Research Article

Bacillus bogoriensis sp. nov., a novel alkaliphilic, halotolerant bacterium isolated from a Kenyan soda lake

,, Rajni Hatti-Kaul1 and Bo Mattiasson1

1 Department of Biotechnology, Center for Chemistry and Chemical Engineering, Lund University, PO Box 124, SE-22 100 Lund, Sweden
2 Centro de Biotecnología, Facultad de Ciencias y Tecnología, Universidad Mayor de San Simón, Cochabamba, Bolivia

Correspondence
Rajni Hatti-Kaul
Rajni.Hatti-Kaul{at}biotek.lu.se

International Journal of Systematic and Evolutionary Microbiology 2005; 55(2):899 · https://doi.org/10.1099/ijs.0.63318-0

Download PDF View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

Strain LBB3T isolated from Bogoria soda lake in Kenya is an alkaliphilic, Gram-positive, strictly aerobic, non-motile, spore-forming bacterium. It was identified as a member of the genus Bacillus on the basis of phenotypic and phylogenetic analyses. The organism grows optimally at 37 °C and pH 10. The G+C content of the genomic DNA is 37·5 mol%. 16S rRNA gene sequence analysis showed 95 and 96 % sequence similarity with Bacillus pseudofirmus (DSM 8715T) and Bacillus alcalophilus (DSM 485T), respectively. Furthermore, DNADNA hybridization against these two Bacillus species showed 39·0 and 55·5 % similarity, respectively. Based on our observations, strain LBB3T is proposed to represent a novel species of the genus Bacillus, for which the name Bacillus bogoriensis sp. nov. is proposed. The type strain of B. bogoriensis is LBB3T (=ATCC BAA-922T=LMG 22234T).
Published online ahead of print on 5 November 2004 as DOI 10.1099/ijs.0.63318-0.

The GenBank/EMBL/DDBJ accession number for the 16S rRNA gene sequence of LBB3T is AY376312.

A phylogenetic tree and electron micrographs are available as supplementary material in IJSEM Online.

This work was supported by a grant from the Department for Research Cooperation (SAREC) within the Swedish International Development Cooperation Agency (Sida).

Footnotes

Present address: PROIMI CONICET, Av. Belgrano y Pasaje Caseros, 4000 San Miguel de Tucumán, Argentina.



The genus Bacillus comprises a vast diversity of physiological types. The G+C content (3269 mol%) of the known Bacillus species, as well as DNADNA hybridization experiments, has revealed the heterogeneity of the genus. Phenetic diversity of alkaliphilic Bacillus strains has been studied, and so far 11 alkaliphilic Bacillus strains have been isolated and identified (Fritze et al., 1990; Nielsen et al., 1994, 1995). Soda lakes contain dense populations of aerobic organotrophic and alkaliphilic bacteria. Some of these bacteria are believed to have biotechnological potential as a source of alkali-stable enzymes (Gessesse & Gashe, 1997; Martins et al., 2001).

Strain LBB3T was recovered from liquid samples collected from Lake Bogoria, Kenya in a screening medium for lipolytic micro-organisms (Vargas et al., 2004), composed of 3 % (v/v) olive oil and basal salts (w/v) [0·08 % K2HPO4, 0·06 % KH2PO4, 0·1 % (NH4)2SO4, 0·02 % MgSO4.7H2O, 0·005 % CaCl2.2H2O, 0·3 % NaCl, 0·0001 % FeCl3]. It was grown at 37 °C and pH 10 on an orbital shaker at 200 r.p.m. Cell morphology was examined using a Nikon Optiphot-2 microscope at 1000x magnification. Bacterial size was determined in living cell preparations. Cells were harvested from liquid cultures, washed twice with water and dehydrated through a graded series of ethanol and isopropyl alcohol. Cells were then mounted on 12 mm cover slips, dried in a vacuum desiccator overnight and then goldpalladium (80/20) coated. Biochemical characteristics were screened by using the API 20 E system (bioMérieux) according to Logan & Berkeley (1984). Sugar assimilation was determined by using the API 50 CHB system.

Genomic DNA was extracted and purified according to Marmur (1961), and its purity was assessed from the A260/A280 and A260/A230 ratios (Johnson, 1994). Universal primers were used to amplify 16S rRNA genes (8-27F, AGAGTTTGATCCTGGCTCAG; 1422R, GGTTACCTTGTTACGACTT) (Weisburg et al., 1991). PCR products were purified using the QIA quick PCR Purification kit (Qiagen) and then resuspended in a final volume of 40 µl. DNA sequencing on both strands was performed by using the dideoxy chain-termination method with an ABI Prism 3100 DNA Analyzer, using an ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems) according to the manufacturer's protocol. GenBank and RDP databases were used to search for 16S rRNA gene sequence similarities (Maidak et al., 2000). A 16S rRNA gene sequence analysis was performed with the aid of the DNAMAN 4.03 software package by using the neighbour-joining method and the JukesCantor distance correction matrix method (Saitou & Nei, 1987). Determination of peptidoglycan type was carried out as described previously (Schleifer & Kandler, 1972; Schleifer, 1985), with the modification that TLC on cellulose was used instead of paper chromatography.

Genomic G+C content (mol%) and DNADNA hybridization were determined by the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany). DNA was isolated by chromatography on hydroxyapatite by the procedure of Cashion et al. (1997). G+C content was calculated according to the method of Mesbah et al. (1989). DNADNA hybridization was carried out as described by De Ley et al. (1970) with the modifications described by Huss et al. (1983) and Escara & Hutton (1980) using a Gilford System model 2600 spectrophotometer equipped with a Gilford model 2527-R thermoprogrammer and plotter. Renaturation rates were computed with the TRANSFER.BAS program described by Jahnke (1992).

An almost-complete 16S rRNA gene sequence was determined for strain LBB3T and compared with other available sequences in the GenBank and RDP databases (Fig. A, available as supplementary material in IJSEM Online). This analysis placed the novel strain in the family Bacillaceae, with the closest related micro-organisms being Bacillus pseudofirmus (DSM 8715T) and Bacillus alcalophilus (DSM 485T), bearing 95 and 96 % sequence similarity, respectively.

A comparison of the morphological and taxonomic characteristics of strain LBB3T with those of phylogenetically related species is shown in Table 1. Strain LBB3T produces creamyellow, circular, convex, smooth, entire, opaque colonies that are 56 mm in diameter after 48 h incubation at 37 °C. It is Gram-positive. Microscopic examination showed the cells to be spore-forming and non-motile rods that are 0·30·4 µm wide and 2·03·5 µm long. In unstained preparations, cells occur singly, in pairs and in irregular clumps (Fig. B, available as supplementary material in IJSEM Online).


Table 1. Phenotypic characteristics that differentiate Bacillus bogoriensis LBB3T from phylogenetically related species Species: 1, Bacillus bogoriensis LBB3T; 2, B. alcalophilus DSM 485T; 3, B. pseudofirmus DSM 8715T; 4, B. agaradhaerens DSM 8721T; 5, B. clarkii DSM 8720T; 6, B. pseudalcaliphilus DSM 8725T; 7, B. halodurans DSM 497T. All data are from Nielsen et al. (1995) except those for B. bogoriensis (this study). All strains are rod-shaped, and negative for erythritol, L-xylose, adonitol, dulcitol, inulin, D-fucose and L-fucose utilization. All strains utilize L-arabinose, D-xylose, fructose, salicin, cellobiose, maltose, trehalose, gentiobiose, starch, glycogen and ribose.


Strain LBB3T revealed uniform growth in the liquid medium, which led to a turbid culture broth and no formation of pellicles. It was strictly aerobic and mesophilic, exhibiting growth between 10 and 40 °C, with an optimum at 37 °C. Growth was supported between pH 8 and 11, with an optimum at pH 10, and with up to 2 M NaCl in the medium. Analysis of the cell wall showed the presence of peptidoglycan type A4β L-ornD-Asp. This pattern is typical for members of the genus Bacillus and related genera.

As shown in Table 1, the G+C content of strain LBB3T is 37·5 mol%. This value lies within the range for low G+C content Gram-positive bacteria. DNADNA hybridization analysis revealed 39·0 % similarity to B. pseudofirmus DSM 8715T and 55·5 % similarity to B. alcalophilus DSM 485T. These values for hybridization are significantly lower than the recommended threshold value of at least 70 % accepted as the definition of a novel species (Wayne et al., 1987), hence supporting the distinct position of strain LBB3T in the genus Bacillus. Differences in 16S rRNA gene sequence identity of 3 % and the G+C content justify the description of a novel Bacillus species to accommodate strain LBB3T.

Based on the analyses of morphological, physiological and phylogenetic traits, we propose strain LBB3T to be a novel alkaliphilic, halotolerant species of the genus Bacillus, for which the name Bacillus bogoriensis sp. nov. is proposed.

Description of Bacillus bogoriensis sp. nov.
Bacillus bogoriensis (bo.gor.i.en'sis. N.L. adj. bogoriensis pertaining to Lake Bogoria, a soda lake in Kenya).

Cells are rod-shaped (0·30·4x2·03·5 µm), Gram-positive, spore-forming and non-motile. Catalase-positive and urease-negative. Nitrate is not reduced to nitrite. Strictly aerobic. Optimal growth occurs aerobically at 37 °C (range 1040 °C), pH 10 (range 811) and maximum salt tolerance of 2 M NaCl. Heterotrophic; utilizes rhamnose, sucrose, L-arabinose, D-xylose, fructose, mannose, amygdalin, salicin, cellobiose, maltose, arbutin, aesculin, lactose, trehalose, gentiobiose, starch, glycogen, glycerol, ribose, raffinose, N-acetylglucosamine and 5-ketogluconate. Does not grow on mannitol, erythritol, D-arabinose, L-xylose, adonitol, methyl β-xyloside, D-glucose, galactose, melibiose, L-sorbose, dulcitol, inositol, sorbitol, methyl α-D-mannoside, methyl α-D-glucoside, inulin, melezitose, xylitol, D-turanose, D-lyxose, D-tagatose, D-fucose, L-fucose, D-arabitol, gluconate or 2-ketogluconate. DNA G+C content is 37·5 mol% (determined by HPLC).

The type strain is LBB3T (=ATCC BAA-922T=LMG 22234T).

References

Cashion, P., Holder-Franklin, M. A., McCully, J. & Franklin, M. (1997). A rapid method for the base ratio determination of bacterial DNA. Anal Biochem 81, 461466.

De Ley, J., Cattoir, H. & Reynaerts, A. (1970). The quantitative measurement of DNA hybridization from renaturation rates. Eur J Biochem 12, 133142.[Medline]

Escara, J. F. & Hutton, J. R. (1980). Thermal stability and renaturation of DNA in dimethyl sulfoxide solutions: acceleration of renaturation rate. Biopolymers 19, 13151327.[CrossRef][Medline]

Fritze, D., Flossdorf, J. & Claus, D. (1990). Taxonomy of alkaliphilic Bacillus strains. Int J Syst Bacteriol 40, 9297.[Abstract/Free Full Text]

Gessesse, A. & Gashe, B. A. (1997). Production of alkaline protease by an alkaliphilic bacteria isolated from an alkaline soda lake. Biotechnol Lett 19, 479481.[CrossRef]

Huss, V. A. R., Festl, H. & Schleifer, K. H. (1983). Studies on the spectrometric determination of DNA hybridization from renaturation rates. Syst Appl Microbiol 4, 184192.

Jahnke, K. D. (1992). Basic computer program for evaluation of spectroscopic DNA renaturation data from GILFORD System 2600 spectrometer on a PC/XT/AT type personal computer. J Microbiol Methods 15, 6173.

Johnson, J. L. (1994). Similarity analysis of DNAs. In Methods for General and Molecular Bacteriology, pp. 655682. Edited by P. Gerhardt, R. G. E. Murray, W. A. Wood & N. R. Krieg. Washington, DC: American Society for Microbiology.

Logan, N. A. & Berkeley, R. C. (1984). Identification of Bacillus strains using the API system. J Gen Microbiol 130, 18711882.[Abstract/Free Full Text]

Maidak, B. L., Cole, J. R., Lilburn, T. G. & 9 other authors (2000). The RDP (Ribosomal Database Project) continues. Nucleic Acids Res 28, 173174.[Abstract/Free Full Text]

Marmur, J. (1961). A procedure for the isolation of deoxyribonucleic acid from microorganisms. J Mol Biol 3, 208218.

Martins, R. F., Davids, W., Abu Al-Soud, W., Levander, F., Rådström, P. & Hatti-Kaul, R. (2001). Starch-hydrolyzing bacteria from Ethiopian soda lakes. Extremophiles 5, 135144.[CrossRef][Medline]

Mesbah, M., Premachandran, U. & Whitman, W. B. (1989). Precise measurement of the G+C content of deoxyribonucleic acid by high-performance liquid chromatography. Int J Syst Bacteriol 39, 159167.

Nielsen, P., Rainey, F. A., Outtrup, H., Priest, F. G. & Fritze, D. (1994). Comparative 16S rDNA sequence analysis of some alkaliphilic bacilli and the establishment of a sixth rRNA group within the genus Bacillus. FEMS Microbiol Lett 117, 6166.[CrossRef]

Nielsen, P., Fritze, D. & Priest, F. G. (1995). Phenetic diversity of alkaliphilic Bacillus strains: proposal for nine new species. Microbiology 141, 17451761.[Abstract/Free Full Text]

Saitou, N. & Nei, M. (1987). The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406425.[Abstract]

Schleifer, K. H. (1985). Analysis of the chemical composition and primary structure of murein. Methods Microbiol 18, 123156.

Schleifer, K. H. & Kandler, O. (1972). Peptidoglycan types of bacterial cell walls and their taxonomic implications. Bacteriol Rev 36, 407477.[Free Full Text]

Vargas, V. A., Delgado, O. D., Hatti-Kaul, R. & Mattiasson, B. (2004). Lipase-producing microorganisms from a Kenyan alkaline soda lake. Biotechnol Lett 26, 8186.[CrossRef][Medline]

Wayne, L. G., Brenner, D. J., Colwell, R. R. & 9 other authors (1987). International Committee on Systematic Bacteriology. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int J Syst Bacteriol 37, 463464.[Free Full Text]

Weisburg, W. G., Barns, S. M., Pelletier, D. A. & Lane, D. J. (1991). 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173, 697703.[Abstract/Free Full Text]