Research Article

A novel valanimycin-resistance determinant (vlmF) from Streptomyces viridifaciens MG456-hF10

Microbiology 2000; 146(2):345

PubMed

Abstract

A novel valanimycin-resistance determinant (vlmF) was isolated from a cosmid containing Streptomyces viridifaciens DNA that leads to valanimycin production in Streptomyces lividans. Expression of the vlmF gene in both Escherichia coli and S. lividans provided valanimycin resistance. The nucleotide sequence of vlmF consists of 1206 bp and the deduced amino acid sequence encodes a polypeptide with 12 putative transmembrane-spanning segments and a calculated pI of 10·1. VlmF shows significant similarities to other known or putative transmembrane efflux proteins that confer antibiotic resistance, but it appears to be specific for valanimycin. The sequence similarities suggest that VlmF is a member of the DHA12 family within the major facilitator superfamily of transport proteins and that it is probably involved in active valanimycin efflux energized by a proton-dependent electrochemical gradient.

Keywords: Streptomyces, antibiotic, resistance, valanimycin

The GenBank accession number for the sequence in this paper is AF148322.

The antibiotic valanimycin (Fig. 1) is a naturally occurring azoxy compound isolated from the fermentation broth of Streptomyces viridifaciens MG456-hF10 by Yamato and coworkers (Yamato et al., 1986 ). In addition to antibacterial activity, valanimycin exhibits potent cytotoxic activity against in vitro cell cultures of mouse leukaemia L1210, P388/S (doxorubicin-sensitive) and P388/ADR (doxorubicin-resistant) (Yamato et al., 1986 ). Valanimycin is a member of a growing family of naturally occurring azoxy compounds, which now includes the cycad toxins macrozamin and cycasin (Lythgoe & Riggs, 1949 ; Langley et al., 1951 ; Riggs, 1956 ; Korsch & Riggs, 1964 ), the carcinogen elaiomycin (Stevens et al., 1956 , 1958 , 1959 ), the antifungal agents maniwamycins A and B (Takahashi et al., 1989 ), the nematocidal compounds jietacins A and B (Imamura et al., 1989 ) and the antifungal agent azoxybacilin (Fujiu et al., 1994 ). Despite the wide range of biological activity exhibited by this class of natural products, relatively little is known about their mechanisms of action. Investigations of valanimycin suggest that the compound inhibits DNA synthesis and causes induction of DNA repair systems (Yamato et al., 1987 ). Previous investigations of valanimycin biosynthesis have established that the antibiotic is derived from L-valine and L-serine and that valine is converted into valanimycin via the intermediacy of isobutylamine and isobutylhydroxylamine (Fig. 1) (Parry et al., 1992 ). In addition, the conversion of isobutylamine to isobutylhydroxylamine was found to be catalysed by a two-component flavin monooxygenase. The genes (vlmH, vlmR) encoding the two components of this flavin monooxygenase have both been cloned from S. viridifaciens and overexpressed (Parry & Li, 1997 ; Parry et al., 1997 ).



(13K):

Fig. 1. Biosynthetic pathway for valanimycin.

In antibiotic-producing organisms, the presence of a self-resistance mechanism is required whenever the antibiotic is potentially harmful to the producer (Cundliffe, 1989 ). The self-resistance can be conferred by a number of mechanisms including target modification, antibiotic inactivation or an efflux system (Cundliffe, 1989 ). In antibiotic-producing Streptomyces, the genes for antibiotic biosynthesis are generally clustered and are often closely associated with one or more resistance genes (Cundliffe, 1989 ). In this report, we describe the cloning of the complete set of genes required for the valanimycin biosynthetic pathway in a low-copy cosmid vector and the characterization of one gene (vlmF) from the cosmid insert that confers valanimycin resistance upon Streptomyces lividans and Escherichia coli. Strains, plasmids and media.
The bacterial strains and plasmids used in this study are indicated in Table 1. Emerson YpSs agar (Difco) was employed as the sporulation medium for S. lividans. S. lividans protoplasts were prepared and transformed by the procedure of Hopwood et al. (1985) . Conjugation of E. coli S17-1 with S. lividans (Mazodier et al., 1989 ) was carried out on AS1 agar (Baltz, 1980 ) using the procedure of Bierman et al. (1992) , with nutrient agar as the top agar. NE agar (10 g D-glucose, 2 g Difco yeast extract, 2 g Casamino acids, 1 g Difco beef extract, 15 g agar l-1, pH 7·0) was used for determinations of valanimycin resistance. Thiostrepton, ampicillin, apramycin, kanamycin and spectinomycin were used at final concentrations of 5, 100, 35, 50 and 30 µg ml-1, respectively. Competent E. coli S17-1 cells were prepared by calcium chloride treatment (Sambrook et al., 1989 ).


Table 1. Bacterial strains and plasmids used in this study


DNA methods.
Genomic DNA was prepared from S. viridifaciens MG456-hF10 using DNAZOL reagent (Gibco-BRL). Plasmid DNA was purified with a QIAprep spin plasmid kit. DNA fragments were isolated from agarose gels with a QIAquick gel extraction kit. PCR products were separated on agarose gels and purified from the gels. Digestion with restriction endonucleases and ligation experiments were carried out by standard procedures under conditions recommended by the manufacturers. Automated DNA sequencing was performed with an Applied Biosystems DNA sequencer at Lone Star Sequencing Laboratories by using universal and synthetic oligonucleotide primers. Synthetic primers were obtained from Integrated DNA Technologies. The sequence of vlmF was determined by complete sequencing of both DNA strands with multiple sequencing of some regions.

Cosmid library construction and screening.
Genomic DNA from S. viridifaciens MG456-hF10 was partially digested with Sau3AI. DNA of the correct size range (3540 kb) was obtained by digestion for 25 min at 37 °C with aliquots of serially diluted enzyme. The digests were monitored by gel electrophoresis using a FIGE mapper (Bio-Rad). The DNA was then dephosphorylated, and ligated to the two arms generated from digestion of pOJ446 with HpaI, followed by dephosphorylation and digestion with BamHI. The ligation mixture was packaged using MaxPlax Packaging Extract from Epicentre Technologies (Madison, WI, USA). The packaged phages were propagated in E. coli DH10B cells. For library screening, the vlmH gene was removed from plasmid pEIBAH (Parry et al., 1997 ) as a 1·1 kb NdeIXhoI fragment and radiolabelled with [α-32P]dCTP using the New England Biolabs NEBlot kit. The pOJ446 library was grown on NZYM agar plates (Sambrook et al., 1989 ) and transferred to Hybond-N nylon membranes (Amersham) in accordance with the manufacturers instructions. The membranes were probed at 42 °C in 5xSSC and 5xDenhardts solution. The final wash was in 0·5xSSC, 0·5% SDS at 59·5 °C for 2 h. Cosmid DNA was isolated from the positive colonies using a QIAprep spin plasmid kit (Qiagen). Competent E. coli S17-1 cells were transformed with isolated cosmid DNA by standard methods (Sambrook et al., 1989 ). Cosmids in E. coli S17-1 were introduced into S. lividans TK24 by the procedure of Bierman et al. (1992) .

Analysis of cosmids for valanimycin production.
S. lividans TK24 strains containing cosmids recovered from the cosmid library by screening with the vlmH gene were fermented in valanimycin production medium according to the procedure of Yamato et al. (1986) . After approximately 40 h, the mycelium was removed by centrifugation, and the fermentation broth was acidified to pH 3. The acidified broth was extracted twice with ethyl acetate. The combined ethyl acetate extracts were concentrated to a small volume in vacuo and examined for the presence of valanimycin by TLC (silica gel; chloroform/methanol/acetic acid, 200:40:1), with UV detection. Several cosmid-containing strains appeared to produce valanimycin in varying amounts, while the fermentation broth derived from S. lividans containing pOJ446 failed to show the presence of valanimycin. The highest producing strain, which contained pVal38, was selected for further study. The fermentation of S. lividans containing pVal38 was carried out on a larger scale and the putative valanimycin was isolated by ethyl acetate extraction and purified by chromatography on Dowex 1X8 (Cl-) (Yamato et al., 1986 ). Since purified valanimycin is somewhat unstable, the solution of valanimycin in ethyl acetate obtained after purification was taken to dryness in vacuo below room temperature. The residue was immediately dissolved in CDCl3 and the solution was analysed by 1H NMR spectrometry. The proton NMR spectrum verified that valanimycin had been produced (Table 2).


Table 2. 1H NMR data for valanimycin isolated from S. viridifaciens and S. lividans TK24(pVal38)


Subcloning of the vlmF gene.
Screening of the valanimycin-producing strain S. lividans TK24(pVal38) for valanimycin resistance as described below revealed that S. lividans TK24(pVal38) was significantly more resistant to valanimycin than S. lividans containing the parent vector pOJ446. Digestion of pVal38 with EcoRI gave a 15 kb fragment derived from the insert in pVal38 (Fig. 2). When this 15 kb fragment was cloned into EcoRI-digested pKC1218 (Bierman et al., 1992 ), the resulting plasmid (pVal15) was found to confer valanimycin resistance on S. lividans. Digestion of the 15 kb fragment with EcoRV yielded an 11·9 kb fragment which was cloned into EcoRV-digested pKC1218 to give pVal12 (Fig. 2). When pVal12 was introduced into S. lividans, it also conferred valanimycin resistance, indicating the presence of one or more resistance genes on this fragment.



(7K):

Fig. 2. Restriction map of the insert in pVal38 and subclones. RI, EcoRI; RV, EcoRV; S, SpeI; X, XhoI.

Construction of expression plasmids.
In order to facilitate the cloning of the vlmF gene into the expression vectors pRSETB and pWHM1109, PCR primers were designed to allow the introduction of EcoRI and HindIII sites. For pRSETB, the sequences of the forward and reverse primers were GGCGAATTCATGACGACGGAACCACTGGC and GTAAAGCTTTTAGGTGAGCTCGCGTCGCT, respectively. The EcoRI and HindIII sites, respectively, are underlined. For pWHM1109, the sequences for the forward and reverse primers were GGCAAGCTTATGACGACGGAACCACTGGC and GTAGAATTCTTAGGTGAGCTCGCGTCGCT, respectively. The HindIII and EcoRI sites, respectively, are underlined. By means of these restriction sites, the PCR products were cloned into pRSETB and pWHM1109 cut with the same endonucleases. PCR was carried out in a 50 µl reaction volume with a 1:1 mixture of Taq and Vent DNA polymerase using pVal38 as a template and the following temperature program: five cycles at 95 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min; 35 cycles at 95 °C for 30 s, 68 °C for 30 s, 72 °C for 1 min; concluded by 5 min at 72 °C.

Sequence analysis.
DNA sequence assembly was performed with Sequencer, Macintosh version 3.0. BLAST searches were performed at the National Center for Biotechnology Information website. SmithWaterman searches were performed at the European Bioinformatics Institute website. The DNA sequence was analysed with the University of Wisconsin Genetics Computer Group (GCG) package, version 8.1-UNIX, including CODONPREFERENCE, BESTFIT, COMPARE, PILEUP and DOTPLOT. Protein alignments were derived from the GCG PILEUP program and from CLUSTALX. The alignments were displayed with SeqVu, Macintosh version 1.01. Hydropathy plots were based on the amino acid hydropathy values of Kyte and Doolittle (Kyte & Doolittle, 1982 ). The DNA Strider program was occasionally used for sequence analysis.

Preparation of valanimycin and valanimycin-containing NE agar.
Streptomyces viridifaciens MG456-hF10 was fermented according to the published procedure. The antibiotic was purified by anion-exchange chromatography on Dowex 1X8 (Cl-). The solution of valanimycin in ethyl acetate obtained after purification was taken to dryness in vacuo below room temperature in a tared flask, and the weight of the valanimycin was determined immediately after removal of traces of solvent under high vacuum. The residue was then immediately dissolved in 10 mM sodium phosphate solution, pH 7·0, and aliquots of the resulting solution were added to warm NE agar before pouring plates.

Determination of MICs of valanimycin and other antibiotics.
E. coli cells and S. lividans spores were inoculated onto NE agar plates containing varying amounts of valanimycin, tetracycline or puromycin. S. lividans containing pVal2 was grown at 30 °C in the presence of thiostrepton (5 µg ml-1) to induce vlmF expression. E. coli NovaBlue(DE3)(pVal3) was grown at 37 °C in the presence of 1 mM IPTG to induce vlmF expression. Growth was scored after overnight incubation with E. coli and after 3 d with S. lividans.

Isolation of valanimycin-producing cosmids
A cosmid library containing S. viridifaciens DNA was constructed in the cosmid shuttle vector pOJ446 (Bierman et al., 1992 ) using fragments derived by partial digestion of genomic DNA with Sau3AI. Screening of the library with a 32P-labelled probe derived from the vlmH gene identified 14 hybridizing clones out of approximately 1000 clones. Cosmid DNA from each of the hybridizing clones was introduced into E. coli S17-1 by transformation and then transferred from S17-1 to S. lividans TK24 by conjugation (Bierman et al., 1992 ). Each cosmid-containing S. lividans clone was fermented in valanimycin production medium, and ethyl acetate extracts of the culture medium were analysed for the presence of valanimycin by TLC with visualization by UV light. Several cosmid-containing clones appeared to produce valanimycin. The clone that appeared to produce the highest levels of valanimycin was selected for additional study. A large-scale fermentation of this clone, pVal38, allowed isolation and purification of a compound that was shown to be valanimycin by TLC and 1H NMR analysis. The 1H NMR data for valanimycin isolated from S. viridifaciens and from S. lividans TK24(pVal38) are compared in Table 2.

Cloning and sequencing of the valanimycin-resistance gene (vlmF)
S. lividans TK24 containing pVal38 was screened for valanimycin resistance on NE agar. This clone was found to be more resistant to valanimycin than S. lividans TK24 and S. lividans TK24 carrying the parent vector pOJ446 (Table 3). Analysis of pVal38 by digestion with several restriction endonucleases revealed that a 15 kb fragment internal to the cosmid insert could be generated by treatment with EcoRI (Fig. 2). This fragment was subcloned into the E. coliStreptomyces shuttle vector pKC1218 (Bierman et al., 1992 ) to give pVal15. Introduction of pVal15 into S. lividans TK24 conferred the same level of valanimycin resistance as did pVal38 (Table 3), a result suggesting that the valanimycin-resistance gene resides on the 15 kb EcoRI fragment. Digestion of the 15 kb fragment with EcoRV yielded a 12 kb fragment that was cloned into pKC1218 to give pVal12. Introduction of pVal12 into S. lividans conferred the same level of valanimycin resistance as pVal38 and pVal15 (Table 3). In order to locate the valanimycin-resistance gene(s), the insert in pVal12 was sequenced. Sequencing revealed the presence of vlmH and vlmR as well as several potential ORFs. The translated amino acid sequence of one of these (vlmF) exhibited similarities to known antibiotic-resistance determinants. The vlmF gene was located approximately 6·4 kb downstream of vlmH and was transcribed in the same direction. vlmF was found to consist of 1206 bp and to encode a polypeptide of 402 amino acids. The vlmF gene exhibited an overall G+C content of 70·4 mol%, with a mean G+C content at the third codon position of 90·0 mol%. These values are typical for Streptomyces genes (Wright & Bibb, 1992 ). The sequence CGAGGA was found about seven nucleotides 5' to the first codon of the vlmF gene. This sequence exhibits a significant degree of complementarity to the 3' end of 16S rRNA of S. lividans and it could serve as a ribosome-binding site (Bibb & Cohen, 1982 ). The calculated molecular mass of the vlmF gene product was 41015 Da, and the calculated isoelectric point was 10·1.


Table 3. Valanimycin resistance of recombinants


Expression of the vlmF gene product and assays for antibiotic resistance
To establish that the putative vlmF gene encodes a protein conferring valanimycin resistance, a DNA fragment containing the gene was amplified from pVal38 by PCR and subcloned into the Streptomyces expression vector pWHM1109 (Tang et al., 1996 ) and the E. coli expression vector pRSETB to give plasmids pVal2 and pVal3. The plasmids were amplified in E. coli DH10B and then transformed into S. lividans TK24 and E. coli NovaBlue(DE3), respectively. S. lividans TK24(pVal2) and E. coli NovaBlue(DE3)(pVal3) were grown on NE agar in the presence of varying amounts of valanimycin. In the case of S. lividans TK24(pVal2), thiostrepton was added to the agar at 5 µg ml-1 to induce vlmF expression from the tipA promoter (Tang et al., 1996 ). E. coli NovaBlue(DE3)(pVal3) was grown in the presence of 1 mM IPTG to induce vlmF expression. The results (Table 3) show that VlmF confers a substantial degree of resistance to valanimycin on both S. lividans and E. coli. E. coli (DE3)(pVal3) and S. lividans TK24(pVal2) were also assayed for resistance to tetracycline and puromycin. Neither clone exhibited enhanced resistance to either antibiotic (data not shown).

Sequence homology studies
GAP, PILEUP and CLUSTALX analyses of vlmF revealed a significant degree of similarity between VlmF and the tetracycline [TetA(H)] and puromycin (Pur8) resistance proteins as well as a number of putative efflux proteins (Fig. 3). A hydropathy plot of VlmF using the amino acid hydropathy values of Kyte and Doolittle (Kyte & Doolittle, 1982 ) indicated that VlmF is a transmembrane protein (Fig. 4). A DOTPLOT comparison of VlmF with TetA(H) and Pur8 indicated that the greatest similarity between these proteins lies within their N-terminal regions (data not shown).



(130K):

Fig. 3. Multiple sequence alignment of VlmF with other efflux proteins. Identical residues are indicated by boxes. Conserved residues between transmembrane domains 2 and 3 are shaded. The abbreviations and accession numbers for the aligned proteins are: YegB, hypothetical protein in alkabaes intergenic region from Escherichia coli (P36554); YnfM, hypothetical protein in mlcasr intergenic region from Escherichia coli (P43451); Pur8, puromycin-resistance protein from Streptomyces lipmanii (P42670); TetA(H), tetracycline-resistance protein, class H, from Pasteurella multocida (P51564); NapC, putative tetracycline efflux protein from Enterococcus hirae (AJ000346); st-Hyp1, hypothetical chloramphenicol and florfenicol resistance protein (fragment) from Salmonella typhimurium (AF097407); SuxA, bicyclomycin and sulfonamide resistance protein from Escherichia coli (P28246).


(17K):

Fig. 4. Hydropathy plot for VlmF obtained according to the hydropathy values of Kyte & Doolittle (1982) as specified by DNA Strider.
A library of genomic DNA from the valanimycin producer S. viridifaciens in the cosmid shuttle vector pOJ446 was screened with an S. viridifaciens gene (vlmH) that is believed to be required for valanimycin biosynthesis (Parry et al., 1997 ). When one of the positively hybridizing cosmid clones (pVal38) recovered from the screening was introduced into S. lividans TK24, the resulting strain produced valanimycin when grown in valanimycin production medium. This suggests that cosmid pVal38 carries all of the genes required for the biosynthesis of valanimycin on a 38 kb fragment. However, the possibility that one or more S. lividans genes is used in the production of valanimycin by this organism cannot be ruled out.

It is now well established that antibiotic-producing micro-organisms carry antibiotic self-resistance genes in order to avoid the lethal effects of their own toxins and, further, that the resistance genes are often closely associated with the corresponding biosynthetic genes. S. lividans containing cosmid pVal38 was therefore evaluated for resistance to valanimycin. The recombinant strain was found to be resistant to valanimycin at twice the concentration of the host organism (Table 3). In a control experiment, the presence of cosmid vector pOJ446 did not affect the level of resistance exhibited by the host. Subcloning experiments combined with resistance screening localized the valanimycin-resistance determinant to a 12 kb EcoRV fragment. Sequencing of this fragment revealed the presence of an ORF (vlmF) exhibiting similarities to known antibiotic-resistance genes and to several hypothetical efflux proteins (see below). When vlmF was cloned into the E. coli and Streptomyces expression vectors pRSETB and pWHM1109, the resulting constructs (pVal3, pVal2) conferred valanimycin resistance on E. coli and S. lividans in the presence of the inducers IPTG and thiostrepton, respectively. In the case of E. coli, pVal3 conferred a level of valanimycin resistance that was at least 10 times greater than that tolerated by the same E. coli strain carrying pRSETB (Table 3). S. lividans carrying pVal2 was resistant to levels of valanimycin at least four times greater than those acceptable to S. lividans containing pWHM1109 (Table 3).

GAP, PILEUP and CLUSTALX analyses of vlmF revealed a significant degree of similarity between VlmF and the tetracycline [TetA(H)] and puromycin (Pur8) resistance proteins as well as between VlmF and a number of putative efflux proteins (Fig. 3). A hydropathy plot of VlmF using the amino acid hydropathy values of Kyte and Doolittle indicates that VlmF is a transmembrane protein with 12 putative transmembrane-spanning domains (Fig. 4). These properties suggest that VlmF is a member of the DHA12 family within the major facilitator superfamily of transport proteins (Pao et al., 1998 ). This assignment is supported by the absence in VlmF of the H motif that is found in the DHA14 family of transport proteins (Paulsen et al., 1996 ). It is of interest that VlmF exhibits similarities to both TetA(H) and Pur8, since TetA(H) is a member of the DHA12 family, while Pur8 is a member of the DHA14 family (Paulsen et al., 1996 ; Pao et al., 1998 ). VlmF contains part of the ß-turn motif [RK]-X-G-R-[RK] which is found between transmembrane domains 2 and 3 in most eukaryotic and prokaryotic transport proteins (shaded in Fig. 3) (Henderson & Maiden, 1990 ). It also contains the SerAsp dipeptide (shaded in Fig. 3) that is conserved in all known tetracycline antiporter proteins (Yamaguchi et al., 1990 ). In addition, VlmF contains a conserved glycine residue (Gly76) that is found in all tetracycline/H+ antiporters and sugar transporters (Yamaguchi et al., 1992 ). While relatively little is known about the mechanism of action of valanimycin, the available information suggests that it damages DNA (Yamato et al., 1987 ). The structure of valanimycin suggests it may be a DNA alkylating agent since the antibiotic contains an electrophilic dehydroalanine moiety. An additional mechanism of action might involve reaction of the dehydroalanine moiety of valanimycin with protein cysteine residues (Chiu et al., 1996 ). A drug efflux protein such as VlmF may be the simplest way for an organism to protect its DNA or proteins against an electrophilic agent such as valanimycin.

Our investigations have shown that VlmF does not confer resistance to either tetracycline or puromycin on S. lividans, even though it exhibits similarities to TetA(H) and Pur8. This is consistent with other studies that have shown that the resistance phenotype conferred by Pur8 on S. lividans is specific for puromycin (Tercero et al., 1993 ). An inspection of the multiple sequence alignment shown in Fig. 3 reveals that most of the similarities between VlmF and other efflux proteins lie in the N-terminal region. This is confirmed by a COMPARE/DOTPLOT analysis (data not shown). The lack of strong similarity between the C-terminal regions of VlmF, TetA(H) and Pur8 as revealed by the DOTPLOT has been observed for other antibiotic efflux proteins (Tercero et al., 1993 ). It may indicate that the C-terminal end of these proteins confers drug-binding specificity (Paulsen et al., 1996 ).

We thank Tomio Takeuchi for a culture of S. viridifaciens and the Keck Computing Center at Rice University for providing the Genetics Computer Group software package for DNA sequence analysis. We thank Sao Jiralerspong for helpful discussions.

Financial support from the National Institutes of Health (grant GM53818) and the Robert A. Welch Foundation (grant C-0729) is gratefully acknowledged.

References

Baltz, R. H. (1980). Genetic recombination by protoplast fusion in Streptomyces.Dev Ind Microbiol 21, 43-54.

Bibb, M. J. & Cohen, S. N. (1982). Gene expression in Streptomyces: construction and application of promoter-probe plasmid vectors in Streptomyces lividans.Mol Gen Genet 187, 265-277.[Medline]

Bierman, M., Logan, R., OBrien, K., Seno, E. T., Rao, R. N. & Schoner, B. E. (1992). Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.Gene 116, 43-49.[Medline]

Chiu, M. L., Folcher, M., Griffin, P., Holt, T., Klatt, T. & Thompson, C. J. (1996). Characterization of the covalent binding of thiostrepton to a thiostrepton-induced protein from Streptomyces lividans.Biochemistry 35, 2332-2341.[Medline]

Cundliffe, E. (1989). How antibiotic-producing organisms avoid suicide.Annu Rev Microbiol 43, 207-233.[Medline]

Fujiu, M., Sawairi, S., Shimada, H., Takaya, H., Aoki, Y., Okuda, T. & Yokose, K. (1994). Azoxybacilin, a novel antifungal agent produced by Bacillus cereus NR2991.J Antibiot 47, 833-835.[Medline]

Henderson, P. J. F. & Maiden, M. C. J. (1990). Homologous sugar transport proteins in Escherichia coli and their relatives in both prokaryotes and eukaryotes.Philos Trans R Soc Lond Ser B 326, 391-410.[Medline]

Hopwood, D. A., Bibb, M. J., Chater, K. F. & 7 other authors (1985). Genetic Manipulation of Streptomyces: a Laboratory Manual. Norwich: John Innes Foundation.

Imamura, N., Kuga, H., Otoguro, K., Tanaka, H. & Omura, S. (1989). Structures of jietacins: unique α,ß-unsaturated azoxy antibiotics.J Antibiot 42, 156-158.[Medline]

Korsch, B. & Riggs, N. V. (1964). Proton magnetic resonance spectra of aliphatic azoxy compounds. The structure of cycasin. Tetrahedron Lett 523525.

Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein.J Mol Biol 157, 105-132.[Medline]

Langley, B. W., Lythgoe, B. & Riggs, N. V. (1951). Macrozamin pt II. The presence of linked nitrogen atoms in the aglycone part. Chem Ind (Lond), 75.

Lythgoe, B. & Riggs, N. V. (1949). Macrozamin pt I. The identity of the carbohydrate component. J Chem Soc 27162718.

Mazodier, P., Petter, R. & Thompson, C. (1989). Intergeneric conjugation between Escherichia coli and Streptomyces species.J Bacteriol 171, 3583-3585.[Abstract/Free Full Text]

Pao, S. S., Paulsen, I. A. & Saier, M. H.Jr (1998). Major facilitator superfamily.Microbiol Mol Biol Rev 62, 1-34.[Abstract/Free Full Text]

Parry, R. J. & Li, W. (1997). An NADPH:FAD oxidoreductase from the valanimycin producer Streptomyces viridifaciens: cloning, analysis, and overexpression.J Biol Chem 272, 23303-23311.[Abstract/Free Full Text]

Parry, R. J., Li, Y. & Lii, F.-W. (1992). Biosynthesis of azoxy compounds. Investigations of valanimycin biosynthesis.J Am Chem Soc 114, 10062-10064.

Parry, R. J., Li, W. & Cooper, H. N. (1997). Cloning, analysis, and overexpression of the gene encoding isobutylamine N-hydroxylase from the valanimycin producer, Streptomyces viridifaciens.J Bacteriol 179, 409-416.[Abstract/Free Full Text]

Paulsen, I. T., Brown, M. H. & Skurray, R. A. (1996). Proton-dependent multidrug efflux systems.Microbiol Rev 60, 575-608.[Abstract/Free Full Text]

Riggs, N. V. (1956). Glucosyloxyazoxymethane, a constituent of the seeds of Cycas circinalis. Chem Ind (Lond), 926.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Simon, R., Priefer, U. & Puhler, A. (1983). A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria.Bio/Technology 1, 784-791.

Stevens, C. L., Gillis, B. T., French, J. C. & Haskell, T. H. (1956). The structure of elaiomycin, a tuberculostatic antibiotic.J Am Chem Soc 78, 3229-3230.

Stevens, C. L., Gillis, B. T., French, J. C. & Haskell, T. H. (1958). Elaiomycin. An aliphatic α,ß-unsaturated azoxy compound.J Am Chem Soc 80, 6088-6092.

Stevens, C. L., Gillis, B. T. & Haskell, T. H. (1959). Elaiomycin. II. Determination of the D-threo configuration.J Am Chem Soc 81, 1435-1437.

Takahashi, Y., Nakayama, M., Watanabe, I., Deushi, T., Ishiwata, H., Shiratsuchi, M. & Otani, G. (1989). Novel antifungal antibiotics maniwamycins A and B. II. Structure determination.J Antibiot 42, 1541-1546.[Medline]

Tang, L., Grimm, A., Zhang, Y. X. & Hutchinson, C. R. (1996). Purification and characterization of the DNA-binding protein Dnrl, a transcriptional factor of daunorubicin biosynthesis in Streptomyces peucetius.Mol Microbiol 22, 801-813.[Medline]

Tercero, J., Lacalle, R. & Jimenez, A. (1993). The pur8 gene from the pur cluster of Streptomyces alboniger encodes a highly hydrophobic polypeptide which confers resistance to puromycin.Eur J Biochem 218, 963-971.[Medline]

Wright, F. & Bibb, M. (1992). Codon usage in the G+C-rich Streptomyces genome.Gene 113, 55-65.[Medline]

Yamaguchi, A., Ono, N., Akasaka, T., Noumi, T. & Sawai, T. (1990). Metal-tetracycline/H+ antiporter of Escherichia coli encoded by a transposon, Tn10.J Biol Chem 265, 15525-15530.[Abstract/Free Full Text]

Yamaguchi, A., Someya, Y. & Sawai, T. (1992). Metal-tetracycline/H+ antiporter of Escherichia coli encoded by transposon Tn10.J Biol Chem 267, 19155-19162.[Abstract/Free Full Text]

Yamato, M., Iinuma, H., Naganawa, H., Yamagishi, Y., Hamada, M., Masuda, T. & Umezawa, H. (1986). Isolation and properties of valanimycin, a new azoxy antibiotic.J Antibiot 39, 184-191.[Medline]

Yamato, M., Umezawa, H., Sakata, N., Moriya, Y. & Hori, M. (1987). Valanimycin acts on DNA in bacterial cells.J Antibiot 40, 558-560.[Medline]

Received 13 July 1999; revised 21 September 1999; accepted 20 October 1999.