaughlin, K. A., Schwartz, L. M. & Osborne, B. A. (1994). Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene nur77. Nature 367, 281-284.[Medline]

Low, K. G., Chu, H. M., Schwartz, P. M., Daniels, G. M., Melner, M. H. & Comb, M. J. (1994). Novel interactions between human T-cell leukemia virus type I Tax and activating transcription factor 3 at a cyclic AMP-responsive element. Molecular and Cellular Biology 14, 4958-4974.[Abstract/Free Full Text]

Mages, H. W., Rilke, O., Bravo, R., Senger, G. & Kroczek, R. A. (1994). NOT, a human immediate-early response gene closely related to the steroid/thyroid hormone receptor NAK1/TR3. Molecular Endocrinology 8, 1583-1591.[Abstract/Free Full Text]

Milbrandt, J. (1988). Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene. Neuron 1, 183-188.[Medline]

Mori, N. & Prager, D. (1996). Transactivation of the interleukin-1α promoter by human T-cell leukemia virus type I and type II Tax proteins. Blood 87, 3410-3417.[Abstract/Free Full Text]

Nagata, K., Ohtani, K., Nakamura, M. & Sugamura, K. (1989). Activation of endogenous c-fos proto-oncogene expression by human T-cell leukemia virus type I-encoded p40tax protein in the human T-cell line, Jurkat. Journal of Virology 63, 3220-3226.[Abstract/Free Full Text]

Nakabeppu, Y. & Nathans, D. (1989). The basic region of Fos mediates specific DNA binding. EMBO Journal 8, 3833-3841.[Medline]

Nakai, A., Kartha, S., Sakurai, A., Toback, F. G. & DeGroot, L. J. (1990). A human early response gene homologous to murine nur77 and rat NGFI-B, and related to the nuclear receptor superfamily. Molecular Endocrinology 4, 1438-1443.[Abstract/Free Full Text]

Nimer, S. D., Gasson, J. C., Hu, K., Smalberg, I., Williams, J. L., Chen, I. S. & Rosenblatt, J. D. (1989). Activation of the GM-CSF promoter by HTLV-I and -II tax proteins. Oncogene 4, 671-676.[Medline]

Ohkura, N., Ito, M., Tsukada, T., Sasaki, K., Yamaguchi, K. & Miki, K. (1996). Structure, mapping and expression of a human NOR-1 gene, the third member of the Nur77/NGFI-B family. Biochimica et Biophysica Acta 1308, 205-214.[Medline]

Osame, M., Usuku, K., Izumo, S., Ijichi, N., Amitani, H., Igata, A., Matsumoto, M. & Tara, M. (1986). HTLV-I associated myelopathy, a new clinical entity. Lancet i, 10311032.

Pise-Masison, C. A., Dittmer, J., Clemens, K. E. & Brady, J. N. (1997). Physical and functional interaction between the human T-cell lymphotropic virus type 1 Tax1 protein and the CCAAT binding protein NF-Y. Molecular and Cellular Biology 17, 1236-1243.[Abstract]

Poiesz, B. J., Ruscetti, F. W., Gazdar, A. F., Bunn, P. A., Minna, J. D. & Gallo, R. C. (1980). Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proceedings of the National Academy of Sciences, USA 77, 7415-7419.[Abstract/Free Full Text]

Reddy, T. R., Tang, H., Li, X. & Wong-Staal, F. (1997). Functional interaction of the HTLV-1 transactivator Tax with activating transcription factor-4 (ATF4). Oncogene 14, 2785-2792.[Medline]

Ryder, K., Lanahan, A., Perez-Albuerne, E. & Nathans, D. (1989). jun-D: a third member of the jun gene family. Proceedings of the National Academy of Sciences, USA 86, 1500-1503.[Abstract/Free Full Text]

Ryseck, R. P., Macdonald-Bravo, H., Mattei, M. G., Ruppert, S. & Bravo, R. (1989). Structure, mapping and expression of a growth factor inducible gene encoding a putative nuclear hormonal binding receptor. EMBO Journal 8, 3327-3335.[Medline]

Salahuddin, S. Z., Markham, P. D., Wong-Staal, F., Franchini, G., Kalyanaraman, V. S. & Gallo, R. C. (1983). Restricted expression of human T-cell leukemialymphoma virus (HTLV) in transformed human umbilical cord blood lymphocytes. Virology 129, 51-64.[Medline]

Smith, M. R. & Greene, W. C. (1990). Identification of HTLV-I tax trans-activator mutants exhibiting novel transcriptional phenotypes. Genes & Development 4, 1875-1885.[Abstract/Free Full Text]

Suzuki, T., Hirai, H., Fujisawa, J. I., Fujita, T. & Yoshida, M. (1993a). A trans-activator Tax of human T-cell leukemia virus type 1 binds to NF-κB p50 and serum response factor (SRF) and associates with enhancer DNAs of the NF-κB site and CArG box. Oncogene 8, 2391-2397.[Medline]

Suzuki, T., Fujisawa, J. I., Toita, M. & Yoshida, M. (1993b). The trans-activator Tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with cAMP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair enhancer of HTLV-1. Proceedings of the National Academy of Sciences, USA 90, 610-614.[Abstract/Free Full Text]

Tanaka, Y., Yoshida, A., Takayama, Y., Tsujimoto, H., Tsujimoto, A., Hayami, M. & Tozawa, H. (1990). Heterogeneity of antigen molecules recognized by anti-tax1 monoclonal antibody Lt-4 in cell lines bearing human T cell leukemia virus type I and related retroviruses. Japanese Journal of Cancer Research 81, 225-231.[Medline]

Trejo, S. R., Fahl, W. E. & Ratner, L. (1996). c-sis/PDGF-B promoter transactivation by the Tax protein of human T-cell leukemia virus type 1. Journal of Biological Chemistry 271, 14584-14590.[Abstract/Free Full Text]

Trejo, S. R., Fahl, W. E. & Ratner, L. (1997). The Tax protein of human T-cell leukemia virus type 1 mediates the transactivation of the c-sis/platelet-derived growth factor-B promoter through interactions with the zinc finger transcription factors Sp1 and NGFI-A/Egr-1. Journal of Biological Chemistry 272, 27411-27421.[Abstract/Free Full Text]

Tsuchiya, H., Fujii, M., Niki, T., Tokuhara, M., Matsui, M. & Seiki, M. (1993). Human T-cell leukemia virus type 1 Tax activates transcription of the human fra-1 gene through multiple cis elements responsive to transmembrane signals. Journal of Virology 67, 7001-7007.[Abstract/Free Full Text]

Uemura, H., Mizokami, A. & Chang, C. S. (1995). Identification of a new enhancer in the promoter region of the human TR3 orphan receptor gene, a member of the steroid receptor superfamily. Journal of Biological Chemistry 270, 5427-5433.[Abstract/Free Full Text]

Velcich, A. & Ziff, E. B. (1990). Functional analysis of an isolated fos promoter element with AP-1 site homology reveals cell type-specific transcriptional properties. Molecular and Cellular Biology 10, 6273-6282.[Abstract/Free Full Text]

Watson, M. A. & Milbrandt, J. (1989). The NGFI-B gene, a transcriptionally inducible member of the steroid receptor gene superfamily: genomic structure and expression in rat brain after seizure induction. Molecular and Cellular Biology 9, 4213-4219.[Abstract/Free Full Text]

Williams, G. T. & Lau, L. F. (1993). Activation of the inducible orphan receptor gene nur77 by serum growth factors: dissociation of immediate-early and delayed-early responses. Molecular and Cellular Biology 13, 6124-6136.[Abstract/Free Full Text]

Woronicz, J. D., Calnan, B., Ngo, V. & Winoto, A. (1994). Requirement for the orphan steroid receptor Nur77 in apoptosis of T-cell hybridomas. Nature 367, 277-281.[Medline]

Yoon, J. K. & Lau, L. F. (1993). Transcriptional activation of the inducible nuclear receptor gene nur77 by nerve growth factor and membrane depolarization in PC12 cells. Journal of Biological Chemistry 268, 9148-9155.[Abstract/Free Full Text]

Yoon, J. K. & Lau, L. F. (1994). Involvement of JunD in transcriptional activation of the orphan receptor gene nur77 by nerve growth factor and membrane depolarization in PC12 cells. Molecular and Cellular Biology 14, 7731-7743.[Abstract/Free Full Text]

Yoshida, M. (1996). Multiple targets of HTLV-1 for dysregulation of host cells. Seminars in Virology 7, 349-360.

Zhao, L. J. & Giam, C. Z. (1992). Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by proteinprotein interaction. Proceedings of the National Academy of Sciences, USA 89, 7070-7074.[Abstract/Free Full Text]

Received 31 March 1999; accepted 9 August 1999.