Research Article

Acinetobacter baumannii has two genes encoding glutathione-dependent formaldehyde dehydrogenase: evidence for differential regulation in response to iron

Microbiology 2001; 147(10):2805

PubMed

With thanks to our partners for supporting this archive.

Abstract

The adhC1 gene from Acinetobacter baumannii 8399, which encodes a glutathione-dependent formaldehyde dehydrogenase (GSH-FDH), was identified and cloned after mapping the insertion site of Tn3-HoHo1 in a recombinant cosmid isolated from a gene library. Sequence analysis showed that this gene encodes a protein exhibiting significant similarity to alcohol dehydrogenases in bacterial, yeast, plant and animal cells. The expression of the adhC1 gene was confirmed by the detection of GSH-FDH enzyme activity in A. baumannii and Escherichia coli cells that expressed the cloned gene. However, the construction and analysis of an A. baumannii 8399 adhC1::Tn3-HoHo1 isogenic derivative revealed the presence of adhC2, a second copy of the gene encoding GSH-FDH activity. Enzyme assays and immunoblot analysis showed that adhC2 encodes a 46·5 kDa protein that is produced in similar amounts under iron-rich and iron-limited conditions. In contrast, the expression of adhC1, which encodes a 45 kDa protein with GSH-FDH activity, is induced under iron limitation and repressed when the cells are cultured in the presence of free inorganic iron. The differential expression of adhC1 is controlled at the transcriptional level and mediated through the Fur iron-repressor protein, which has potential binding sites within the promoter region of this adhC copy. The expression of both adhC copies is significantly enhanced by the presence of sub-inhibitory concentrations of formaldehyde in the culture media. Examination of different A. baumannii isolates indicates that they can be divided into two groups based on the type of GSH-FDH they produce. One group contains only the constitutively expressed 46·5 kDa protein, whilst the other produces this GSH-FDH type in addition to the iron-regulated isoenzyme. Further analysis showed that the presence and expression of the two adhC genes does not confer resistance to exogenous formaldehyde, nor does it enable it to utilize methylated compounds as a sole carbon source when cultured under iron-rich as well as iron-deficient conditions.

Keywords: adhC copies, formaldehyde metabolism, iron regulation, gene duplication

Abbreviations: EDDHA, ethylenediamine-di(o-hydroxyphenylacetic) acid; FURTA, Fur titration assay; GSH-FDH, glutathione-dependent formaldehyde dehydrogenase

This paper is dedicated to the memory of Dr M. A. Vides, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Argentina, who was a great mentor and colleague.

The GenBank accession number for the sequence reported in this paper is AF130307.

The glutathione-dependent formaldehyde dehydrogenases are members of the superfamily of zinc-containing alcohol dehydrogenases found in animal, plant, yeast and bacterial cells (Uotila & Koivusalo, 1989 ). These ubiquitous enzymes belong to the class III alcohol dehydrogenases and catalyse the oxidation of S-(hydroxymethyl)glutathione, which is formed by the spontaneous reaction between formaldehyde and the SH group of glutathione. This enzymic reaction leads ultimately to the oxidation of highly toxic formaldehyde into formic acid (Uotila & Koivusalo, 1989 ) and it is thus considered an essential function for cell viability.

It was initially proposed that the primary function of bacterial glutathione-dependent formaldehyde dehydrogenase (GSH-FDH) is the metabolism of formaldehyde formed endogenously by oxidative demethylation of compounds such as monomethyl-L-amino acids (Ling & Tung, 1948 ). However, it was found later that this enzyme is essential in the oxidation of methanol and other methylated compounds when they are the sole carbon source in methylotrophic bacteria such as Paracoccus denitrificans (Ras et al., 1995 ) and the facultative phototroph Rhodobacter sphaeroides (Barber et al., 1996 ; Barber & Donohue, 1998a ). It was also shown that GSH-FDH activity is involved in microbial resistance to exogenous formaldehyde (Kaulfers & Wollman, 1988 ; Sasnauskas et al., 1992 ). In the case of Escherichia coli, this resistance activity is due to the GSH-FDH-mediated degradation of formaldehyde, which is encoded by a gene located within a large self-transmissible plasmid (Kummerle et al., 1996 ).

In some bacterial species, the production of GSH-FDH is induced when the cells are growing in culture media containing C1 substrates that are sources of formaldehyde (Barber et al., 1996 ; Hanson & Hanson, 1996 ). Furthermore, examination of GSH-FDH activity in E. coli and Haemophilus influenzae showed that this enzymic activity is induced by formaldehyde at concentrations between 7·9 µM and 264 µM, whereas higher concentrations of this disinfectant were toxic to the bacterial cells (Gutheil et al., 1997 ). The expression of GSH-FDH activity in these two bacteria is controlled at the transcriptional level. In addition, it was recently shown that the transcription of the adhI gene in R. sphaeroides is upregulated by exogenous formaldehyde and S-(hydroxymethyl)glutathione (Barber & Donohue, 1998b ). The redox state of the cell is also an important signal controlling the expression of adhI in R. sphaeroides through the global regulator PrrA (Barber & Donohue, 1998b ). This positive regulator controls the expression of bacterial photosynthetic genes in response to changes in oxygen tension, and it is required to fully stimulate the expression of this gene. However, this is not the only factor controlling adhI expression because its transcription is also increased by the trans-acting mutation spd-7 (Barber & Donohue, 1998b ). These data show that the expression of the gene encoding this activity in bacteria is indeed controlled by a complex regulatory circuitry in which some of the components remain to be identified and characterized.

The genus Acinetobacter includes bacterial species that are widely distributed (Baumann, 1968 ). A. baumannii, previously known as A. calcoaceticus subsp. anitratus, is the most prevalent genospecies associated with human infections, mainly in hospitalized and ambulatory compromised patients (Bergogne-Berenzin & Towner, 1996 ). Although numerous reports describing different aspects related to this pathogen and the infections it causes in compromised patients have been published (Bergogne-Berenzin et al., 1996 ; Bergogne-Berenzin & Towner, 1996 ), not much is known about the basic metabolic processes and the regulation of gene expression.

In this work, we provide evidence that all A. baumannii clinical isolates examined produce a 46·5 kDa protein immunologically related to GSH-FDH, which is encoded by a constitutively expressed gene named adhC2. However, some of these strains harbour an additional copy, identified as adhC1, that encodes a slightly smaller GSH-FDH whose expression is controlled by the iron concentration of the culture media. In addition, our data indicate that the presence and expression of two adhC copies does not confer resistance to exogenous formaldehyde, nor does it enable these strains to utilize some methylated compounds as sole carbon sources.

Bacterial strains, media and plasmids.
Bacterial strains and plasmids used in this work are shown in Table 1. All strains were routinely grown at 37 °C in Luria (L) broth or agar (Sambrook et al., 1989 ), containing the appropriate antibiotics. A Tris/succinate minimal medium consisting of 12·1 g Tris l-1, 3·7 g KCl l-1, 1·1 g NH4Cl l-1, 0·27 g KH2PO4 l-1, 0·001 g CaCl2 . 2H2O l-1, 0·14 g Na2SO4 l-1, 0·01 g MgCl2 . 6H2O l-1, 5·0 g NaCl l-1, 5·0 g sodium succinate l-1, 1·0 g yeast extract l-1 (pH 7·4) was used to grow cells to determine ß-galactosidase (Miller, 1972 ) and GSH-FDH (Barber et al., 1996 ) enzymic activities and the secretion of catechol compounds (Arnow, 1937 ) by E. coli DH5α. The production of these enzymes and catechol compounds by A. baumannii 8399 was tested using cells cultured in Tris/M9 minimal medium, which consisted of Tris/M9 salts (12·1 g Tris l-1, 3·7 g KCl l-1, 1·1 g NH4Cl l-1, 0·15 g CaCl2 . 2H2O l-1, 0·14 g Na2SO4 l-1, 0·1 g MgCl2 . 6H2O l-1, 5·0 g NaCl l-1, adjusted to pH 7·4) supplemented with 0·5% (w/v) glucose, 0·2% (w/v) Casamino acids and 20 µM KH2PO4 (pH 7·4). Iron-rich conditions and iron-deficient conditions were obtained by adding FeCl3 and the iron chelator ethylenediamine-di(o-hydroxyphenylacetic) acid (EDDHA; Sigma), respectively, to minimal media. A. baumannii 8399 cells cultured in Tris/M9 minimal medium supplemented with either 0·00125% (v/v) or 0·0025% (v/v) formaldehyde, concentrations that do not affect cell growth, were used to determine the effect of this C1 compound on the expression of GSH-FDH activity. Resistance to exogenous formaldehyde was determined by the ability of bacterial cells to grow in the presence of increasing concentrations of formaldehyde as previously described (Kaulfers & Brandt, 1987 ), using E. coli VU3695 as a positive control. Growth assays in Simmons salts supplemented with either sodium citrate (10 mM), methylamine (100 mM), ethanol (50 mM), methanol (50 mM), sodium succinate (25 mM), or choline (10 mM) were used to test the utilization of different carbon sources. Simmons salts consisted of 0·2 g MgSO4 l-1, 1·0 g NH4H2PO4 l-1, 1·0 g K2HPO4 l-1 and 5·0 g NaCl l-1, adjusted to pH 7·0.


Table 1. Bacterial strains and plasmids


Determination of GSH-FDH activity.
Bacterial strains were grown for 16 h at 37 °C in 25 ml of either Tris/succinate or Tris/M9 minimal medium. Stationary-phase cells were collected, washed twice with 25 ml TBS (Tris/HCl 50 mM, NaCl 0·15 M, pH 7·5), suspended in 2 ml TBS and lysed by sonication at 4 °C. Supernatants obtained after centrifugation at 15000 g for 3 min were used as crude cell extracts to determine enzymic activity spectrophotometrically as described previously (Barber et al., 1996 ). The enzymic activity of each sample, expressed as µmol NAD reduced min-1 (mg protein)-1, was determined at least twice using fresh samples each time. The assays were done in duplicate each time and the results are reported as the mean value±1SD of a representative experiment. GSH-FDH activity was also tested in proteins separated by polyacrylamide gel electrophoresis under non-denaturing conditions. The gels and samples were prepared and run under the conditions described previously (Actis et al., 1985 ), but without the addition of SDS and 2-mercaptoethanol. The enzymic activity was revealed by staining the gels with NAD, reduced glutathione, phenazine methosulfate and nitro blue tetrazolium (Uotila & Koivusalo, 1979 ). Protein concentration was determined as described by Bradford (1976) .

Recombinant DNA techniques.
Standard DNA recombinant methods were done as described by Sambrook et al. (1989) . DNA restriction fragments used as probes were either isolated from agarose gels with the GeneClean kit (Bio101) or amplified by PCR using the conditions described previously (Barancin et al., 1998 ). The probes were labelled with [α-32P]dATP or [α-32P]dCTP using the oligolabelling method (Feinberg & Vogelstein, 1983 ). The adhC1.5' (5'-CTTGCTTAGACGTATGTGAC-3') and adhC1.3' (5'-CCTACTCCAGTATGGGTAATC-3') primers were used to amplify the 5' region of adhC1. DNA nucleotide sequences were determined manually (Sanger et al., 1979 ) or by automated DNA sequencing with the BigDye terminator cycle sequencing kit (PE-Applied Biosystems). DNA and protein sequences were analysed using the BLAST network service at NCBI, the GCG University of Wisconsin Genetics Computer software package, and ProfileScan, which is available at http://www.ch.embnet.org/software/PFSCAN.

Construction of a genomic library and transposition mutagenesis.
The library was constructed using pVK102 and 8399 chromosomal DNA partially digested with HindIII as described previously (Genti-Raimondi et al., 1991 ). The Tn3-HoHo1 transposon (Stachel et al., 1985 ) was used as described previously (Tolmasky et al., 1988 ) to generate insertional derivatives of recombinant cosmids harbouring A. baumannii 8399 DNA. Recombinant cosmids and Tn3-HoHo1 insertional derivatives were introduced into E. coli DH5α by electroporation. The A. baumannii 8399M6 adhC1::Tn3-HoHo1 isogenic derivative was obtained using pM6 and the allelic-exchange method described previously (Tolmasky et al., 1993 ). The cosmid pM6 was conjugated into the 8399 wild-type strain and then cured by incompatibility with pPH1JI. The 8399M6 transconjugant was selected on L agar containing 10 µg chloramphenicol ml-1, 500 µg ampicillin ml-1 and 50 µg gentamicin ml-1. Generation of the appropriate derivative was confirmed by Southern hybridization and nucleotide sequencing after PCR amplification and cloning into pCR2.1. DNA hybridization experiments were carried out under high- and low-stringency conditions as previously described (Graber et al., 1998 ).

Cloning of promoter elements, RNA analysis and S1 mapping.
The 500 bp ClaIEcoRI fragment, containing the left end of Tn3-HoHo1 and the predicted adhC1 promoter region, was cloned into pSK+ to generate pPE9. This derivative was used to create the reporter construct pPE9-lacZ by cloning at the EcoRI site the DNA cassette from pAB2001 (Becker et al., 1995 ), which harbours a promoterless lacZ gene and encodes gentamicin resistance. Total RNA from A. baumannii 8399 cells, grown to mid-exponential phase at 37 °C in Tris/M9 containing either 50 µM EDDHA or 300 µM FeCl3, was isolated using hot phenol (Barancin et al., 1998 ). Northern blots were prepared and probed with the 32P-labelled ClaI-EcoRI fragment using standard techniques (Sambrook et al., 1989 ). The adhC1 transcription initiation site(s) was determined by S1 mapping as described previously (Bidinost et al., 1999 ; Wu & Janssen, 1997 ). Primer #188 (5'-CGATACTACTCAAGCTCCAAATGGC-3') was end-labelled and used together with unlabelled primer #189 (5'-CCTGGAGCAAAGGCGACAGCTGCACG-3') to PCR amplify the adhC1 promoter region. The purified amplicon and total RNA were coprecipitated, dissolved in hybridization buffer and allowed to anneal at 53 °C. E. coli tRNA was used as negative control. The samples were digested with nuclease S1 and analysed by electrophoretic comparison under denaturing conditions to a ladder obtained by dideoxynucleotide sequencing using the primer #189 and the plasmid pMU6 as a template.

Overexpression of GSH-FDH.
E. coli BL21(DE3) cells harbouring pMU6, a pBCSK+ derivative with adhC1 cloned downstream of the T7 promoter, were grown in L broth at 37 °C until the OD600 reached a value of 0·50·6. Gene expression was then induced by the addition of IPTG as previously described (Studier et al., 1990 ). After washing with 1 vol. TBS, whole-cell lysates were prepared and analysed by SDS-PAGE (Actis et al., 1985 ; Smoot et al., 1998 ).

Protein electrophoresis and immunoblot analysis.
Samples containing either 25 µg or 50 µg proteins were loaded onto mini (5 cm longx8 cm wide separating gel) and large (16 cm longx15 cm wide separating gel) polyacrylamide gels, respectively. GSH-FDH and the Fur repressor were detected by immunoblotting using standard protocols (Towbin et al., 1979 ). The antiserum against the E. coli Fur was raised and absorbed as described previously (Tolmasky et al., 1994 ). The anti-GSH-FDH serum was prepared using the protein isolated by SDS-PAGE and electroelution, and immunopurified with nitrocellulose strips containing the cognate antigen band as described previously (Olmsted, 1981 ). The immunocomplexes were detected using horseradish-peroxidase-labelled protein A and the SuperSignal CL-HRP substrate (Pierce Chemical).

Cloning of fur and detection of Fur boxes.
The A. baumannii 8399 fur gene was PCR amplified using the primers #265 (5'-CCAAAGATTGAACAACAAGCTAGG-3') and #267 (5'-CGATTATTTCTTGCGCAATGCTTCC-3'), which were designed using the nucleotide sequence reported by Daniel et al. (1999) . The reaction and cycling conditions were as described previously (Barancin et al., 1998 ) with the exception that 55 °C was used as the annealing temperature. The amplicon was cloned with the Invitrogen TA system using E. coli Top10F' competent cells. The presence of the A. baumannii fur homologue and the expression of Fur activity by recombinant clones were confirmed by determining the nucleotide sequence of the cloned amplicon and testing it using the E. coli RRJC1 reporter strain (Wertheimer et al., 1994 ), respectively. The BamHIXbaI insert of one of these clones, named pMU45, was ligated into pACYC184 to create the plasmid pMU45.184 that was used to examine the iron-regulated expression of cloned adhC1. The presence of Fur (iron) boxes was assessed using the Fur titration assay (FURTA) (Stojiljkovic et al., 1994 ). The FURTA phenotype was confirmed by determining the ß-galactosidase activity (Miller, 1972 ) of cells cultured in liquid medium supplemented with 100 µM FeCl3 at least twice. Each time, the assays were done in duplicate and the results are reported as the mean value±1SD of a representative experiment.

Cloning and sequencing of adhC
The presence of a gene encoding GSH-FDH in the genome of A. baumannii was initially detected during the screening of Tn3-HoHo1 insertion derivatives of a genomic library that expressed iron-regulated ß-galactosidase activity. Analysis of one of these derivatives, which was named pM6, showed that Tn3-HoHo1 interrupted a potential ORF related to the human class III alcohol dehydrogenase and several bacterial glutathione-dependent formaldehyde dehydrogenases. The entire gene was cloned as part of a 2·1 kb ClaI-EcoRI fragment, which was identified by colony and Southern blotting using an A. baumannii 8399 DNA fragment adjacent to the Tn3-HoHo1 site as a probe. Nucleotide sequence analysis showed that the ORF where the transposon inserted consists of 1110 nucleotides followed by a GC-rich palindrome and a poly(T) tract that may function as a rho-independent transcriptional terminator. This ORF is preceded by the nucleotide sequence AGGAAA resembling a ribosome-binding site (Shine & Dalgarno, 1974 ) and encodes a polypeptide of 369 aa residues with a predicted molecular mass of 39267 Da. A comparison of the predicted amino acid sequence encoded by this ORF with the GenBank database confirmed the similarity of this protein to glutathione-dependent formaldehyde dehydrogenases found in prokaryotic and eukaryotic cells. Although these dehydrogenases have the same activity and share high amino acid sequence homology, they have been reported with different names such as FDH, GS-FDH, GSH-FDH, FALDH and GD-FALDH. Similarly, the genes encoding these proteins in different cell types were reported with various names such as adhC, adhI, adh3, gd-faldh and flhA. In this work, the A. baumannii gene encoding glutathione-dependent formaldehyde dehydrogenase activity and its cognate translation product are reported as adhC and GSH-FDH, respectively.

The predicted amino acid sequence of the A. baumannii GSH-FDH is highly similar to bacterial enzymes such as those found in H. influenzae Rd (83·7% identity, accession no. P44557), P. denitrificans (62·9% identity, accession no. L36327), R. sphaeroides (61·7% identity, accession no. L47326), Methylobacter marinus (28·0% identity, accession no. L33464), E. coli K-12 strain MG1655 (85·6% identity, accession no. AAC73459·1) and E. coli VU3695 (85·9% identity, accession no. X73835). The latter is a plasmid-encoded gene product that confers formaldehyde resistance (Kummerle et al., 1996 ). The A. baumannii 8399 GSH-FDH also showed significant similarity to the glutathione-independent formaldehyde dehydrogenase produced by Pseudomonas putida (30·7% identity, accession no. D21201). The alignment of these predicted amino acid sequences showed that the A. baumannii GSH-FDH enzyme contains several conserved amino acids required for the structure and enzymic activity of this protein, such as the C-40, H-62 and C-169 ligands to the active Zn, the cysteine residues at positions 92, 95, 98 and 106 that bind to the second Zn atom, and the typical NAD+-binding site 193-GLGGIG-200 (Ras et al., 1995 ; Whener et al., 1993 ).

Generation of an adhC isogenic mutant
One of the metabolic pathways that detoxifies formaldehyde by using it as a carbon source and generates essential reducing power in the form of NADH includes the enzymic action of GSH-FDH (Hanson & Hanson, 1996 ; Large, 1983 ). To test whether this enzyme activity plays a similar role in A. baumannii, the pM6 cosmid harbouring the adhC::Tn3-HoHo1 copy was used to create the 8399M6 (adhC::Tn3-HoHo1) isogenic mutant by marker exchange (Tolmasky et al., 1993 ). Southern blot analysis showed that the adhC probe hybridized with a 6·4 kb HindIII fragment present in the chromosome of the 8399 wild-type strain and the pPA6 cosmid clone (Fig. 1, lanes 1 and 2). As predicted, the pM6 HindIII fragment harbouring adhC increased its size to about 20 kb, a 14 kb increase due to the insertion of Tn3-HoHo1 within this gene (Fig. 1, lane 3). A HindIII fragment with a size similar to the latter was detected in the genome of the A. baumannii 8399M6 strain, with the concomitant disappearance of the 6·4 kb HindIII fragment detected in the wild-type strain (Fig. 1, lane 4). The Tn3-HoHo1 insertion site in the chromosome of A. baumannii 8399M6 was confirmed by Southern blot hybridization and by sequencing a PCR fragment encompassing the putative adhC promoter region and the 5' end of the leaderless ß-galactosidase gene present at one of the ends of Tn3-HoHo1. This approach showed that the transposon inserted between the T116 and the A117 of the predicted adhC ORF.



(99K):

Fig. 1. Detection of adhC copies in A. baumannii by Southern blot analysis. Total DNA isolated from the 8399 wild-type strain (lane 1) and the 8399M6 (adhC1::Tn3-HoHo1) isogenic derivative (lane 4) and the recombinant cosmids pPA6 (lane 2) and pM6 (lane 3) were digested with HindIII and blotted onto nitrocellulose. The blots were probed with adhC1 under low stringency. The size of the λ HindIII fragments (lane 5) is indicated in kb.

The DNA hybridization analysis also revealed that the adhC probe recognizes an additional 4·3 kb HindIII fragment present in the genome of the 8399 wild-type strain, which is absent in the pPA6 recombinant cosmid (compare lanes 1 and 2 of Fig. 1). The same 4·3 kb HindIII fragment was also present in the genome of the 8399M6 (adhC::Tn3-HoHo1) derivative (Fig. 1, lane 4). These results demonstrate that the A. baumannii 8399 strain has two adhC genes located in different genomic regions. However, the nucleotide sequences of these two adhC copies appear to be somewhat different because the presence of the adhC copy located within the 4·3 kb HindIII fragment could be detected only when the hybridization experiments were conducted under low stringency conditions. The copy cloned and characterized in this work is identified as adhC1, whilst the copy detected by DNA hybridization is referred to as adhC2.

Growth studies in L broth revealed that strain 8399M6 (adhC1::Tn3-HoHo1) was viable and showed a growth rate slightly higher than the 8399 wild-type strain during the exponential phase (data not shown). However, both cultures reached similar cell density during stationary phase. Both strains also showed similar growth rate and final cell density when cultured in Tris/M9 minimal medium, although the final cell mass was not as high as that observed with L broth.

Analysis of the expression of adhC
GSH-FDH assays showed that the 8399 parental strain and the 8399M6 isogenic derivative produced 160·9±6·9 and 59·7±2·61 µmol NADH min-1 (mg protein)-1, respectively. These data demonstrate that the insertion of Tn3-HoHo1 in adhC1 results in a 2·7-fold reduction but not complete elimination of enzyme activity, providing further support for the presence of adhC isogenes in the genome of A. baumannii 8399. It is noteworthy that no formaldehyde dehydrogenase activity was detected in either of these A. baumannii strains when glutathione was not added to the reaction mixture, suggesting that the 8399 strain does not express glutathione-independent formaldehyde dehydrogenase activity.

Enzyme levels similar to those detected in the 8399 parental strain were also measured in E. coli DH5α cells harbouring pPA6, in which adhC1 was cloned into the cosmid pVK102, whilst the activity was increased almost 10-fold when the cells contained this gene cloned in the higher-copy-number recombinant plasmid pMU6. In contrast, DH5α cells that harboured the cloning vectors pVK102 or pBCSK+ produced 106·8±29·2 and 116·0±34·5 µmol NADH min-1 (mg protein)-1, respectively. These lower levels represent the enzyme activity encoded by the chromosome of this bacterium (Gutheil et al., 1997 ). Comparable lower enzyme levels were also detected in E. coli DH5α cells containing pM6, the pPA6 derivative that has Tn3-HoHo1 inserted within the adhC1 gene.

The adhC1 gene product was characterized by PAGE under denaturing and non-denaturing conditions using cells that overexpressed this gene. For this purpose, we used the T7 promoter-RNA polymerase system (Tabor & Richardson, 1985 ) and exploited the fact that the adhC1 cloned in pMU6 was inserted downstream and transcribed in the same direction as the T7 promoter present in the pBCSK+ vector. SDS-PAGE analysis showed the presence of a 45 kDa protein in the extract of E. coli BL21(DE3) cells harbouring pMU6 when induced with IPTG (Fig. 2a, lane 4). This protein was also detected, although at a lower amount, in the extract of non-induced cells (lane 3). In contrast, no significant changes of protein bands within this molecular size range were detected in the extracts of non-induced and induced E. coli BL21(DE3) cells harbouring either pBCSK+ (lanes 1 and 2) or pMU6.ΔN (lanes 5 and 6). Both these constructs were used as negative controls, with the latter being a derivative of pMU6 in which a 941 bp NsiI fragment that contains most of adhC1 was deleted. When the samples obtained from IPTG-induced cells (Fig. 2a, lanes 2, 4 and 6) were analysed by PAGE under non-denaturing conditions and stained to detect GSH-FDH, the extract of cells containing pMU6 (Fig. 2b, lane 2) was the only sample that showed a protein band with enzymic activity. A faint band with similar mobility representing the GSH-FDH produced by the E. coli host strain was detected in the other two samples only after prolonged staining (data not shown).



(35K):

Fig. 2. Overexpression and detection of GSH-FDH. (a) E. coli BL21(DE3) cells harbouring either the cloning vector pBCSK+ (lanes 1 and 2) or the recombinant derivatives pMU6 (lanes 3 and 4) or pMU6.ΔN (lanes 5 and 6) were cultured as described in Methods. Lysates (25 µg per lane) of non-induced (lanes 1, 3 and 5) and IPTG-induced (lanes 2, 4 and 6) cells were size fractionated by SDS-PAGE and stained with Fast stain. The arrows indicate the protein band corresponding to GSH-FDH. (b) The samples shown in lanes 2, 4 and 6 of (a) were fractionated by PAGE under non-denaturing conditions and stained with NAD, reduced glutathione, phenazine methosulfate and nitro blue tetrazolium to detect GSH-FDH activity. (c) Immunological detection of GSH-FDH produced by the 8399 wild-type strain (lane 1) and the 8399M6 (adhC1::Tn3-HoHo1) isogenic derivative (lane 2). Total cell proteins (50 µg per lane) were size-fractionated in a large polyacrylamide gel under denaturing conditions before blotting and probing with anti-GSH-FDH serum.

The 45 kDa band produced after IPTG induction of E. coli BL21(DE3) cells harbouring pMU6 was used to raise polyclonal antibodies against GSH-FDH. Western analysis using immunopurified anti-GSH-FDH serum showed the presence of a protein band in the whole-cell extracts of E. coli DH5α harbouring the vector pBCSK+ or the pMU6 plasmid that contains the 8399 adhC1 copy, although the signal was much stronger in the sample containing the latter. As indicated before, the band detected in E. coli DH5α(pBCSK+) most likely represents the protein encoded by the cognate gene present in the genome of this cloning strain. The same immunoblot analysis using mini-SDS-polyacrylamide gels showed the presence of a single and an apparent double band, which all migrated close to the 45 kDa molecular mass marker, in the whole-cell extracts of the 8399M6 adhC1::Tn3-HoHo1 isogenic derivative and the 8399 parental strain, respectively (data not shown). This observation was further confirmed by immunoblot analysis using large polyacrylamide gels which showed presence of two polypeptides that differ by 1·5 kDa in their sizes in the 8399 cell lysate (Fig. 2c, lane 1). In contrast, the 8399M6 whole-cell extract contained only the 46·5 kDa protein, the larger of the two protein bands reacting with the anti-GSH-FDH serum (Fig. 2c, lane 2).

These data, taken together with the results obtained using enzymic assays, confirm that A. baumannii 8399 carries and expresses two adhC isogenes, which encode proteins with molecular sizes similar to those detected in other bacteria that produce GSH-FDH activity. Cloning and sequencing experiments have shown so far that, generally, bacteria carry a single adhC gene, with the apparent exception of E. coli VU3695. This clinical strain contains a large self-conjugative plasmid that harbours an adhC copy encoding resistance to exogenous formaldehyde (Kummerle et al., 1996 ). This observation, together with the fact that E. coli DH5α (Gutheil et al., 1997 ) and MG1655 (Blattner et al., 1997 ) have an adhC chromosomal copy, suggest that E. coli VU3695 indeed carries chromosomal and plasmid adhC copies. Whether either A. baumannii 8399 adhC isogene is located on a plasmid element remains to be determined.

Regulation of the expression of adhC
It has been established that C1 compounds such as formaldehyde control the production of GSH-FDH in bacteria like E. coli and H. influenzae (Gutheil et al., 1997 ). Similarly, the enzyme activity produced by the A. baumannii 8399 wild-type strain and the 8399M6 adhC1::Tn3-HoHo1 isogenic derivative was increased between five- and tenfold when the cells were cultured in the presence of sub-inhibitory concentrations of formaldehyde. However, our initial observation that an adhC1lacZ transcriptional fusion expressed iron-regulated ß-galactosidase appears to be novel, and it prompted us to examine the effect of this metal on the expression of GSH-FDH in more detail. Spectrophotometric assays showed that GSH-FDH activity in E. coli DH5α harbouring pPA6 was about twofold higher in cells cultured under iron limitation than in cells cultured under iron-rich conditions (see Table 2). A similar response to changes in iron concentration was observed in E. coli DH5α cells harbouring pMU6, although the enzymic activity detected in iron-starved cells was much higher due to the higher copy number of this clone. This table also shows that the enzymic activity of cells harbouring either the vector pVK102 or pM6 (adhC1::Tn3-HoHo1) was comparable under iron-limiting or iron-rich conditions. The effect of iron on the expression of GSH-FDH was also tested in the A. baumannii 8399 wild-type strain. Table 2 shows that the GSH-FDH activity increased significantly as the minimal medium was supplemented with increasing concentrations of the iron chelator EDDHA, with an almost tenfold difference between the enzymic activity detected in 8399 cells cultured under iron-rich and iron-limiting conditions. The enzymic activity of A. baumannii 8399M6 (adhC1::Tn3-HoHo1) cells cultured in the presence of 300 µM FeCl3 was similar to that of the parental strain grown under the same conditions and was increased only about 1·5-fold when the cells were cultured under iron-limiting conditions. The iron regulation of adhC1 transcription in the A. baumannii 8399 wild-type strain was further examined by Northern blot analysis. Fig. 3 shows the presence of an RNA band of 1400 nucleotides which coincides with the predicted size of the transcription product of adhC1. Scanning densitometry of the autoradiogram showed that the amount of adhC1 transcripts in the total RNA sample obtained from iron-starved cells (lane 2) was six- to eightfold higher than the amount present in total RNA isolated from iron-replete cells (lane 1). Taken together, the data indicate that although the expression of both A. baumannii 8399 adhC copies are regulated by formaldehyde, only the transcription of adhC1 is affected by the iron concentration of the media.


Table 2. GSH-FDH activity in A. baumannii 8399 and E. coli DH5α clones harbouring various plasmids cultured under iron-rich and iron-limiting conditions



(67K):

Fig. 3. Northern blot analysis of adhC1 expression in A. baumannii. Total RNA isolated from cells grown under iron-rich (lane 1) and iron-deficient (lane 2) conditions was fractionated by formaldehyde-agarose gel electrophoresis. (a) Gel stained with ethidium bromide. (b) Northern blot of samples shown in (a) probed with a 32P-labelled fragment harbouring adhC1. The size of the transcript detected with the probe is indicated on the right.

The possibility that the regulation of the expression of adhC1 by iron is mediated through the Fur repressor was investigated by testing for the presence of potential Fur or iron boxes within the promoter of adhC1 using FURTA (Stojiljkovic et al., 1994 ). The E. coli H1717 Fur-deficient reporter strain harbouring the pPE9 recombinant construct containing the adhC1 promoter region produced 125±19 Miller units of ß-galactosidase when cultured in broth supplemented with inorganic iron. In contrast, only 16±4 units of enzyme were detected when this reporter strain harboured just the cloning vector. These results suggested that the adhC1 promoter region contains Fur-binding sites. This hypothesis was confirmed by the observation that cells of the E. coli fur mutant strain BN4020 harbouring pPE9-lacZ and the empty vector pACYC184 produced 1132±20·7 Miller units of ß-galactosidase, while this enzymic activity was reduced to 125·8±7·1 and 11·2±0·08 units when the reporter cells harboured pPE9-lacZ together with either pMH15 (E. coli fur) or pMU45.184 (A. baumannii fur), respectively. Immunoblot analysis and Arnow tests confirmed that the presence of pMH15 and pMU45.184 resulted in the biosynthesis of the Fur repressor protein and restored the iron-regulated biosynthesis of catechol compounds in the E. coli H1717 Fur-deficient strain (data not shown). Analysis of the adhC1 region expressing promoter activity showed that it contains potential Fur-binding sites similar to those described in other iron-regulated genes. The nucleotide sequence GATAATGAT, which is located 198 nucleotides upstream of the AUG codon (Fig. 4a), shares 9 of the 19 nucleotides found in the GATAATGATAATCATTATC consensus sequence for the Fur-binding site of iron-regulated genes (Calderwood & Mekalanos, 1988 ). This sequence is followed by the hexamer GATAAG that closely resembles the minimal interaction unit NAT(A/T)AT, which was recently reported as the nucleotide array that can explain the iron-regulated expression of AT-rich promoters that do not contain canonical Fur boxes (Escolar et al., 1999 ). Furthermore, at least 10 other units very similar to those found in the aerobactin promoter region (Escolar et al., 2000 ) can be identified upstream of the adhC1 initiation codon. This region also includes the sequence TAGCATTACATTATCTATTTTGCT that matches 19 of the 24 nucleotides found in the non-template strand of the Fur-binding site I of the promoter region of the fatDCBA operon of the pJM1 plasmid (Chai et al., 1998 ). The potential regulatory role of these sequences is further supported by the results obtained using S1 mapping, which showed three adjunct adhC1 transcription initiation sites (Fig. 4b) located within a region that contains three adjacent Fur-binding units (Fig. 4a). Furthermore, the putative -10 adhC1 promoter element was found nearby these units. These results are consistent with the presence of potential Fur-binding sites in the adhC1 promoter region that can account for the iron-regulated expression of this gene via the Fur iron repressor protein. The precise interaction of this regulator with specific nucleotides located in the adhC1 promoter remains, however, to be determined with approaches similar to those used in the characterization of other iron-regulated genes in different bacteria.



(32K):

Fig. 4. Analysis of the adhC1 promoter region. (a) Location of transcription start sites and predicted Fur boxes within the adhC1 promoter region. Putative -35 and -10 promoter elements and a potential ribosome-binding site (RBS) are underlined. The three horizontal arrows indicate the cognate adhC1 transcriptional initiation sites marked in (b). The first codon of adhC1 is in bold italics and the boxed nucleotides identify potential Fur-binding sites. (b) adhC1 transcription start site mapping using either total RNA (lane 1) or tRNA (lane 2). The DNA sequencing ladders represent the sense strand and the transcription initiation sites are marked with asterisks.

Detection of GSH-FDH in other clinical isolates of A. baumannii
A collection of 12 isolates typed by their plasmid content, which were obtained during an outbreak of respiratory infections caused by this pathogen (Actis et al., 1993 ) and which includes the strain 8399, was tested by immunoblotting. Although all strains produced the 46·5 kDa protein reacting with the anti-GSH-FDH serum, only six of them contained the 45 kDa protein detectable by this approach. The growth of these 12 strains in broth was inhibited by as little as 0·005% formaldehyde. Conversely, E. coli strain VU3695, which is resistant to formaldehyde due to the expression of plasmid-mediated formaldehyde dehydrogenase activity (Kaulfers & Brandt, 1987 ), grew well in the L broth containing up to 0·02% of this disinfectant. Furthermore, in the case of A. baumannii 8399, the parental strain and its adhC1 insertional derivative 8399M6 expressed similar formaldehyde-resistance levels under iron-rich and iron-limiting conditions. It was also determined that all the A. baumannii strains grew in minimal medium supplemented with either citrate, succinate or ethanol as a carbon source. However, no growth was detected when these 12 strains were cultured in minimal medium supplemented with either choline, methanol or methylamine. Further assays showed that the parental strain 8399 and the isogenic derivative 8399M6 could not grow in a chemically defined medium supplemented with either 0·00125% or 0·0025% formaldehyde as a sole carbon source. These two formaldehyde concentrations, which were the same as those used to test the induction of GSH-FDH activity by this compound, did not affect the growth of these two strains in minimal medium supplemented with succinate as a sole carbon source. The ability of the 8399 parental strain and its adhC1::Tn3-HoHo1 isogenic derivative to use formaldehyde as a carbon source did not change by using iron-rich or iron-restricted culture conditions.

Concluding remarks
The data presented in this report show that some strains of A. baumannii contain two adhC isogenes, one of which is expressed in a Fur- and Fe-dependent manner. However, the presence of two adhC copies and the differential expression of one of them does not affect, at least under the conditions used in this study, the growth rate of the cells, the ability to resist exogenous formaldehyde, or the use of different methylated compounds as sole carbon sources. This gene duplication may represent simply an intermediate step or an incomplete gene transfer process that left two adhC isogenes in some strains of A. baumannii. However, the fact that only adhC1 is iron regulated may suggest that the product of this gene plays a role additional to its well-established function in the detoxification of intracellular formaldehyde. It was recently reported that organic acids such as formate, which is produced by the successive enzymic action of GSH-FDH and S-formylglutathione hydrolase on formaldehyde, protect stationary-phase E. coli and Salmonella cells from killing by cationic peptides (Barker et al., 2000 ). Thus, a potential protective function of increased expression of GSH-FDH, which would result in higher intracellular levels of formate, is in agreement with the fact that pathogens such as A. baumannii encounter antimicrobial peptides produced by the host. Furthermore, the Fur-regulated expression of adhC1 is consistent with the well-known fact that iron-restricted conditions of the host control the expression of a large number of bacterial genes. Also, it has recently been proposed that Fur works more like a global regulator that controls different cell functions in addition to those involved in iron acquisition (Escolar et al., 1999 ). Another aspect that should be considered is that other metals, besides iron, could be involved in the Fur-mediated regulation of the adhC1 expression in A. baumannii 8399. Bacillus subtilis contains the yqkL, yqfV and ygaG fur homologues in its genome (Cummings & Connerton, 1997 ; Mizuno et al., 1996 ), which encode distantly related regulatory proteins that control different regulons. The first two homologues encode a Fur iron repressor, which controls the transcription of siderophore biosynthetic and ferri-siderophore transport genes, while the PerR regulator controls the response of this bacterium to peroxide stress (Bsat et al., 1998 ). The ygaG gene encodes the B. subtilis Zur homologue that controls the expression of two operons involved in zinc transport. The potential presence of such a homologue, which would control the biosynthesis of the GSH-FDH zinc metalloenzyme, seems quite reasonable. However, the expression of more than one fur homologue in A. baumannii 8399 that can control the expression of unrelated regulons remains to be seen.

This work was supported by grants from the Medical Research Foundation of Oregon, the American Lung Association (ALA) and research funds from Miami University to L.A.A. and grants from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) of Argentina, Consejo de Investigaciones Científicas y Tecnológicas de Córdoba (CONICOR) and Agencia Nacional de Promoción Científica y Tecnológica (ANPCYT) to L.A.A. and L.C.P. J.R.E. was supported by predoctoral fellowships from CONICOR, Secretaría de Ciencia y Tecnología de la Nación (SECYT) and funds from Fundación VER and ALA. We are grateful to Dr K. Hellingwerf (University of Amsterdam) and G. Janssen (Miami University) for kindly providing the pAB2001 plasmid and the E. coli BL21(DE3) strain, respectively.

References

Actis, L. A., Potter, S. & Crosa, J. H. (1985). Iron-regulated outer membrane protein OM2 of Vibrio anguillarum is encoded by virulence plasmid pJM1. J Bacteriol 161, 736-742.[Abstract/Free Full Text]

Actis, L. A., Tolmasky, M. E., Crosa, L. M. & Crosa, J. H. (1993). Effect of iron-limiting conditions on growth of clinical isolates of Acinetobacter baumannii. J Clin Microbiol 31, 2812-2815.[Abstract/Free Full Text]

Arnow, L. (1937). Colorimetric determination of the components of 3,4-dihydroxyphenylalanine-tyrosine mixtures. J Biol Chem 118, 531-537.[Free Full Text]

Bagg, A. & Neilands, J. (1985). Mapping of a mutation affecting regulation of iron uptake systems in Escherichia coli K-12. J Bacteriol 161, 450-453.[Abstract/Free Full Text]

Barancin, C. E., Smoot, J. C., Findlay, R. H. & Actis, L. A. (1998). Plasmid-mediated histamine biosynthesis in the bacterial fish pathogen Vibrio anguillarum. Plasmid 39, 235-244.[Medline]

Barber, R. D. & Donohue, T. J. (1998a). Function of a glutathione-dependent formaldehyde dehydrogenase in Rhodobacter sphaeroides formaldehyde oxidation and assimilation. Biochemistry 37, 530-537.[Medline]

Barber, R. D. & Donohue, T. J. (1998b). Pathways for transcriptional activation of a glutathione-dependent formaldehyde dehydrogenase gene. J Mol Biol 280, 775-784.[Medline]

Barber, R. D., Rott, M. A. & Donohue, T. J. (1996). Characterization of a glutathione-dependent formaldehyde dehydrogenase from Rhodobacter sphaeroides. J Bacteriol 178, 1386-1393.[Abstract/Free Full Text]

Barker, H. C., Kinsella, N., Jaspe, A., Friedrich, T. & OConnor, C. D. (2000). Formate protects stationary-phase Escherichia coli and Salmonella cells from killing by a cationic antimicrobial peptide. Mol Microbiol 35, 1518-1529.[Medline]

Baumann, P. (1968). Isolation of Acinetobacter from soil and water. J Bacteriol 96, 39-42.[Abstract/Free Full Text]

Becker, A., Schmidt, M., Jager, W. & Puhler, A. (1995). New gentamicin-resistance and lacZ promoter-probe cassettes suitable for insertion mutagenesis and generation of transcriptional fusions. Gene 162, 37-39.[Medline]

Bergogne-Berenzin, E. & Towner, K. J. (1996). Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev 9, 184-165.

Bergogne-Berenzin, E., Joly-Guillou, M. L. & Towner, K. J. (1996). History and importance of Acinetobacter spp., role in infection, treatment and cost implications. In Acinetobacter: Microbiology, Epidemiology, Infections, Management , pp. 2-12. Edited by E. Bergogne-Berenzin, M. L. Joly-Guillou & K. J. Towner. Boca Raton, FL:CRC Press.

Bidinost, C., Wilderman, P. J., Dorsey, C. W. & Actis, L. A. (1999). Analysis of the replication elements of the pMJ101 plasmid from the fish pathogen Vibrio anguillarum. Plasmid 42, 20-30.[Medline]

Blattner, F. R., Plunkett, G. R., Bloch, C. A. & 14 other authors (1997). The complete genome sequence of Escherichia coli K-12. Science 277, 14531474.[Abstract/Free Full Text]

Boyer, H. W. & Roulland-Doussoix, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 41, 459-472.[Medline]

Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of protein-dye binding. Anal Biochem 72, 249-252.

Bsat, N., Herbig, A., Casillas-Martinez, L., Setlow, P. & Helmann, J. D. (1998). Bacillus subtilis contains multiple Fur homologues: identification of the iron uptake (Fur) and peroxide regulon (PerR) repressors. Mol Microbiol 29, 189-198.[Medline]

Calderwood, S. B. & Mekalanos, J. (1988). Confirmation of the fur operator site by insertion of a synthetic oligonucleotide into an operon fusion plasmid. J Bacteriol 170, 1015-1017.[Abstract/Free Full Text]

Chai, S., Welch, T. J. & Crosa, J. H. (1998). Characterization of the interaction between Fur and the iron transport promoter of the virulence plasmid in Vibrio anguillarum. J Biol Chem 273, 33841-33847.[Abstract/Free Full Text]

Cummings, N. J. & Connerton, I. F. (1997). The Bacillus subtilis 168 chromosome from sspE to katA. Microbiology 143, 1855-1859.[Abstract]

Daniel, C., Haentjens, S., Bissinger, M. C. & Courcol, R. J. (1999). Characterization of the Acinetobacter baumannii Fur regulator: cloning and sequencing of the fur homolog gene. FEMS Microbiol Lett 170, 199-209.[Medline]

Escolar, L., Perez-Martin, J. & de Lorenzo, V. (1999). Opening the iron box: transcriptional metalloregulation by the Fur protein. J Bacteriol 181, 6223-6229.[Free Full Text]

Escolar, L., Perez-Martin, J. & de Lorenzo, V. (2000). Evidence of an unusually long operator for the Fur repressor in the aerobactin promoter of Escherichia coli. J Biol Chem 275, 24709-24714.[Abstract/Free Full Text]

Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132, 6-13.[Medline]

Genti-Raimondi, S., Tolmasky, M. E., Patrito, L. C., Flury, A. & Actis, L. A. (1991). Molecular cloning and expression of the ß-hydroxysteroid dehydrogenase gene from Pseudomonas testosteroni. Gene 30, 43-40.

Graber, K., Smoot, L. M. & Actis, L. A. (1998). Expression of iron binding proteins and hemin binding activity in the dental pathogen Actinobacillus actinomycetemcomitans. FEMS Microbiol Lett 163, 135-142.[Medline]

Gutheil, W. G., Kasimoglu, E. & Nicholson, P. C. (1997). Induction of glutathione-dependent formaldehyde dehydrogenase activity in Escherichia coli and Haemophilus influenzae. Biochem Biophys Res Commun 238, 693-696.[Medline]

Hanson, R. S. & Hanson, T. E. (1996). Methanotrophic bacteria. Microbiol Rev 60, 493-471.

Hantke, K. (1984). Cloning of the repressor protein gene of iron-regulated systems in Escherichia coli K12. Mol Gen Genet 197, 337-341.[Medline]

Hantke, K. (1987). Selection procedure for deregulated iron transport mutants (fur) in Escherichia coli K-12: fur not only affects iron metabolism. Mol Gen Genet 210, 135-139.[Medline]

Hartstein, A. I., Rashad, A. L., Liebler, J. M. & 7 other authors (1988). Multiple intensive care unit outbreak of Acinetobacter calcoaceticus subspecies anitratus respiratory infection and colonization associated with contaminated, reusable ventilators and resuscitation bags. Am J Med 85, 624631.[Medline]

Hirsch, P. R. & Beringer, J. E. (1984). A physical map of pPH1JI and pJB4JI. Plasmid 12, 139-141.[Medline]

Kaulfers, P.-M. & Brandt, D. (1987). Isolation of a conjugative plasmid in Escherichia coli determining formaldehyde resistance. FEMS Microbiol Lett 43, 161-163.

Kaulfers, P.-M. & Wollman, A. (1988). Cloning and expression of formaldehyde resistance from Escherichia coli. FEMS Microbiol Lett 55, 299-302.

Knauf, V. C. & Nester, E. W. (1982). Wide host range cloning vectors: a cosmid clone bank of an Agrobacterium Ti plasmid. Plasmid 8, 45-54.[Medline]

Kummerle, N., Feucht, H.-H. & Kaulfers, P.-M. (1996). Plasmid-mediated formaldehyde resistance in Escherichia coli: characterization of resistance gene. Antimicrob Agents Chemother 40, 2276-2279.[Abstract]

Large, P. J. (1983). Methylotrophy and methanogenesis. In Aspects of Microbiology , pp. 25-56. Edited by J. A. Cole, C. J. Knowles & D. Schlessinger. Washington, DC:American Society for Microbiology.

Leong, S., Ditta, G. S. & Helinski, D. R. (1982). Heme biosynthesis in Rhizobium: identification of a cloned gene coding for an amino levulinic acid synthetase from Rhizobium meliloti. J Biol Chem 257, 8724-8730.[Abstract/Free Full Text]

Ling, K. & Tung, T. (1948). The oxidative demethylation of monomethyl-L-amino acids. J Biol Chem 174, 643-645.[Free Full Text]

Miller, J. H. (1972). Assay of ß-galactosidase. In Experiments in Molecular Genetics , pp. 352-355. Edited by J. H. Miller. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory.

Mizuno, M., Masuda, S., Takemaru, K., Hosono, S., Sato, T., Takeuchi, M. & Kobayash, I. Y. (1996). Systematic sequencing of the 283 kb 210 degrees-232 degrees region of the Bacillus subtilis genome containing the skin element and many sporulation genes. Microbiology 142, 3103-3111.[Abstract]

Olmsted, J. B. (1981). Affinity purification of antibodies from diazotized paper blots of heterogeneous protein samples. J Biol Chem 256, 11955-11957.[Abstract/Free Full Text]

Ras, J., van Ophem, P. W., Reijnders, W. N. M., van Spanning, R. J. M., Duine, J. A., Stouthamer, A. H. & Harms, N. (1995). Isolation, sequencing, and mutagenesis of the gene encoding NAD- and glutathione-dependent formaldehyde dehydrogenase (GD-FALDH) from Paracoccus denitrificans, in which GD-FALDH is essential for methylotrophic growth. J Bacteriol 177, 247-251.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sanger, F., Nicklen, S. & Coulson, A. R. (1979). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467.

Sasnauskas, K., Jomantiene, R., Januska, A., Levediene, E., Lebedys, J. & Janulaitis, A. (1992). Cloning and analysis of Candida maltosa gene which confers resistance to formaldehyde in Saccharomyces cerevisiae. Gene 122, 207-211.[Medline]

Shine, J. & Dalgarno, L. (1974). The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proc Natl Acad Sci USA 71, 1342-1346.[Abstract/Free Full Text]

Smoot, L. M., Bell, E. C., Paz, R. L., Corbin, K. A., Hall, D. D., Steenbergen, J. N., Harner, A. C. & Actis, L. A. (1998). Molecular and genetic analysis of iron uptake proteins in the Brazilian purpuric fever clone of Haemophilus influenzae biogroup aegyptius. Front Biosci 3, d989-d996.

Stachel, S., An, G., Flores, C. & Nester, E. (1985). A Tn3 lacZ transposon for the random generation of ß-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium. EMBO J 4, 891-898.[Medline]

Stojiljkovic, I., Bäumler, A. J. & Hantke, K. (1994). Fur regulon in gram-negative bacteria. Identification and characterization of new iron-regulated Escherichia coli genes by a Fur titration assay. J Mol Biol 236, 531-545.[Medline]

Studier, F., Rosenberg, A., Dunn, J. & Dubendorff, J. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185, 60-89.[Medline]

Tabor, S. & Richardson, C. (1985). A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci USA 82, 1074-1078.[Abstract/Free Full Text]

Tolmasky, M. E., Actis, L. A. & Crosa, J. H. (1988). Genetic analysis of the iron uptake region of the Vibrio anguillarum plasmid pJM1: molecular cloning of genetic determinants encoding a novel trans activator of siderophore biosynthesis. J Bacteriol 170, 1913-1919.[Abstract/Free Full Text]

Tolmasky, M. E., Actis, L. A. & Crosa, J. H. (1993). A single amino acid change in AngR, a protein encoded by pJM1-like virulence plasmids results in hyperproduction of anguibactin. Infect Immun 61, 3228-3233.[Abstract/Free Full Text]

Tolmasky, M. E., Wertheimer, A., Actis, L. A. & Crosa, J. H. (1994). Characterization of the Vibrio anguillarum fur gene: role in regulation of expression of the FatA outer membrane protein and catechols. J Bacteriol 176, 213-220.[Abstract/Free Full Text]

Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gel to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76, 4350-4354.[Abstract/Free Full Text]

Uotila, L. & Koivusalo, M. (1979). Purification of formaldehyde and formate dehydrogenase from pea seeds by affinity chromatography and S-formylglutathione as the intermediate of formaldehyde metabolism. Arch Biochem Biophys 196, 33-45.[Medline]

Uotila, L. & Koivusalo, M. (1989). Glutathione-dependent oxireductases: formaldehyde dehydrogenase. In Coenzymes and Cofactors , pp. 517-550. Edited by D. Dolphin, R. Poulson & O. Abramovic. New York:Wiley.

Wertheimer, A., Tolmasky, M. E., Actis, L. A. & Crosa, J. H. (1994). Structural and functional analyses of mutant Fur proteins with impaired regulatory function. J Bacteriol 176, 5116-5122.[Abstract/Free Full Text]

Whener, E. P., Rao, E. & Brendel, M. (1993). Molecular structure and genetic regulation of SFA, a gene responsible for resistance to formaldehyde in Saccharomyces cerevisiae, and characterization of its product. Mol Gen Genet 237, 351-358.[Medline]

Wu, C.-J. & Janssen, G. R. (1997). Expression of a streptomycete leaderless mRNA encoding chloramphenicol acetyltransferase in Escherichia coli. J Bacteriol 179, 6824-6830.[Abstract/Free Full Text]

Received 19 March 2001; revised 12 June 2001; accepted 18 June 2001.