Abstract
A 4-phenyl-3-butenoic acid-producing actinomycete, designated strain VK-A60T, was isolated from a soil sample collected from Koyang, Korea. Morphological and chemical characteristics of the strain were consistent with those of the genus Streptomyces. The cell wall of the strain contains ll-diaminopimelic acid. The predominant fatty acids are anteiso-C15 : 0, iso-C16 : 0 and C16 : 0. The strain formed a distinct monophyletic line within the 16S rRNA gene sequence phylogenetic tree. Analyses of its morphological, physiological and biochemical characteristics, together with random amplified polymorphic DNA and DNA–DNA relatedness data, confirmed that strain VK-A60T represents a novel Streptomyces taxon that is distinguishable from closely related reference strains. Strain VK-A60T (=KCCM 10555T=NBRC 100598T) is proposed as the type strain of a novel species, for which the name Streptomyces koyangensis sp. nov. is proposed.
- ll-DAP, ll-diaminopimelic acid
- ISP, International Streptomyces Project
- RAPD, random amplified polymorphic DNA
- TBR, tree bisection–reconnection
-
The GenBank/EMBL/DDBJ accession number for the 16S rRNA gene sequence of Streptomyces koyangensis VK-A60T is AY079156.
-
Detailed characteristics of the strains analysed in this study are available as supplementary material in IJSEM Online.
The genus Streptomyces proposed by Waksman & Henrici (1943) for aerobic, spore-forming actinomycetes has been classified into different species based on morphology and cell-wall chemotaxonomic characteristics of the organisms. Streptomyces species, Gram-positive soil bacteria, have distinct features such as high DNA G+C content, the presence of ll-diaminopimelic acid (ll-DAP) and the absence of characteristic sugars in the cell wall (Anderson & Wellington, 2001). In addition, Streptomyces species produce extensively branched substrate and aerial mycelia (Locci, 1989). More than 500 Streptomyces species and subspecies have been described, the largest number of any bacterial genus (Hain et al., 1997).
Streptomycetes are the most prolific producers of various bioactive compounds, such as antibiotics (Okami & Hotta, 1988; Berdy, 1995). During the screening of antifungal metabolites for plant chemotherapeutic agents, we isolated a variety of actinomycete strains that are active against some plant-pathogenic fungi and oomycetes from vegetative soil in Korea (Lee & Hwang, 2002). Among them, Streptomyces sp. strain VK-A60T, isolated from soil in a radish field in Korea, produced the antibiotic 4-phenyl-3-butenoic acid, which exhibited antifungal activity against plant-pathogenic fungi in vitro and in vivo (Lee, 2002).
Here, strain VK-A60T was subjected to a polyphasic taxonomic analysis. Based on morphological, physiological, phylogenetic and molecular evidence, strain VK-A60T is considered to represent a novel species, Streptomyces koyangensis sp. nov.
Strain VK-A60T, which produces 4-phenyl-3-butenoic acid (Lee, 2002), was isolated from soil collected from radish-growing fields at Koyang, Korea. The reference strains Streptomyces canescens KCCM 40569T (=DSM 40001T), Streptomyces coelicolor KCCM 40636T (=DSM 40233T), Streptomyces felleus KCCM 40499T (=DSM 40130T), Streptomyces griseus subsp. griseus KCCM 32410 (=IFO 12875), Streptomyces limosus KCCM 40500T (=DSM 40131T), Streptomyces odorifer KCCM 40694T (=DSM 40347T), Streptomyces sampsonii KCCM 40365T (=ATCC 25495T) and Streptomyces somaliensis KCCM 40354 (=DSM 40267) were obtained from the Korean Culture Center of Microorganisms (KCCM), Seoul, Korea. Strain VK-A60T and the reference strains were grown at 28 °C on yeast extract/malt extract agar and stored in 15 % glycerol yeast extract/malt extract at −70 °C until used.
The morphology of the spore chain and the spore surface ornamentation of strain VK-A60T were examined by light and scanning electron microscopy of 14-day-old cultures on inorganic salt/starch agar as described by Williams & Davies (1967). The morphological categorization suggested by Pridham et al. (1958) was employed using the section terminology of the ISP (International Streptomyces Project) (Shirling & Gottlieb, 1969). The cultural properties of strain VK-A60T were evaluated according to the guidelines of the ISP as described by Shirling & Gottlieb (1966) and Locci (1989). Strain VK-A60T was examined for physiological and biochemical features as described by Shirling & Gottlieb (1966), Williams et al. (1983) and Locci (1989). The isomers of DAP in the whole cell hydrolysates were analysed by TLC (Lee & Hwang, 2002). Cellular fatty acids were prepared and analysed using the method of Guckert et al. (1991). The DNA G+C content of strain VK-A60T was determined using the thermal denaturation method of Marmur & Doty (1962). The Tm value was measured by UV spectroscopy (UV/Visible spectrophotometer, Pharmacia Biotech).
Genomic DNA of strain VK-A60T was isolated as described by Pospiech & Neumann (1995). The 16S rRNA gene sequence was amplified using modified universal primers, fD1 (AGAGTTTGATCCTGGG) and rP2 (ACGGCTACCTTGTTACGACTT) (Weisburg et al., 1991). The PCR products were ligated into the PCR2.1-TOPO vector (Invitrogen) and transformed into Escherichia coli TOP 10 (Invitrogen). The 16S rRNA gene sequence of strain VK-A60T inserted into the plasmid vector was sequenced on an ABI310 automatic DNA sequencer (Applied Biosystems) using Big Dye terminator cycle sequencing ready reaction kits (PE Applied Biosystems). DNA sequence analysis was performed using the blast network services at the NCBI (Altschul et al., 1997) and dnastar software program version 4.03 (DNASTAR, Inc.).
The nearly complete 16S rRNA gene sequence of strain VK-A60T was aligned with other Streptomyces nucleotide sequences using the clustal w program version 1.7 (Thompson et al., 1994). Phylogenetic analyses were performed according to the neighbour-joining method (Saitou & Nei, 1987) and the maximum-parsimony method (Fitch, 1971) using paup* version 4b10 (Swofford, 2002). Maximum-parsimony analysis was performed with the heuristic search option with random addition sequences, branch swapping by tree bisection–reconnection (TBR) and maxtrees set at 100. Gaps were treated as missing data and all nucleotide substitutions were equally weighted and unordered. The consistency index and retention index were calculated for all parsimony trees (Kluge & Farris, 1969; Farris, 1989). Relative robustness of individual branches was estimated by bootstrapping, using 1000 replicates, with heuristic searches, branch swapping by TBR and maxtrees set at 100. For neighbour-joining analysis, the data analysed by the Hasegawa–Kishino–Yano (HKY85) distance model (Hasegawa et al., 1985) were used for the construction of the neighbour-joining tree. To determine the support for each clade, bootstrap analysis was performed with 1000 replications and maxtrees set at 10. Trees were rooted using the treeview program, version 1.6.6.
PCR amplifications were carried out in 50 μL volumes for random amplified polymorphic DNA (RAPD) analysis. The PCR mixture contained 400 ng DNA, 0·125 μM MgCl2, 0·25 μM dNTPs (Takara), 0·125 μM primer, 1·5 U Taq DNA polymerase (Takara) and the appropriate amount of 10× buffer (Takara). DMSO was added to the PCR mixture to give a concentration of 10 %. Amplification was performed in a DNA thermal cycler programmed for 4 min at 95 °C, 40 cycles of 40 s at 94 °C, 45 s at 38 °C and 90 s at 72 °C and a final extension for 5 min at 72 °C. The oligonucleotide primers AM50 (CAGGAAACAGCTATGAC), AM62 [GTTTCGGTGGTCAT(AT)GCGT(TAG)AGG], AM63 [CCT(CTA)ACGC(AT)ATGACCACGAAAC] (Mehling et al., 1995) and 70-34 (GGACCGCTAG) (Roberts & Crawford, 2000) were synthesized by GenoTech Corp. After separation by agarose gel electrophoresis, the amplified fragments were visualized by staining with ethidium bromide solution and were photographed under UV light.
DNA–DNA hybridization between strain VK-A60T and comparative strains S. griseus subsp. griseus IFO 12875, S. canescens DSM 40001T, S. coelicolor DSM 40233T, S. sampsonii ATCC 25495T, S. odorifer DSM 40347T, S. limosus DSM 40131T, S. felleus DSM 40130T and S. somaliensis DSM 40267 was performed according to the method of Chung et al. (1999).
Strain VK-A60T produced Rectiflexibiles spore chains containing more than 10 spores per chain. The spores were spherical in shape and 1·2 μm in diameter with a smooth surface. A scanning electron micrograph of spore chains of strain VK-A60T cultured on inorganic salts/starch agar is available as Supplementary Fig. A in IJSEM Online. Aerial mycelia proliferated well on most of the ISP culture media. The colour of the substrate mycelia was brown. Soluble pigments were produced. Strain VK-A60T grew well on yeast extract/malt extract agar (ISP2), oatmeal agar (ISP3), inorganic salts/starch agar (ISP4), peptone/yeast extract iron agar (ISP6) and tyrosine agar (ISP7).
Whole-cell hydrolysates contained ll-DAP as a diagnostic diamino acid of the cell-wall peptidoglycan. The G+C content of the genomic DNA was 67·8 mol%. The fatty acid composition of strain VK-A60T is shown in Supplementary Table A in IJSEM Online. The predominant cellular fatty acids were 12-methyltetradecanoic acid (anteiso-C15 : 0), 14-methylpentadecanoic acid (iso-C16 : 0) and hexadecanoic acid (C16 : 0). The morphological and chemical properties of strain VK-A60T were consistent with those of the genus Streptomyces (Locci, 1989; Manfio et al., 1995) (Table 1⇓). In particular, strain VK-A60T produced the antifungal compound 4-phenyl-3-butenoic acid in cell cultures (Lee, 2002).
Morphological, physiological and biochemical characteristics of strain VK-A60T and phylogenetically related Streptomyces species
Strains/species: 1, S. koyangensis sp. nov. VK-A60T; 2, S. albidoflavus 3, S. canescens; 4, S. coelicolor; 5, S. felleus; 6, S. griseus; 7, S. limosus; 8, S. odorifer; 9, S. sampsonii; 10, S. somaliensis. Data for reference species were taken from Shirling & Gottlieb (1966, 1969), Nonomura (1974) and Williams et al. (1989). +, Positive; −, negative; d, doubtful; v, variable; nd, no data available. All species exhibit Rectiflexibiles spore chains with smooth spore surfaces and are negative for growth on inositol and raffinose and positive for growth on xylose and mannitol as sole carbon sources.
The nearly complete 16S rRNA gene sequence (1488 nt) of strain VK-A60T was compared to that of Streptomyces species deposited in the GenBank database. In the phylogenetic tree of 29 Streptomyces species, strain VK-A60T was placed in the clade with S. griseus subsp. griseus, S. felleus, S. odorifer, S. coelicolor, Streptomyces albidoflavus, S. somaliensis, S. limosus, S. canescens, S. sampsonii, Streptomyces resistomycificus and Streptomyces griseochromogenes (Fig. 1⇓). 16S rRNA gene sequence similarity among these organisms was 99 %, which corresponds to approximately 15 nt differences in 1488 bases. These 11 Streptomyces species were grouped into the clusters of S. griseus subsp. griseus and S. albidoflavus in the phylogenetic tree generated using the neighbour-joining algorithm (Saitou & Nei, 1987) (Fig. 1⇓). The close relationships between strain VK-A60T and these 11 species were confirmed by maximum-parsimony methods (Fitch, 1971). Strain VK-A60T forms a distinct phylogenic line distant from the two clusters of S. griseus subsp. griseus and S. albidoflavus in the tree. The position of strain VK-A60T in the phylogenetic tree was not affected by either the tree-making algorithm or the outgroup strains used. These findings suggest that strain VK-A60T represents a novel species that is closely related to the 11 Streptomyces species, having a high 16S rRNA gene sequence similarity. The designation of strain VK-A60T as a separate genomic species was suggested by the bootstrap value (96 %) in the neighbour-joining tree based on the nearly complete 16S rRNA gene sequence data.
Neighbour-joining phylogenetic tree of strain VK-A60T and 28 Streptomyces species based on nearly complete 16S rRNA gene sequences (1488 nt). Numbers at nodes indicate levels of bootstrap support (%) based on a neighbour-joining analysis of 1000 resampled datasets; only values >50 % are given. NCBI accession numbers are given in parentheses. Bar, 0·01 nucleotide substitutions per site.
To establish further the classification of strain VK-A60T, RAPD analysis was performed using primers of various lengths with varying G+C contents. RAPD analysis yielded 6–13 bands for each Streptomyces strain and specific banding patterns with the different primer pairs. In general, primers AM50, AM62 and AM63 separated nine strains into three groups according to their banding patterns. In the RAPD profile, S. griseus subsp. griseus formed one group (group I), and S. canescens, S. coelicolor, S. felleus, S. limosus, S. odorifer, S. somaliensis and S. sampsonii formed another (group II). Strain VK-A60T, in group III, exhibited a clearly distinguishable RAPD banding pattern. In particular, unique bands of 0·4, 3·0 and 0·9 kb were generated from strain VK-A60T by the primers AM50, AM62 and AM63, respectively. When the primer 70-34 (with low DNA G+C content) was used, all strains tested generated diverse RAPD banding patterns. The RAPD banding patterns are available as Supplementary Fig. B in IJSEM Online.
DNA–DNA hybridization analysis was carried out between strain VK-A60T and closely related strains selected from the phylogenetic data. The levels of DNA–DNA hybridization between strain VK-A60T and S. griseus subsp. griseus, S. canescens, S. coelicolor, S. sampsonii, S. odorifer, S. limosus, S. felleus and S. somaliensis were 68·5, 55·2, 20·8, 64·0, 34·4, 66·8, 25·6 and 57·5 %, respectively. DNA–DNA relatedness values below 80 % have been recommended for the recognition of novel genomic species of Streptomyces (Labeda, 1993, 1996, 1998). The DNA–DNA relatedness values determined here are available as Supplementary Table B in IJSEM Online.
Strain VK-A60T was clearly distinguished from the phylogenetically related Streptomyces strains by the formation of melanin, soluble pigments, reverse-side pigments and production of antibiotics (Table 1⇑). However, morphological features of the aerial mycelium and carbon-source utilization of strain VK-A60T were similar to those of these closely related strains.
Based on the combination of phenotypic characteristics and genotypic data, we propose the name Streptomyces koyangensis sp. nov. for this organism.
Description of Streptomyces koyangensis sp. nov.
Streptomyces koyangensis (ko.yang.en′sis. N.L. masc. adj. koyangensis pertaining to Koyang, Republic of Korea, the geographical origin of the type strain).
Aerobic, Gram-positive, non-motile actinomycete. Spore chains containing 10 or more spores per chain are Rectiflexibiles. Spores are spherical (1·2 μm in diameter) with a smooth surface. Whole-cell hydrolysates contain ll-DAP. The G+C content of the genomic DNA is 67·8 mol%. The predominant cellular fatty acids are anteiso-C15 : 0 (16·54 %), iso-C16 : 0 (28·77 %) and C16 : 0 (11·60 %). In addition, anteiso-C17 : 0 (9·01 %), iso-C14 : 0 (8·84 %), iso-C15 : 0 (7·02 %), C17 : 0 cyclo (4·54 %), anteiso-C17 : 1 (3·23 %), iso-C17 : 0 (1·94), C14 : 0 (1·33 %), iso-C16 : 1 (1·86 %) and C16 : 1 cis9 (2·57) were detected. Grows well on yeast extract/malt extract agar (ISP2), oatmeal agar (ISP3), inorganic salts/starch agar (ISP4), peptone/yeast extract iron agar (ISP6) and tyrosine agar (ISP7). Does not grow well on ISP5 medium. The spore mass is white to grey and the reverse sides of colonies are brown on most agar media. Aerial mycelia are abundant on most of these media. The colour of substrate mycelium is pale brown to dark brown. Production of spores on ISP4 is prolific. Melanin pigments are produced on ISP6 and ISP7. As the sole carbon source, it utilizes l-arabinose, d-fructose, mannitol and xylose for growth, but not adonitol, dextran, meso-inositol, d-melezitose, d-melibiose, raffinose, l-rhamnose, sucrose or xylitol. As a nitrogen source, utilizes l-cysteine, l-histidine, l-phenylalanine and l-valine. However, it cannot utilize dl-α-amino-n-butyric acid or l-hydroxyproline. Degrades casein, elastin, aesculin, gelatin, starch, tyrosine and xanthine, but not cellulose. Pectin hydrolysis, nitrate reduction and H2S production are positive, whereas lecithinase, lipolysis and hippurate hydrolysis are negative. The strain grows in the presence of 4, 7 and 10 % sodium chloride but not 13 %. It grows in 0·02 % NaN3 and 0·001 % thallous acetate, but not in 0·1 % phenol or 0·001 % potassium tellurite. The strain is resistant to penicillin G, but sensitive to neomycin, rifampicin and oleandomycin. Produces 4-phenyl-3-butenoic acid, which inhibits the mycelial growth of several plant-pathogenic fungi, such as Alternaria mali, Cladosporium cucumerinum, Colletotrichum gloeosporioides, Colletotrichum orbiculare, Magnaporthe grisea and Fusarium oxysporum f. sp. cucumerinum.
The type strain is VK-A60T (=KCCM 10555T=NBRC 100598T).
Acknowledgments
This study was supported by a grant (# CG 1432) from the Crop Functional Genomics Center of the 21st Century Frontier Research Program funded by the Ministry of Science and Technology and a grant from the Center for Plant Molecular Genetics and Breeding Research, Korea. We thank Stuart Timmis for critically reviewing the manuscript.