Research Article

Staphylococcal phosphoenolpyruvate-dependent phosphotransferase system - two highly similar glucose permeases in Staphylococcus carnosus with different glucoside specificity: protein engineering in vivo?

Microbiology 1999; 145(10):2881

PubMed

With thanks to our partners for supporting this archive.

Abstract

Previous sequence analysis of the glucose-specific PTS gene locus from Staphylococcus carnosus revealed the unexpected finding of two adjacent, highly similar ORFs, glcA and glcB, each encoding a glucose-specific membrane permease EIICBAGlc. glcA and glcB show 73% identity at the nucleotide level and glcB is located 131 bp downstream from glcA. Each of the genes is flanked by putative regulatory elements such as a termination stemloop, promoter and ribosome-binding site, suggesting independent regulation. The finding of putative cis-active operator sequences, CRE (catabolite-responsive elements) suggests additional regulation by carbon catabolite repression. As described previously by the authors, both genes can be expressed in Escherichia coli under control of their own promoters. Two putative promoters are located upstream of glcA, and both were found to initiate transcription in E. coli. Although the two permeases EIICBAGlc1 and EIICBAGlc2 show 69% identity at the protein level, and despite the common primary substrate glucose, they have different specificities towards glucosides as substrate. EIICBAGlc1 phosphorylates glucose in a PEP-dependent reaction with a Km of 12 µM; the reaction can be inhibited by 2-deoxyglucose and methyl ß-D-glucoside. EIICBAGlc2 phosphorylates glucose with a Km of 19 µM and this reaction is inhibited by methyl α-D-glucoside, methyl ß-D-glucoside, p-nitrophenyl α-D-glucoside, o-nitrophenyl ß-D-glucoside and salicin, but unlike other glucose permeases, including EIICBAGlc1, not by 2-deoxyglucose. Natural mono- or disaccharides, such as mannose or N-acetylglucosamine, that are transported by other glucose transporters are not phosphorylated by either EIICBAGlc1 nor EIICBAGlc2, indicating a high specificity for glucose. Together, these findings support the suggestion of evolutionary development of different members of a protein family, by gene duplication and subsequent differentiation. C-terminal fusion of a histidine hexapeptide to both gene products did not affect the activity of the enzymes and allowed their purification by Ni2+-NTA affinity chromatography after expression in a ptsG (EIICBGlc) deletion mutant of E. coli. Upstream of glcA, the 3 end of a further ORF encoding 138 amino acid residues of a putative antiterminator of the BglG family was found, as well as a putative target DNA sequence (RAT), which indicates a further regulation by glucose specific antitermination.

Keywords: glucose-specific phosphotransferase system, Staphylococcus carnosus, membrane protein, regulation, kinetics

Abbreviations: CRE, catabolite-responsive element; NTA, nitrilotriacetic acid; PEP, phosphoenolpyruvate; PTS, phosphotransferase system

a Present address: Department of Microbiology, Biozentrum, University of Basel, Basel, Switzerland.

The phosphotransferase system (PTS) catalyses transport and phosphorylation of carbohydrates in various obligate and facultative anaerobic bacteria. This system has also been implicated in chemotaxis and in regulation of numerous catabolic pathways (Erni, 1992 ; Hengstenberg et al., 1993 ; Postma et al., 1993 ; Lengeler et al., 1994 ). Enzyme I (EI) and the histidine-containing phosphocarrier protein (HPr) are soluble cytoplasmic proteins that are involved in the transport of all PTS sugars and are thus designated as general proteins of the PTS. During the transfer of the phosphoryl group from phosphoenolpyruvate (PEP) to the substrate, both proteins are phosphorylated on a histidyl residue. Enzymes II (EII) are sugar-specific permeases which consist of three domains (EIIA, EIIB, EIIC). IIA and IIB are hydrophilic and cytoplasmic, and both contain a phosphorylation site, which is a histidyl residue (IIA) and a cysteyl residue (IIB), respectively. Exceptions are described for IIBMan from Escherichia coli, IIBSor from Klebsiella pneumoniae and IIBFru from Bacillus subtilis, which are phosphorylated at a histidyl residue (Erni et al., 1989 ; Wöhrl & Lengeler, 1990 ; Martin-Verstraete et al., 1990 ). IIC is a transmembrane domain and serves as the binding site and translocator for the substrate. Depending on the PTS and the bacterial species, the domains are expressed independently or as fusion proteins, in which the domain organization may vary (Saier & Reizer, 1994 ).

Recently, we reported the cloning and sequencing of two EII-coding genes, glcA and glcB, from Staphylococcus carnosus and their expression in E. coli (Christiansen & Hengstenberg, 1996 ). Both genes showed high similarities to members of the glucose-specific subfamily of PTS permeases. Despite their close proximity, sequence analysis indicated an independent individual regulation of gene expression for glcA and glcB.

The three EII domains are fused in both permeases (EIICBA). Each protein is physiologically active in E. coli WA2127ΔptsG::Cmr and was shown to restore glucose fermentation in the E. coli mutant. Since EII permeases show overlapping specificity, we addressed the question whether these two glucose transporters have different substrates. To study the regulation of glucose uptake and metabolism in the Gram-positive bacterium S. carnosus, an important organism in food production, a further characterization of the two highly similar permeases is necessary. Here, we describe the purification of the two proteins EIICBAGlc1 and EIICBAGlc2 to apparent homogeneity, and the characterization of their substrate specificities in an in vitro fluorimetric assay. Additionally, the potential to initiate transcription of the two promoters preceding glcA was analysed by deletion studies.

Chemicals.
Restriction enzymes, T4-DNA ligase, DNase and RNase were obtained from Bethesada Research Laboratories; Triton X-100, glucose-6-phosphate dehydrogenase, Klenow fragment of polymerase I, 5-bromo-4-chloro-3-indolyl ß-D-galactopyranoside, ampicillin and chloramphenicol were obtained from Boehringer Mannheim; Bacto-Tryptone, yeast extract and MacConkey agar base were from Difco. The Ni2+-nitrilotriacetic acid (NTA) expression and purification kit was from Qiagen. PVDF membranes were from Bio-Rad. Other reagents were commercial products of the highest purity available.

Bacterial strains, plasmids and growth conditions.
E. coli TG1 (Sambrook et al., 1989 ) was used for cloning experiments. Expression of the EIICBAGlc proteins was performed in E. coli WA2127ΔptsG::CmrptsG ptsLPM Cmr his leu met lac supE± ) (Buhr et al., 1994 ), obtained from B. Erni, Bern. S. carnosus TM300 (Schleifer & Fischer, 1982 ) was obtained from F. Götz, Tübingen. pUC18/19 (Vieira & Messing, 1985 ) were used for cloning experiments. LB medium and growth conditions were as described previously (Christiansen & Hengstenberg, 1996 ). Fusion of histidine hexapeptide to the gene products was achieved by using the pQE vectors from Qiagen.

Preparation of cell membranes.
Cells of E. coli WA2127ΔptsG::Cmr were grown overnight in 2 l LB medium and harvested by centrifugation. The cell paste (approx. 10 g) was resuspended in 2 vols standard buffer Sb (0·05 M Tris/HCl, pH 7·5, 10-4 M DTT, 10-4 M PMSF, 10-4 M NaN3, 10-4 M EDTA). The cells were disrupted by sonication with a Branson sonifier B12. The crude extract was centrifuged for 15 min at 10000 g and 4 °C. Membranes were collected at 170000 g for 4 h (4 °C), resuspended in 20 vols Sb and sedimented under the same conditions to remove remaining cytoplasmic contaminants. The washed membrane fractions were suspended in the required volume of Sb.

In vitro EIIGlc activity test and inhibitor kinetics.
The PTS-dependent phosphorylation of glucose was measured by a coupled reaction of glucose-6-phosphate dehydrogenase in 250 µl samples at 37 °C, containing 6 mM MgCl2, 0·5 mM NADP+, 1 mM PEP, 5 µg EI from S. carnosus (80 pmol), 5 µg HPr from S. carnosus (530 pmol), glucose-6-phosphate dehydrogenase (0·25 units), 10 µl membrane resuspension (1 mg membrane fraction is resuspended in 10 µl Sb), and varying amounts of glucose (3·125100 nmol). The reaction was started by adding HPr. Increments of NADPH concentration were detected in an Eppendorf fluorimeter 1030 (primary filter 313366 nm, secondary filter 4003000 nm).

The specificity of the EIIGlc was tested by inhibition of the reaction by potential substrate analogues. A negative control was performed by adding the inhibitors as substrates.

The reaction was performed using a glucose concentration five times higher than the calculated Km value, and a 10-, 100- or 1000-fold excess of the potential inhibitor was added. In the case of an inhibition, glucose-specific MichaelisMenten kinetics were repeated in the presence of different concentrations of inhibitor (1-, 2-, 5- and 100-fold the Ki value) and the inhibition constants were calculated by nonlinear curve-fitting. In the case of a quenching effect by the inhibitor on the detection of fluorescence (o- and p-nitrophenyl glucosides), the concentration-dependent factor was determined and taken into account.

Construction of plasmids.
For expression of His-tagged EIIGlc1 and EIIGlc2, the corresponding genes were cloned into the BamHI restriction site of pQE, upstream of the histidine-hexapeptide coding region. Therefore, PCR was performed using the pUC universal primer and the oligonucleotides 3'-ATCAATTTAACCTAGGGGTA-5' (glcA) or 3'-CCACTTATTACCTAGGACAA-5' (glcB) (annealing temp. 42 °C) to introduce a BamHI restriction site (underlined bases) with concomitant removal of the termination codons of the genes. A 192 bp EcoRVBamHI 3' fragment (glcA) and a 157 bp HincIIBamHI 3' fragment (glcB) of the corresponding PCR products were isolated, sequenced and used to substitute the corresponding sequence in glcA and glcB, respectively. The modified genes were ligated into pQE plasmids, so the gene products were extended by the amino acids LDRS(H)6 (EIIGlc1) or GS(H)6 (EIIGlc2), respectively.

Two potential promoters P0 and P1 are located upstream of glcA. P1 is flanked by the two restriction sites HinfI and MnlI, which facilitated its removal (glcA-ΔP1). MnlI was used to delete both promoters (glcA-ΔP01), whereas P0 was deleted by unidirectional deletion of DNA by exonuclease III and mung bean nuclease (glcA-ΔP0).

Purification of EIICBAGlc1 and EIICBAGlc2.
Both EIIGlc permeases were purified by using the Ni2+-NTA metal chelate system according to the procedure of the manufacturer. To improve the expression of the fusion proteins, the coding sequences were recloned into pUC18.

Alkaline wash of membranes.
Membrane fractions (1 g) of E. coli WA2127ΔptsG::Cmr, expressing the desired gene product of glcA or glcB, were resuspended in 10 vols alkaline buffer [0·05 M Tris/HCl, pH 8·0, 10-4 M PMSF, 10% (v/v) glycerol, 10 mM glucose, 5 mM 2-mercaptoethanol]. The pH was adjusted to 12 (EIIGlc1-His) and 11·5 (EIIGlc2-His), respectively. After incubation for 15 min at room temperature, the pellet was harvested by centrifugation at 170000 g, 4 °C, for 3·5 h.

Solubilization of membrane proteins.
The membrane fraction after the alkaline wash (approx. 300 µg) was resuspended in 10 vols solubilization buffer (0·05 M Tris/HCl, pH 7·5, 10-4 M PMSF, 10-4 M NaN3, 5 mM 2-mercaptoethanol). Triton X-100 (final concn 1%, w/v) and NaCl (final concn 100 mM) were added and the proteins solubilized for 1 h with continuous stirring at 4 °C. After centrifugation at 170000 g for 1 h, the supernatant was suitable for Ni2+-NTA affinity chromatography.

Ni2+-NTA affinity chromatography.
The supernatant containing the solubilized proteins was applied to a column containing 0·5 ml Ni2+-NTA suspension, equilibrated with 20 vols solubilization buffer containing 1% Triton X-100. After washing with 20 vols solubilization buffer +0·8% Triton X-100 and 6 vols solubilization buffer +0·8% Triton X-100 and 25 mM imidazole, EIIGlc proteins were eluted with 4 vols elution buffer (solubilization buffer +0·8% Triton X-100, 100 mM imidazole).

Ion-exchange chromatography.
In case of residual contaminating proteins, an ion-exchange chromatography step was included. The eluted fractions of the Ni2+-NTA column were supplied to a column containing 1 ml Fractogel EMD DMAE 650 (S), equilibrated with 10 vols solubilization buffer +0·8% Triton X-100. After washing with 10 vols of the same buffer, proteins were eluted with a linear gradient of NaCl (00·4 M, 5 ml).

PAGE.
SDS-polyacrylamide gels were prepared according to Laemmli (1970) . Protein concentration was determined according to the method of Peterson (1977) .

Blotting to PVDF membranes.
Protein transfer from SDS-PAGE gels to PVDF membranes was carried out in a Biometra Semi-dry Fast Blot. The transfer buffer contained 0·09 M Tris/borate, pH 8·0, 1 mM EDTA, 20% methanol, 0·05% SDS. Gels were stained in 50% methanol, 0·1% Coomassie R250, and destained in 50% methanol.

N-terminal sequencing of proteins.
Purified proteins EIICBA1Glc-His and EIICBA2Glc-His (approx. 20 µg) were blotted to PVDF membranes and, after staining, protein-containing membrane slices were cut out and sequenced on a gas-phase sequencer according to Hewick et al. (1981) .

Expression and purification of EIICBAGlc1-His and EIICBAGlc2-His
In this report we describe for the first time the overexpression, purification and functional analysis of two glucose-specific EIICBA PTS permeases. It has already been established that glcA and glcB complement a ptsG mutant of E. coli. The E. coli WA2127ΔptsG::Cmr strain used for complementation lacks all EIICBGlc and has a defect in the mannose-PTS, resulting in a glucose-nonfermenting phenotype. Cells transformed with pUC18 containing glcA or glcB formed red colonies on MacConkey agar containing glucose.

To enable a fusion of the histidine hexapeptide coding region of the pQE plasmids to the 3' end of glcA or glcB, the stop codon was removed and the genes were cloned into pQE as described in Methods. After expression using the pQE system, both proteins (EIIGlc1-His and EIIGlc2-His) complemented the ptsG deletion mutant E. coli WA2127ΔptsG::Cmr. Membrane fractions were collected and shown to phosphorylate glucose in the PEP-dependent reaction of the in vitro assay, although 15 times more slowly than after expression via the pUC system (see Fig. 2; data shown for pQE17-glcA.)



(27K):

Fig. 2. MichaelisMenten kinetics of glucose phosphorylation by different preparations of EIICBAGlc. The reaction was measured by a coupled reaction as described in Methods, using as EIIGlc 10 µl membrane resuspensions (1 mg membrane+10 µl buffer) from E. coli after expression of the different plasmid constructions indicated. pUC18-glcA and pUC18-glcB, EIICBAGlc1 and EIICBAGlc2, respectively, after expression of the genes in pUC; pUC18-glcA, TX and pUC18-glcB, TX, the same membranes after adding Triton X-100 for solubilization (the same reactions are carried out by 1·2 µg purified and solubilized EIICBAGlc1 and 0·8 µg purified and solubilized EIICBAGlc2, respectively). ΔP0, ΔP1, ΔP01, EIICBAGlc1 after expression of the different glcA promoter deletion constructs in pUC18. pQE17-glcA, EIICBAGlc1 after expression of the gene in pQE. WT, wild-type membranes. The calculated Km values for EIICBAGlc1 and EIICBAGlc2 are 12 µM and 19 µM for membrane preparations; after solubilization the values are 30·5 µM and 37·2 µM, respectively.

To increase the level of expression, the modified genes (glcA-his and glcB-his) were cloned into pUC18 plasmids in the opposite orientation to the lac promoter. Expression of these plasmids (pUC18-glcA-his and pUC18-glcB-his) restored the glucose fermentation of E. coli WA2127ΔptsG::Cmr and membrane fractions of those transformed cells showed a Vmax of glucose phosphorylation identical to the wild-type proteins expressed via the pUC system. Moreover, the reaction of the His-tagged proteins gave the same Km values in the in vitro activity test compared to the corresponding gene products without His-tag, showing that the C-terminal extension does not influence the functionality of the EIIGlc.

Alkaline washing of the isolated membranes at pH 12·0/pH 11·5 retained 15·5%/17·4% of the proteins and 74%/78% of the EIIGlc activity in the case of EIIGlc1-His/EIIGlc2-His. Approximately 55% of the membrane-bound EIIGlc activity could then be solubilized with Triton X-100. Varying amounts of Triton X-100 and NaCl did not improve the yield of solubilized activity, whereas other detergents were even less efficient. After adsorption to Ni2+-NTA and washing with buffer containing 25 mM imidazole, 5060% of the total activity could be eluted with 100 mM imidazole. Residual contamination with proteins of a lower molecular mass (Fig. 1b, lane 5) was eliminated by ion-exchange chromatography on Fractogel EMD DEAE 650 (S). The yield of this additional purification step was 95%. The data are summarized in Table 1; Fig. 1 shows the purity reached in each of the chromatography steps. The identity of the purified proteins was verified by 10 cycles of Edman degradation.



(94K):

Fig. 1. Fractions of the purification steps from EIICBAGlc1 (a) and EIICBAGlc2 (b) separated by SDS-PAGE (10%). Lane 1, 75 µg membrane protein; lane 2, 75 µg membrane protein after alkaline treatment; lane 3, 30 µl supernatant after solubilization with Triton X-100 (40 µg protein); lane 4, 30 µl flowthrough of the Ni2+-NTA column (40 µg protein); lane 5, 3 µg protein eluted from the Ni2+-NTA column; lane 6 (in a), 3 µg protein eluted from the Ni2+-NTA column, heated to 80 °C for 5 min; lane 6 (in b), 3 µg protein eluted from the Fractogel EMD DEAE 650 (S) column; lane 7, 3 µg protein eluted from the Fractogel column, heated to 80 °C for 5 min. ST, size standards.

Table 1. Purification of EIICBAGlc1-His and EIICBAGlc2-His


SDS-PAGE analysis of the purified proteins revealed four tightly spaced bands in the case of EIICBAGlc1 and two bands in the case of EIICBAGlc2, which in both cases were not separable by further chromatography but could be coalesced into a single band by heating to 80 °C for 5 min (Fig. 1a, lane 6; Fig. 1b, lane 7). This can be explained by different SDS binding properties after thermal breakdown of folded protein structures (Heller, 1978 ). In the case of EIIGlc1, heating resulted in partial aggregation of protein molecules. The apparent molecular masses of the purified proteins, as revealed by SDS-PAGE, are lower than the calculated molecular masses of the His-tagged proteins; this can be explained by an increased binding of SDS to the strongly hydrophobic C-domains of these proteins. These unusual electrophoretic mobilities of proteins in SDS-PAGE are known as heat-modifiability and have been observed for many other membrane proteins, such as FhuA, FhuB, LacY, SecY, RodA, MalG and OmpA (Köster & Braun, 1986 ; Ried et al., 1994 ; Locher & Rosenbusch, 1997 ) and even for other EII proteins (Lee & Saier, 1983 ; Bramley & Kornberg, 1987 ; Peters et al., 1995 ).

That similar proteins show either an increased or decreased electrophoretic mobility after heating prior to SDS-PAGE has been shown for modified variants of the OmpA protein. Whereas the wild-type protein has a lower mobility, the R236V variant lacks modifiability and the membrane-spanning N-terminus (OmpA171) has an increased mobility after heat treatment (Ried et al., 1994 ). In contrast, a circular permutation (2341) of the OmpA N-terminus has a decreased mobility under the same conditions (Koebnik & Krämer, 1995 ).

With the purification method described, we were able to isolate 200 µg (EIIGlc1) or 160 µg (EIIGlc2) purified protein from 10 g wet cell paste. A large-scale purification would provide enough purified proteins for production of antibodies and for crystallization of the proteins to study expression, structure and function. Crystallization seems to be more likely for EIICBA fusion proteins compared to EIICB molecules because of the higher proportion of hydrophilic amino acids. Structure analysis would give insight into function of the widely distributed bacterial PTS transporters which are also involved in bacterial signal transduction.

In vitro test of EIICBAGlc activity and kinetics of inhibitors
After expression of pUC18-glcA and pUC18-glcB in E. coli WA2127ΔptsG::Cmr, isolated membranes had, respectively, a 45-fold and 15-fold increased rate of phosphorylation of glucose compared to equal amounts of cell membranes from S. carnosus (Fig. 2). The Km values of the glucose phosphorylation were 12 µM and 19 µM for cell membranes after expression of pUC18-glcA and pUC18-glcB, respectively, similar to the Km value obtained for the same reaction performed by use of membrane fractions isolated from S. carnosus (approx. 5 µM; data not shown). The addition of the His-tag did not alter the kinetic properties. However, incubation with Triton X-100 led to slightly increased Km values of PEP-dependent glucose phosphorylation by the products of glcA and glcB, whether membrane-bound or purified. Closer analysis of the Triton X-100-dependent kinetics of the EII proteins showed that glucose phosphorylation at lower substrate concentration is identical, but in the presence of Triton X-100, the activity at higher glucose concentrations, and thus the Vmax value, increases up to 120% (Fig. 2), resulting in an increased Km value. One possible reason for this may be the existence until solubilization of closed membrane vesicles, which may be rate-limiting in cellular membrane suspensions (Lengsfeld et al., 1973 ), thus slightly changing the apparent kinetic properties of the EII proteins.

For determination of inhibition constants, the influence of different carbohydrates on the glucose-phosphorylation reaction by purified EII proteins was investigated. In the case of an inhibition, the kinetics of the glucose phosphorylation were measured in the presence of different inhibitor concentrations, and the Ki values were calculated by nonlinear curve-fitting. Table 2 summarizes these experiments. The monosaccharides galactose, fructose and mannose, as well as the tested disaccharides cellobiose, sucrose, maltose, lactose, melibiose and trehalose, and also N-acetylglucosamine did not show any inhibition of glucose phosphorylation by either EIIGlc, and thus seem not to be substrates for either glucose transporter.


Table 2. PEP-dependent in vitro phosphorylation of glucose


In contrast to their similar rate and affinity of glucose transport, the two purified EIIGlc proteins showed a different behaviour against glucoside analogues: while glucose transport of EIIGlc1 was inhibited by 2-deoxyglucose and methyl ß-D-glucoside, EIIGlc2 was inhibited by methyl α-D-glucoside, methyl ß-D-glucoside, p-nitrophenyl α-D-glucoside, o-nitrophenyl ß-D-glucoside and salicin. This could be based on a different arrangement of the active-site amino acids, responsible for keeping the substrate in a catalytically relevant position. EIIGlc1 shows a stronger selection for substitution of the C-1 position. Different interactions of the aglycones with active-site amino acids could be responsible for the affinity of a substrate to the EII. This adds evidence to the suggestion that the evolution of the PTS proteins occurs by gene duplication with subsequent modification and thereby differentiation of the substrate specifity.

pH-stat measurements showed that the carbohydrate analogues tested do not result in an acidification of the environment when supplied to S. carnosus cells in an unbuffered medium (data not shown). Thus, they are not likely to be metabolizable by S. carnosus or even to be natural substrates.

Sequence analysis of EIICBAGlc1 and EIICBAGlc2
By mutagenesis of glucose-specific IIC domains, several amino acids have been suggested to play a role in binding or translocation of the substrate (Buhr et al., 1992 ; Ruijter et al., 1992 ; Begley et al., 1996 ). Alignment of the two EIIGlc from S. carnosus with all known glucose permeases EIICB(A) shows that M17, G149, R203, I296 and D343 are conserved in all the sequences, adding evidence to the above suggestion (the numbers are taken from the E. coli sequence; Fig. 3). In position 206 the amino acids V, I, L and G occur, indicating importance of hydrophobicity.



(33K):

Fig. 3. Proposed two-dimensional structure of the IIC domain of EIIGlc from E. coli as revealed from lacZ and phoA fusions (Buhr & Erni, 1993 ). Essential conserved residues are marked (HH 211/212, GITE 295298) as well as mutations that uncouple translocation and phosphorylation (R203, V206, K257, I296) or lead to a poorly translocating but still phosphorylating transporter (M17, G149, K150, S157, H339, D343). All the residues mentioned above that are conserved in all so far known transporters of the Glc-Nag subfamily (G149, R203, H 211, G295, TE 297/298, D343) or at least in the glucose transporters (M17, H212, I296) are shaded. Sequence analysis of the two EIICBAGlc from S. carnosus suggests a complete agreement with the proposed two-dimensional structure of IIC from E. coli, according to the model from Lengeler et al. (1994) .

To date, no three-dimensional structural information about EIIC proteins is available, so the exact mechanisms of sugar binding, transport and phosphorylation remain unclear. Experiments with lacZ and phoA fusions (Sugiyama et al., 1991 ; Buhr & Erni, 1993 ) led to proposed two-dimensional models of EIICGlc (Fig. 3) and EIICMtl from E. coli. Sequence analysis of EIIGlc1/2 from S. carnosus (homologies, hydropathy plots, positive-inside rule) agrees with the proposed two-dimensional structure of IIC from E. coli.

Further investigation using site-directed mutagenesis or construction of genes encoding chimeric transporters could lead to the identification of regions containing the binding sites. Identification of stacking aromates or changing substrate specifity by site-directed mutagenesis have been shown for other sugar-binding proteins (Iobst & Drickamer, 1994 ; Strokopytov et al., 1994 ).

Sequence analysis of the glc region and deletion of the promoters P0 and P1
While glcB is preceded by a single putative promoter, two putative promoters, P0 and P1, are located upstream of glcA. Together with the intergenic putative termination loop, this indicates independent expression of glcA and glcB.

To prove the ability to initiate transcription of glcA, the two upstream promoters P0 and P1 were deleted as described above. After expression of the constructs in E. coli WA2127ΔptsG::Cmr, cell membranes showed impaired in vitro glucose phosphorylation compared to glcA (glcA-ΔP0, 25%; glcA-ΔP1, 63%; glcA-ΔP01, 5%, Fig. 2). The residual activity of glcA-ΔP01 can be explained by transcription products initiated at the upstream bla promoter of the pUC18 vector combined with its high copy number. A control plasmid lacking both promoters, the ribosome-binding site and the codons of the first 38 amino acids of EIIGlc1 caused no detectable glucose phosphorylation (data not shown).

Thus, both promoters, P0 and P1, are able to initiate the transcription of glcA in the heterologous host E. coli. P0 shows a higher activity (63%) than P1 (25%). We expect both putative promoter regions to be involved in regulation of EIIGlc1 expression in S. carnosus, in which during growth on glucose the EIIGlc activity of membrane fractions increases about five- to sevenfold (data not shown). Although catabolite repression via CRE elements and RAT specific antitermination is not probable in the heterologous host E. coli, it cannot be ruled out that these elements influence the residual promoter activities. CRE1 is missing in all three constructs ΔP0, ΔP1 and ΔP01; the putative RAT sequence is only absent in ΔP01. To confirm the role of P0 and P1, as well as the role of the existence of two EIIGlc coding genes in regulation of glucose uptake in S. carnosus, further work should focus on genetical analysis in the homologous organism, e.g. disruption of genes or regulative elements, following the expression pattern using reporter genes.

Catabolite repression in Gram-positive bacteria is mediated by HPr after ATP-dependent phosphorylation of HPr on a seryl residue. Recently, the genes of the HPr kinase hprK and the phosphatase hprP have been identified in E. coli (Galinier et al., 1998 ; Reizer et al., 1998 ). A complex of CcpA, HPr-Ser~P and, at least in some cases, fructose 1,6-bisphosphate binds to the CRE which is found near the transcription start of many catabolic genes, resulting in repression of their expression (Hueck et al., 1994 ).

Sequence analysis revealed the existance of three CRE-like elements in the region of glcA and glcB (Fig. 4), suggesting that binding of a CcpA/HPr-Ser~P to these regions leads to an additional control of the PTS. One possibility is a negative regulation to protect cells from a toxic effect of accumulated sugar phosphates.



(5K):

Fig. 4. Schematic organization of genes and putative elements of regulation in the glc locus of S. carnosus. glcA and glcB encode the PTS permeases EIICBAGlc1 and EIICBAGlc2, respectively. Sequence analysis of the incomplete ORF upstream glcA shows 55% homology to the antiterminator glcT from B. subtilis. P0, P1 and P2 are putative promoters; CRE 1, CRE 2 and CRE 3 are putative catabolite-responsive elements. SD indicates a putative ShineDalgarno sequence and RAT a putative antiterminator binding site. The arrows indicate the relative positions of sites used for DNA manipulations to construct the promoter deletions glcA-ΔP0 (1), glcA-ΔP1 (2 and 3) and glcA-ΔP01 (3).

Also of interest is the finding of a partially sequenced ORF preceding glcA (Christiansen & Hengstenberg, 1996 ), encoding the C-terminus of a protein with mean amino acid identity of 25% and similarity of 55% to the corresponding parts of bacterial antiterminators of the BglG family (data not shown). So far, these genes have been found in ß-glucoside operons of E. coli (Schnetz & Rak, 1990 ) and Erwinia chrysanthemi (El Hassouni et al., 1992 ), as well as in the sac, lev and lic operons of B. subtilis (Crutz et al., 1990 ; Débarbouillé et al., 1990 ;Schnetz et al., 1996 ). Their antiterminator proteins bind to the RAT region of mRNA, preceding a terminator stemloop, resulting in antitermination. By PTS-dependent phosphorylation the antiterminators are regulated in their activity, resulting in adaptation to the environmental conditions.

Recently, a regulation of the ptsG gene in B. subtilis via antitermination was described following the presented mechanism (Stülke et al., 1997 ). In S. carnosus a stemloop (TAACTAATTCGATTAGGCATGAGTGA) with 85% identity to the glucose-specific RAT sequence of B. subtilis is located between the putative glcT gene and glcA, followed by a putative weak termination loop (AAGTTTGGAGCAATCCAACTTTTTT).

In conclusion, we have cloned a genomic region of S. carnosus encoding two very similar PTS permeases with the common substrate glucose but a clearly distinguishable substrate specifity towards glucosides. The identified and putative regulatory elements suggest a complex regulatory mechanism of glucose metabolism involving differential gene expression, transcriptional regulation, catabolite repression and antitermination.

We thank B. Erni for the providing E. coli WA2127ΔptsG::Cmr, and F. Götz for providing S. carnosus TM300. We are grateful to K. H. Wüster for N-terminal sequencing and to W. Philipp and R. Morris for critical reading of the manuscript. Part of this work was supported by the Fonds der Chemischen Industrie.

References

Begley, G. S., Warner, K. A., Arents, J. C., Postma, P. W. & Jacobson, G. R. (1996). Isolation and characterization of a mutation that alters the substrate specificity of the Escherichia coli glucose permease. J Bacteriol 178, 940-942.[Abstract/Free Full Text]

Bramley, H. F. & Kornberg, L. (1987). Nucleotide sequence of bglC, the gene specifying enzyme IIBgl of the PEP:sugar phosphotransferase system in Escherichia coli K12, and overexpression of the gene product. J Gen Microbiol 133, 563-573.[Abstract/Free Full Text]

Buhr, A. & Erni, B. (1993). Membrane topology of the glucose transporter of Escherichia coli. J Biol Chem 268, 11599-11603.[Abstract/Free Full Text]

Buhr, A., Daniels, G. A. & Erni, B. (1992). The glucose transporter of Escherichia coli. Mutants with impaired translocation activity that retain phosphorylation activity. J Biol Chem 267, 3847-3851.[Abstract/Free Full Text]

Buhr, A., Flükiger, K. & Erni, B. (1994). The glucose transporter of Escherichia coli overexpression, purification, and characterization of functional domains. J Biol Chem 269, 23427-23443.

Christiansen, I. & Hengstenberg, W. (1996). Cloning and sequencing of two genes from Staphylococcus carnosus coding for glucose-specific PTS and their expression in Escherichia coli K-12. Mol Gen Genet 250, 375-379.[Medline]

Crutz, A.-M., Steinmetz, M., Aymerich, S., Richter, R. & Le Coq, D. (1990). Induction of levansucrase in Bacillus subtilis: an antitermination mechanism negatively controlled by the phosphotransferase system. J Bacteriol 172, 1043-1050.[Abstract/Free Full Text]

Débarbouillé, M., Arnaud, M., Fouet, A., Klier, A. & Rapoport, G. (1990). The sacT gene regulating the sacPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators. J Bacteriol 172, 3966-3973.[Abstract/Free Full Text]

El Hassouni, M., Henrissat, B., Chippaux, M. & Barras, F. (1992). Nucleotide sequence of the arb genes, which control ß-glucoside utilization in Erwinia chrysanthemi: comparison with the Escherichia coli bgl operon and evidence for a new ß-glycohydrolase family including enzymes from eubacteria, archaebacteria and humans. J Bacteriol 174, 765-777.[Abstract/Free Full Text]

Erni, B. (1992). Group translocation of glucose and other carbohydrates by the bacterial phosphotransferase system. Int Rev Cytol 137A, 127-148.[Medline]

Erni, B., Zanolari, B., Graff, P. & Kocher, H. P. (1989). Mannose permease of Escherichia coli. Domain structure and function of the phosphorylating subunit. J Biol Chem 264, 18733-18741.[Abstract/Free Full Text]

Galinier, A., Kravanja, M., Engelmann, R., Hengstenberg, W., Kilhoffer, M.-C., Deutscher, J. & Haiech, J. (1998). New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression. Proc Natl Acad Sci USA 95, 1823-1828.[Abstract/Free Full Text]

Heller, K. B. (1978). Apparent molecular weights of a heat-modifiable protein from the outer membrane of Escherichia coli in gels with different acrylamide concentrations. J Bacteriol 134, 1181-1183.[Abstract/Free Full Text]

Hengstenberg, W., Kohlbrecher, D., Witt, E. & 7 other authors (1993). Structure and function of proteins of the phosphotransferase system and of 6-phospho-ß-glycosidases in Gram-positive bacteria. FEMS Microbiol Rev 12, 149164.[Medline]

Hewick, R. H., Hunkapiller, M. W., Hood, L. E. & Dreyer, W. J. (1981). A gasliquid solid phase peptide and protein sequenator. J Biol Chem 256, 7990-7997.[Abstract/Free Full Text]

Hueck, C. J., Hillen, W. & Saier, M. H.Jr (1994). Analysis of a cis-active sequence mediating catabolite repression in Gram-positive bacteria. Res Microbiol 145, 503-518.[Medline]

Iobst, S. T. & Drickamer, K. (1994). Binding of sugar ligands to Ca2+ dependent animal lectins. II. Generation of high-affinity galactose binding by site-directed mutagenesis. J Biol Chem 269, 15512-15519.[Abstract/Free Full Text]

Koebnik, R. & Krämer, L. (1995). Membrane assembly of circularly permuted variants of the E. coli outer membrane protein OmpA. J Mol Biol 250, 617626.[Medline]

Köster, W. & Braun, V. (1986). Iron hydroxamate transport of Escherichia coli: nucleotide sequence of the fhuB gene and identification of the protein. Mol Gen Genet 204, 435-442.[Medline]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

Lee, C. A. & Saier, M. H.Jr (1983). Mannitol-specific enzyme II of the bacterial phosphotransferase system. III. The nucleotide sequence of the permease gene. J Biol Chem 258, 10761-10767.[Abstract/Free Full Text]

Lengeler, J. W., Jahreis, K. & Wehmeier, U. F. (1994). Enzymes II of the phosphoenolpyruvate-dependent phosphotransferase systems: their structure and function in carbohydrate transport. Biochim Biophys Acta 1188, 1-28.[Medline]

Lengsfeld, A. M., Alexander, E. T., Hengstenberg, W. & Korte, T. (1973). Morphological changes in staphylococcal cytoplasmic membrane due to action of non-ionic detergent Triton X-100. Exp Cell Res 76, 159-169.[Medline]

Locher, K. P. & Rosenbusch, J. P. (1997). Oligomeric states and siderophore binding of the ligand-gated FhuA protein that forms channels across Escherichia coli outer membranes. Eur J Biochem 247, 770-775.[Medline]

Martin-Verstraete, I., Débarbouillé, M., Klier, A. & Rapoport, G. (1990). Levanase operon of Bacillus subtilis includes a fructose-specific phosphotransferase system regulating the expression of the operon. J Mol Biol 214, 657-671.[Medline]

Peters, D., Frank, R. & Hengstenberg, W. (1995). Lactose-specific enzyme II of the phosphoenolpyruvate-dependent phosphotransferase system of Staphylococcus aureus. Purification of the histidine-tagged transmembrane component IICBLac and its hydrophilic IIB domain by metal-affinity chromatography, and its functional characterization. Eur J Biochem 228, 798-804.[Medline]

Peterson, G. L. (1977). A simplification of the protein assay method of Lowry et al. which is more generally applicable. Anal Biochem 83, 346-356.[Medline]

Postma, P. W., Lengeler, J. W. & Jacobson, G. R. (1993). Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57, 543-594.[Abstract/Free Full Text]

Reizer, J., Hoischen, C., Titgemeyer, F., Rivolta, C., Rabus, R., Stülke, J., Karamata, D., Saier, M. H.Jr & Hillen, W. (1998). A novel protein kinase that controls catabolite repression in bacteria. Mol Microbiol 27, 1157-1169.[Medline]

Ried, G., Koebnik, R., Hindennach, I., Mutschler, B. & Henning, U. (1994). Membrane topology and assembly of the outer membrane protein OmpA of Escherichia coli K12. Mol Gen Genet 243, 127-135.[Medline]

Ruijter, G. J. G., van Meurs, G., Verwey, M. A., Postma, P. W. & van Dam, K. (1992). Analysis of mutations that uncouple transport from phosphorylation in Enzyme IIGlc of the Escherichia coli phosphoenolpyruvate-dependent phosphotransferase system. J Bacteriol 174, 2843-2850.[Abstract/Free Full Text]

Saier, M. H.Jr & Reizer, J. (1994). The bacterial phosphotransferase system: new frontiers 30 years later. Mol Microbiol 13, 755-764.[Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schleifer, K. H. & Fischer, U. (1982). Description of a new species of the genus Staphylococcus: Staphylococcus carnosus. Int J Syst Bacteriol 32, 153-156.

Schnetz, K. & Rak, B. (1990). ß-Glucoside permease represses the bgl operon of Escherichia coli by phosphorylation of the antiterminator protein and also interacts with glucose-specific enzyme IIIGlc, the key element in catabolite control. Proc Natl Acad Sci USA 87, 5074-5078.[Abstract/Free Full Text]

Schnetz, K., Stülke, J., Gertz, S., Krüger, S., Krieg, M., Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator of the BglG family. J Bacteriol 178, 1971-1979.[Abstract/Free Full Text]

Strokopytov, B., Penninga, D., Rozeboom, H. J., Kalk, K. H., Dijkhuizen, L. & Dijkstra, B. W. (1994). X-ray structure of cyclodextrin glycosyltransferase complexed with acarbose. Implications for the catalytic mechanism of glycosidases. Biochemistry 34, 2234-2240.

Stülke, J., Martin-Verstraete, I., Zagorec, M., Rose, M., Klier, A. & Rapoport, G. (1997). Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Mol Microbiol 25, 65-78.[Medline]

Sugiyama, J. E., Mahmoodian, S. M. & Jacobson, G. R. (1991). Membrane topology analysis of the Escherichia coli mannitol permease by using a nested-deletion method to create mtlAphoA fusions. Proc Natl Acad Sci USA 88, 9603-9607.[Abstract/Free Full Text]

Vieira, J. & Messing, J. (1985). The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with the synthetic universal primers. Gene 19, 259-268.

Wöhrl, B. M. & Lengeler, J. W. (1990). Cloning and physical mapping of the sor genes for L-sorbose transport and metabolism from Klebsiella pneumoniae. Mol Microbiol 4, 1557-1565.[Medline]

Received 22 January 1999; revised 24 May 1999; accepted 7 June 1999.