Abstract
Keywords: protease, Pseudomonas fluorescens, ECF sigma factor, transmembrane activator, temperature regulation
The GenBank accession numbers for the sequences reported in this paper are AF228766 and AF228767.
The regulation by temperature of protease and lipase production in psychrotrophic strains of P. fluorescens has been previously documented. Lipase production is increased at temperatures below the optimum growth temperature (Andersson, 1980 ). In contrast, protease production is reduced by about 50% at 4 °C above the optimum growth temperature of 27 °C, at which the generation time is reduced by 26% (R. G. Woods and others, unpublished data), and is almost completely inhibited at 32 °C (McKellar & Cholette, 1987 ). However, little is known about the regulatory mechanisms involved in the determination of protease production at different temperatures. In this report, we show that the production of protease by P. fluorescens LS107d2 at 29 °C, slightly above the optimal growth temperature of 25 °C, is dependent on PrtR, which we propose is a novel member of a group of anti-sigma factors and transmembrane activators which interact with ECF (extracytoplasmic function) sigma factors of the σ70 family. ECF sigma factors are necessary for the transcription of genes which encode products with extracytoplasmic functions and are usually encoded in an operon which includes the gene encoding the anti-sigma factor or activator (Missiakas & Raina, 1998 ; Hughes & Mathee, 1998 ). Our data suggest that PrtR is a transmembrane activator, rather than an anti-sigma factor, and that prtR is translationally coupled to an upstream gene, prtI, which encodes an ECF sigma factor.
Bacterial strains and growth conditions.The Escherichia coli strain TG1 (Brown, 1991 ) was used for general plasmid transformations and JM109λpir and S17.1λpir were used for the propagation of the suicide vector pJP5603 (Pemberton & Penfold, 1992 ); the latter strain was used as a donor in conjugation. All E. coli strains were cultured in Luria broth media (Brown, 1991 ) at 37 °C. Pseudomonas fluorescens strains LS107d2 and B52 were originally isolated from raw milk (Richardson & Te Whaiti, 1978 ; Johnson et al., 1992 ). Skimmed milk media comprised low-salt Luria broth containing 2·5% skimmed milk. In the case of liquid cultures, a HEPES-based medium was used (2 mM HEPES pH 7·0, 1 mM NH4Cl2, 0·1 mM CaCl2, 1 mM MgCl2 and 0·5% hydrolysed casein). Where appropriate, the following antibiotic concentrations were used: chloramphenicol, 25 µg ml-1 for E. coli and 200 µg ml-1 for P. fluorescens; kanamycin, 50 µg ml-1; ampicillin, 50 µg ml-1; rifampicin, 50 µg ml-1; and tetracycline, 10 µg ml-1.
Recombinant DNA techniques and nucleotide sequence analysis.
Restriction enzyme digests, ligation of DNA fragments, end-filling with Klenow polymerase, agarose electrophoresis, transformation of E. coli and Southern blot analysis were performed as described by Sambrook et al. (1989) . Probes were labelled by nick translation using [α-32P]dCTP. Plasmid DNA was prepared using alkaline lysis (Sambrook et al., 1989 ) or a column (Qiagen) and genomic DNA was prepared using the cetyltrimethylammonium bromide method (Wilson, 1987 ). DNA sequencing was accomplished using an Applied Biosystems model 377 sequencer. Database comparisons of nucleotide sequences, following translation in six frames, utilized the BLAST program (Altschul et al., 1997 ; Gish & States, 1993 ).
Library construction and screening.
Genomic libraries from P. fluorescens strains LS107d2 and B52 were made in λZap Express (Stratagene) using DNA partially digested with Sau3A. Plaques were screened, following transfer to a positively charged nylon membrane (Bio-Rad), using a probe derived by inverse PCR (see below). From these λ clones, plasmid clones were excised to give p62A and p53 containing the prtIR region from LS107d2 and B52, respectively (see Fig. 1).
|
Cloning of the metalloprotease gene (aprX) from LS107d2.
Two primers, MU1 (CGGAATTCACGAGATCGGCCATACC) and Md2 (GCGGATCCGTAGAGGATGTCGTTGC), derived from conserved regions between the metalloprotease genes of Pseudomonas aeruginosa (Duong et al., 1992 ) and Serratia marcescens (Nakahama et al., 1986 ), were used to amplify a 578 bp fragment of aprX from P. fluorescens LS107d2. This fragment was labelled and used to screen the LS107d2 λ library, as described above. A clone containing a 5 kb insert was identified and named pLS51.
Transposon mutagenesis.
Random transposon mutagenesis was accomplished by conjugal transfer of pUTmini-Tn5 Km from S17.1λpir to P. fluorescens LS107d2 (de Lorenzo et al., 1990 ; Herrero et al., 1990 ). Protease-negative mutants were detected following screening of exconjugants on media containing 2·5% skimmed milk.
Inverse PCR.
Inverse PCR, used to identify DNA sequence flanking the transposon insertion into prtR, was accomplished using an adaptation of the method of Rich & Willis (1990) . Genomic DNA from the mutant of interest was cut with EagI and religated with T4 DNA ligase. PCR using divergent primers (AAGGCGAATCACCAAGGTAGTCGGCA and GATAGCTAGACTGGGCGGTTTTATGG) within the mini-Tn5Km cassette (de Lorenzo et al., 1990 ) was performed with the following PCR program for 35 cycles: 60 s at 95 °C, 30 s at 50 °C and 90 s at 74 °C. The resulting PCR product was gel-extracted, sequenced and compared to sequences in databases.
Chromosomal insertional mutagenesis.
To construct a prtI insertion mutant, a 300 bp SalIXhoI internal prtI fragment from p53 was purified and cloned into the SalI site of the suicide vector pJP5603 (Penfold & Pemberton, 1992 ), which carries the kan gene, to give pJP5603-1. Following transformation into JM109λpir, the construct was conjugated into P. fluorescens LS107d2 using triparental mating (Herrero et al., 1990 ). Kanamycin-resistant exconjugants arising from a single crossover event were isolated on Luria broth media containing kanamycin and then screened on 2·5% skimmed milk media for protease activity at 29 and 23 °C. Colonies which were AprX- at 29 °C but not at 23 °C were presumed to be prtI::kan and were confirmed by Southern blot analysis.
Complementation analysis.
To confirm that prtI and prtR were required for protease expression at 29 °C, DNA fragments from p53 containing either prtI, prtR or the entire prtIR region were cloned into the broad-host-range cloning vector pBBR1MCS (Kovach et al., 1995 ), to give pBBR4, pBBR14 and pBBR53, respectively. The DNA fragments, derived from p53, were a 2·4 kb PstIKpnI fragment containing prtIR; a 1·4 kb XhoIKpnI fragment containing prtR; and a 1·1 kb PstIBclI fragment containing prtI (see Fig. 1). The three resulting pBBR1MCS derivatives were each transformed into TG1 and conjugated into the P. fluorescens LS107d2 target strains by triparental mating. The phenotypes of the exconjugants were tested for protease activity on 2·5% skimmed milk agar plates.
Transcription mapping.
The transcriptional start point of aprX was mapped using S1 nuclease protection. A 456 bp DNA fragment was derived by PCR from plasmid pLS51 (see above) using primers LS186 (3'-CTGCCAACTAGTGAAACTT-5') and PRTMb270 (3'-AAGACGACCCGCAACTTGAC-5'), which bind at positions -186 to -167, and 250 to 270, respectively (where position 1 is the aprX ATG start codon). A 32P-labelled single-stranded antisense probe using 150 pmol primer prtmS1 (3'-CATACTGGCACCGCCGTTGGA-5' nt 82103) was used in a linear amplification with 1 µg of the above purified PCR product as template. The PCR reaction, containing 62 µmol each of dATP, dTTP and dGTP, 18 µmol dCTP, 3 µl [α-32P]dCTP (1014 Bq mmol-1; 370 Bq µl-1) and 2·5 units Taq DNA polymerase (Promega), was cycled under the following conditions: 96 °C for 40 s, 50 °C for 40 s and 72 °C for 90 s for a total of 40 cycles. The probe was purified by excision from a 6% denaturing polyacrylamide gel following identification by autoradiography. The probe was eluted from the polyacrylamide slice by soaking in 300 µl elution buffer (0·5 M ammonium acetate, 1 mM EDTA and 0·2% SDS) overnight at 37 °C, ethanol-precipitated, resuspended in 100 µl diethyl-pyrocarbonate-treated water and stored at -20 °C until required. Total RNA (5 µg), purified as described by Aiba et al. (1981) , was mixed with the purified 32P-labelled probe, ethanol-precipitated and dissolved in 10 µl hybridization buffer (80% deionized formamide, 100 mM sodium citrate pH 6·4, 300 mM sodium acetate pH 6·4, 1 mM EDTA). The DNARNA mix was denatured at 85 °C for 10 min and then allowed to hybridize at 37 °C for 3 h. The reaction was then made up to 200 µl with 1x S1 nuclease buffer (Promega), 50 units S1 nuclease were added and incubated at 37 °C for 3 h. The digested products were ethanol-precipitated, resuspended in 8 µl gel loading buffer (95% formamide, 20 mM EDTA, 0·05% bromophenol blue and 0·05% xylene cyanole FF), and 2 µl was electrophoresed on a 6% denaturing polyacrylamide gel alongside dideoxy sequencing reactions. The latter were derived using modified T7 polymerase (United States Biochemical) and labelled with [α-32P]dCTP. The gel was dried and visualized by autoradiography.
Protease assays.
Due to the relatively low levels of protease produced by strain LS107d2, a well assay was used (Lawrence et al., 1967 ): wells were cut into 2·5% skimmed milk agar plates using a 4 mm cork borer, 40 µl supernatant from liquid cultures was placed into each well and the plates were incubated at 37 °C for 25 h. Supernatant from a parallel culture of P. fluorescens B52 was assayed using both the azocasein method (Wassif et al., 1995 ) and the well assay in order to generate a standard curve of protease activity in units ml-1 versus the diameter (in mm) of the hydrolysed skimmed milk halo produced around the wells; protease activity for the LS107d2 cultures in equivalent units ml-1 for the azocasein assay (defined as ΔA450 min-1) was then calculated from the standard curve.
In order to identify genes involved in the regulation of protease production, transposon mutagenesis of P. fluorescens LS107d2 was carried out. Mutants were screened for lack of protease activity on skimmed milk media at 29 °C. One such mutant, although lacking activity at 29 °C, retained protease activity at 23 °C (see Fig. 3). The flanking region was derived by inverse PCR using EagI-cleaved genomic DNA (see Methods). Sequence analysis of the region adjacent to the EagI site (see Fig. 1), and database comparisons, revealed substantial amino acid similarity (48% identity over 48 amino acid residues) to several ECF sigma factors, including AlgT and RpoE (Mathee et al., 1997 ; Pogliano et al., 1997 ). Nucleotide sequence derived from further downstream of this open reading frame subsequently revealed that the site of insertion of the transposon was in a second gene designated prtR (see below), but did not reveal any substantial amino acid similarities to database entries.
|
The prtIR operon
Since P. fluorescens is a diverse group of organisms (Cox & MacRae, 1989 ), we cloned the corresponding region of the genome from both strains LS107d2 and B52 (see Methods), although the above observations were made in strain LS107d2.
Sequence analysis of the region from LS107d2 and B52 revealed a dicistronic operon, which we designated prtIR (Fig. 1). The first gene clearly encodes an ECF sigma factor related protein (PrtI), with algU (Martin et al., 1993 ) and sigE (Martin et al., 1994 ) being its closest homologues, with 43% and 38% identity, respectively. Further, PrtI acts at the level of transcription since, in contrast to the wild-type strain (see below), no aprX transcript is detectable in a prtI mutant strain (prtI::kan; see Methods) at 29 °C by S1 nuclease analysis (data not shown). The second gene encodes a protein with no substantial amino acid sequence similarity to other sequences in databases. However, ECF sigma factors are all cotranscribed with their cognate regulators, a group of membrane-associated anti-sigma factors and transmembrane transcriptional activators (Hughes & Mathee, 1998 ), suggesting that PrtR might be such a protein. In agreement with this suggestion, the hydrophobicity profile of PrtR (Fig. 2) shows a centrally placed single membrane-spanning domain typical of these regulators (Mathee et al., 1997 ; Hughes & Mathee, 1998 ). Furthermore, the stop codon of prtI and the start codon of prtR overlap, indicating the existence of translational coupling. Evidence from the CarQRS system suggests that this facilitates interaction between the C-terminal end of the sigma factor (CarQ) and the N-terminal end of anti-sigma factor (CarR), allowing both to be inserted into the inner membrane concurrently upon the completion of translation (Gorham et al., 1996 ). Thus although we have not demonstrated directly that PrtR is membrane-associated, the evidence strongly suggests that it is a transmembrane regulator.
|
The site of insertion of the transposon in the mutant strain of LS107d2 (see above) is within the codon encoding Gln138, in the N-terminal region of PrtR; the mutant allele is designated prtR::Tn. Since the phenotype of this mutant is lack of protease production at 29 °C, we conclude that PrtR is essential for protease production, and hence aprX expression, at 29 °C, and is therefore most likely to function as a transmembrane activator of PrtI, as opposed to an anti-sigma factor. This is supported by complementation studies (see below).
Interestingly, the amino acid sequence of PrtR shows no significant similarity to the two other transmembrane activators currently reported, as foreshadowed by the initial sequence analysis of the region flanking the transposon insertion (see above): amino acid sequence alignment of PrtR with FecR (Van Hove et al., 1990 ) and PupR (Chi & Bartlett, 1995 ) using CLUSTAL (Thompson et al., 1994 ) showed that PrtR is only 18% identical to PupR and 18·5% to FecR (data not shown), although FecR and PupR are 38% identical to each other.
The corresponding genes from P. fluorescens strain B52 encode proteins which are 89% identical (PrtI) and 87% (PrtR) identical to those from LS107d2, and also show translational coupling (see Fig. 1).
Insertional mutagenesis of prtIR and complementation analysis
In order to determine the function of prtI in the expression of protease activity, a chromosomal mutant of LS107d2 was constructed (prtI::kan; see Methods). As in the case of the prtR::Tn mutant, the prtI::kan mutant is protease-deficient at 29 °C but not at 23 °C (Fig. 3). We have determined whether this mutation is complemented by prtI and/or prtR following transfer of multicopy plasmids containing each of these genes and testing for protease production at 29 °C either phenotypically or by assay of culture supernatants. The results indicate that prtI::kan is complemented by prtI and that prtR::Tn is complemented by prtR (Figs 3 and 4), as expected if both are required for a protease-positive phenotype at 29 °C. It would be expected that the prtI::kan mutation would have a polar effect on prtR expression and hence not be complemented by prtI alone; the fact that it is complemented by prtI alone indicates that expression of prtR, in the prtI::kan mutant strain, is occurring from a promoter within pJP5603-1 since the entire construct is integrated into the chromosome as a result of a single recombinational event (see Methods).
|
Three other features of the complementation pattern are notable. Firstly, whereas prtR::Tn was not complemented by prtI, as expected, prtI::kan is complemented by prtR (Figs 3 and 4). We suggest that the presence of prtR in multicopy may overcome PrtI deficiency by interacting, albeit perhaps inefficiently, with other sigma factors due to PrtR overproduction. Secondly, although prtR::Tn is protease-proficient at 23 °C, the presence of prtI in multicopy strongly represses protease production at 23 °C in the prtR::kan mutant background (Fig. 3). This may be due to the higher affinity of RNA polymerase for its cognate promoter when associated with PrtI, as compared to other sigma factors, thus excluding RNA polymerase holoenzyme associated with other sigma factors from binding to the promoter; consequently, assuming PrtI to be inactive (or relatively inactive) in the absence of PrtR (in the prtR::kan background), the promoter will be mostly occupied with an inactive RNA polymerase. The lack of repression at 23 °C when both PrtI and PrtR are introduced is consistent with this interpretation (Fig. 3). Thirdly, when present in multicopy, in the prtI::kan or prtR::Tn mutant strains, both PrtI and PrtR promote overproduction of protease at both 23 and 29 °C (Fig. 3). These observations are consistent with both PrtI functioning as a sigma factor and PrtR functioning as a transmembrane activator; furthermore, although PrtI and PrtR are not essential at 23 °C (see above; Figs 3 and 4), evidently they can function at this temperature since overproduction is clearly evident at 23 °C (as well as at 29 °C).
We conclude that both PrtI and PrtR are essential for protease production at 29 °C, and further suggest that PrtR can interact with other sigma factors (when in excess of normal levels) whereas PrtI specifically requires active PrtR to form a functional RNA polymerase at 29 °C.
The aprX promoter
In view of the involvement of PrtI in expression of aprX at 29 °C, we sought to determine whether the aprX promoter possesses sequence features in common with other ECF promoters. We have therefore determined the start site of transcription in strain LS107d2 using S1 nuclease analysis (see Methods and Fig. 5).
|
The sequence of the promoter region at -10 and -27/35 bp upstream of the start site is identical to that in strain B52 (Fig. 6), and the transcriptional start site is also identical in this strain (data not shown). Further evidence that these regions represent the promoter is that they are also conserved, in a similar position with respect to the initiation codon, in P. aeruginosa (see Duong et al., 1992 ). This promoter region shows sequence features which are consistent with interaction with an ECF factor, possibly PrtI, although interaction with σ70 (or with both) is not excluded (see Fig. 6).
|
It is therefore possible that aprX is the target of RNA polymerase associated with PrtI, but this remains to be determined. Alternatively, PrtI may be necessary for the transcription of a gene encoding an activator or sigma factor which, in turn, is required for transcription of aprX. It may be noted that we have constructed insertion mutants of prtI and prtR in strain B52 and, in contrast to the equivalent mutants in LS107d2, they do not show lack of protease activity at 29 °C (data not shown). Since the promoters appear to be identical (see above), this may indicate that the aprX promoter is not in fact the target of PrtI in LS107d2; alternatively, features of the sequence upstream of the promoter in B52 may allow recognition by another ECF factor, rendering the promoter PrtI-independent at 29 °C. The question of the target of PrtI, and a mutagenic analysis of the -10 and -35 regions of aprX, merit further study.
In conclusion, this work strongly suggests that prtI and prtR encode a sigma factor and a transmembrane activator, respectively, and that both are required for protease expression at 29 °C. The requirement for such a transmembrane signalling system and an alternative sigma factor at 29 °C is consistent with a stress response to higher temperature. The nature of the signal that is presumably transduced by PrtR is not known; it may be temperature directly, perhaps inducing a conformational change in PrtR, or it may be unfolded periplasmic or outer-membrane proteins, even at the relatively moderate temperature of 29 °C; some precedent for the latter notion is the ECF sigma factor encoded by rpoE in E. coli, whose transcription is increased by misfolded periplasmic and outer-membrane proteins (see Hughes & Mathee, 1998 ; Missiakas & Raina, 1998 ; Pogliano et al., 1997 ). Support for this suggestion comes from the analysis of a transposon mutant of LS107d2 with a very similar phenotype to LS107d2prtR::Tn (unpublished data). This mutant has an insertion in a gene encoding the regulator component of a two-component regulatory system with amino acid sequence similarity to CpxR which, like RpoE, responds to misfolded proteins in the E. coli model (Pogliano et al., 1997 ).
A related question is why the target promoter is inactive at 29 °C. It is possible that the relevant sigma factor is rendered inactive at 29 °C; differing, optimum temperatures for in vitro transcription by several sigma factors in a single species, including different ECF sigma factors, has been demonstrated (Maeda et al., 2000 ).
This work was supported by the Australian Research Council and in part by the Dairy Research Development Corporation. R.G.W. was the recipient of an Australian Postgraduate Award.References
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. L. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 3389-3402.
Andersson, R. E. (1980). Microbial lipolysis at low temperatures. Appl Environ Microbiol 39, 36-40.
Brown, T. A. (1991). Molecular Biology LabFax. Oxford: Bios Scientific Publishers and Blackwell Scientific Publications.
Chi, E. & Bartlett, D. H. (1995). An rpoE-like locus controls outer membrane protein synthesis and growth at cold temperatures and high pressures in the deep-sea bacterium Photobacterium sp. strain SS9. Mol Microbiol 17, 713-726.[Medline]
Cox, J. M. & MacRae, I. C. (1989). A numerical taxonomic study of proteolytic and lipolytic psychrotrophs isolated from caprine milk. J Appl Bacteriol 66, 137-152.[Medline]
Duong, F., Lazdunski, A., Cami, B. & Murgier, M. (1992). Sequence of a cluster of genes controlling synthesis and secretion of alkaline protease in P. aeruginosa: relationship to other secretory pathways. Gene 121, 47-54.[Medline]
Gish, W. & States, D. J. (1993). Identification of protein coding regions by database similarity search. Nat Genet 3, 266-272.[Medline]
Gorham, H. C., McGowan, S. J., Robson, P. R. H. & Hodgson, D. A. (1996). Light-induced carotenogenesis in Myxococcus xanthus: light-dependent membrane sequestration of ECF sigma factor CarQ by anti-sigma factor CarR. Mol Microbiol 19, 171-186.[Medline]
Herrero, M., De Lorenzo, V. & Timmis, K. N. (1990). Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J Bacteriol 172, 6557-6567.
Hughes, K. T. & Mathee, K. (1998). The anti-sigma factors. Annu Rev Microbiol 52, 231-286.[Medline]
Johnson, L. A., Beacham, I. R., MacRae, I. C. & Free, M. L. (1992). Degradation of triglycerides by a pseudomonad isolated from milk: molecular analysis of a lipase-encoding gene and its expression in Escherichia coli. Appl Environ Microbiol 58, 1776-1779.
Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson, G. T., Farris, M. A., Roop, R. M.II & Peterson, K. M. (1995). Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166, 175-176.[Medline]
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J Mol Biol 157, 105-132.[Medline]
Lawrence, R. C., Fryer, T. F. & Reiter, B. (1967). Rapid method for the quantitative estimation of microbial lipases. Nature 213, 1264-1265.
Liao, C.-H. & McCallus, D. E. (1998). Biochemical and genetic characterisation of an extracellular protease from Pseudomonas fluorescens CY091. Appl Environ Microbiol 64, 914-921.
de Lorenzo, V., Herrero, M., Jakubzik, U. & Timmis, K. N. (1990). Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in Gram-negative eubacteria. J Bacteriol 172, 6568-6572.
McKellar, R. C. & Cholette, H. (1987). Effect of temperature shifts on extracellular proteinase-specific mRNA pools in Pseudomonas fluorescens B52. Appl Environ Microbiol 53, 1973-1976.
Maeda, H., Jishage, M., Nomura, T., Fujita, N. & Ishihama, A. (2000). Two extracytoplasmic function sigma subunits, σE and σFecI, of Escherichia coli: promoter selectivity and intracellular levels. J Bacteriol 182, 1181-1184.
Martin, D. W., Holloway, B. W. & Deretic, V. (1993). Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: algU shows sequence similarities with a Bacillus sigma factor. J Bacteriol 175, 1153-1164.
Martin, D. W., Schurr, M. J. & Deretic, V. (1994). Analysis of promotors controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to σE and stress response. J Bacteriol 176, 6688-6696.
Mathee, K., McPherson, C. J. & Ohman, D. E. (1997). Posttranslational control of the algT (algU)-encoded σ22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J Bacteriol 179, 37113720.
Missiakas, D. & Raina, S. (1998). The extracytoplasmic function sigma factors: role and regulation. Mol Microbiol 28, 1059-1066.[Medline]
Nakahama, K., Yoshimura, K., Matumoto, R., Kikuchi, M., Lee, I. S., Hase, T. & Matsubara, H. (1986). Cloning and sequencing of Serratia protease gene. Nucleic Acids Res 14, 5843-5855.
Pemberton, J. M. & Penfold, R. J. (1992). High frequency electroporation and maintenance of pUC and pBR-based cloning vectors in P. stutzeri. Curr Microbiol 25, 25-29.[Medline]
Penfold, R. J. & Pemberton, J. M. (1992). An improved suicide vector for construction of chromosomal insertion mutations in bacteria. Gene 118, 145-146.[Medline]
Pogliano, J., Lynch, A. S., Belin, D., Linn, E. C. C. & Beckwith, J. (1997). Regulation of Escherichia coli cell envelope proteins involved in protein folding and degradation by the Cpx two-component system. Genes Dev 11, 1169-1182.
Rich, J. R. & Willis, D. K. (1990). A single oligonucleotide can be used to rapidly isolate DNA sequences flanking a transposon Tn5 insertion by the polymerase chain reaction. Nucleic Acids Res 18, 6673-6676.
Richardson, B. C. & Te Whaiti, I. E. (1978). Partial characterization of heat-stable extracellular proteases of some psychrotrophic bacteria from raw milk. N Z J Dairy Sci Technol 13, 172-176.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sexton, R., Gill, P. R.Jr, Dowling, D. N. & OGara, F. (1996). Transcriptional regulation of the iron-responsive sigma factor gene pbrA. Mol Gen Genet 250, 50-58.[Medline]
Suhren, G. (1989). Producer microorganisms. In Enzymes of Psychrotrophs in Raw Food , pp. 3-34. Edited by R. C. McKellar. Boca Raton, FL:CRC Press.
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 4673-4680.
Van Hove, B., Staudenmaier, H. & Braun, V. (1990). Novel two-component transmembrane transcription control: regulation of iron dicitrate transport in Escherichia coli K-12. J Bacteriol 172, 6749-6758.
Wassif, C., Cheek, D. & Belas, R. (1995). Molecular analysis of a metalloprotease from Proteus mirabilis. J Bacteriol 177, 5790-5798.
Wilson, K. (1987). Preparation of genomic DNA from bacteria. In Current Protocols in Molecular Biology, pp. 2.4.12.4.5. Edited by F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith & K. Struhl. Brooklyn, NY: Greene Publishing Associates and Wiley Interscience.
Wosten, M. M. S. M. (1998). Eubacterial sigma-factors. FEMS Microbiol Rev 22, 127-150.[Medline]
Received 17 March 2000; revised 11 July 2000; accepted 5 September 2000.