Research Article

Sequence variation in dichloromethane dehalogenases/glutathione S-transferases

Microbiology 2001; 147(3):611

PubMed

Abstract

Dichloromethane dehalogenase/glutathione S-transferase allows methylotrophic bacteria to grow with dichloromethane (DCM), a predominantly man-made compound. Bacteria growing with DCM by virtue of this enzyme have been readily isolated in the past. So far, the sequence of the dcmA gene encoding DCM dehalogenase has been determined for Methylobacterium dichloromethanicum DM4 and Methylophilus sp. DM11. DCM dehalogenase genes closely related to that of strain DM4 were amplified by PCR and cloned from total DNA from 14 different DCM-degrading strains, enrichment cultures and sludge samples from wastewater treatment plants. In total, eight different sequences encoding seven different protein sequences were obtained. Sequences of different origin were identical in several instances. Sequence variation was limited to base substitutions; strikingly, 16 of the 19 substitutions in the dcmA gene itself encoded amino acids that were different from those of the DM4 sequence. The kinetic parameters kcat and Km, the pH optimum and the stability of representative DCM dehalogenase variants were investigated, revealing minor differences between the properties of DCM dehalogenases related to that from strain DM4.

Keywords: dichloromethane, dehalogenase, glutathione S-transferase

Abbreviations: CAH, chlorinated aliphatic hydrocarbon; DCM, dichloromethane; GST, glutathione S-transferase

The GenBank accession numbers for the sequences determined in this work are AJ27113138 (see text for details).

Dichloromethane (DCM) is a solvent, produced and used industrially in large quantities, which easily escapes into the environment because of its volatile and water-soluble character (Mckay et al., 1993 ; van Agteren et al., 1998 ). The contamination of groundwater and drinking water supplies by DCM became a source of concern because of evidence of genotoxic effects associated with DCM exposure (reviewed by Green, 1997 ). This led to the inclusion of DCM in the list of priority pollutants in 1977 (Keith & Telliard, 1979 ) and provided an incentive for investigating the degradation of DCM by bacteria and its applications in the treatment and prevention of environmental pollution with DCM.

Bacteria that rely on a single enzyme, DCM dehalogenase, for growth with DCM as the sole carbon source were readily isolated from environments contaminated with chlorinated aliphatic hydrocarbons (CAHs). More than a dozen strains, isolated from different locations, that possess DCM dehalogenase have been reported (see Vuilleumier, 2001 , for an overview). DCM dehalogenase was purified and shown to require glutathione as a cofactor to transform DCM to formaldehyde and two molecules of HCl (Kohler-Staub & Leisinger, 1985 ). Cloning of the corresponding gene from Methylobacterium sp. strain DM4 (La Roche & Leisinger, 1990 ), now called Methylobacterium dichloromethanicum DM4 (Doronina et al., 2000 ), showed that the encoded protein belonged to the glutathione S-transferases (GSTs), a large family of detoxification enzymes in all aerobic organisms, including bacteria (Josephy, 1997 ; Vuilleumier, 1997 ).

With the exception of Methylophilus sp. strain DM11, known methylotrophic DCM-degrading strains were shown to possess a DCM dehalogenase that is very similar, if not identical, to that of Methylobacterium dichloromethanicum DM4, since they showed strong cross-reactivity with antibodies raised against the DM4 enzyme (Kohler-Staub et al., 1986 ) and hybridized with the dcmA gene of strain DM4 as a probe (Scholtz et al., 1988 ). In contrast, the sequence of the DCM dehalogenase from Methylophilus sp. strain DM11 (266 residues) deduced from the gene sequence is only 56% identical to that of the enzyme from strain DM4 (287 residues) (Bader & Leisinger, 1994 ). The kinetic parameters of the DM4 and DM11 enzymes differ quite significantly, the DM11 enzyme displaying a kcat value about sixfold higher, and Km value sixfold higher, than that of the DM4 enzyme (Vuilleumier & Leisinger, 1996 ). The kinetic properties of these enzymes also determine the growth properties of DCM-degraders using DCM as the sole carbon source. Hence, a bacterium expressing the DM11 enzyme was superior to an otherwise identical strain expressing the DM4 enzyme in batch culture, but the reverse applied during growth under limiting conditions of DCM in the chemostat (Gisi et al., 1998 ). Nevertheless, only DCM-degraders with a DCM dehalogenase gene similar to that of strain DM4 were detected by hybridization analysis in sludge from wastewater treatment plants and in enrichment batch cultures (growing with DCM) that were derived from them (Gisi et al., 1998 ).

Hybridization analysis also revealed that the DNA loci of DCM-degrading bacteria with a DCM dehalogenase very similar to that of strain DM4 displayed significant variation (Schmid-Appert et al., 1997 ). Strains were classified into different groups on the basis of the number, type and pattern of overlapping insertion sequence elements flanking a common conserved 4·2 kb DNA fragment containing the dcmA gene. This suggested that horizontal gene transfer may have been involved in the spread of the DCM-degrading phenotype in environments contaminated with CAHs. However, it also raised specific questions regarding the evolution of DCM dehalogenase genes. Did dcmA genes of different origins display sequence variation, and, if so, what were the consequences of this variation at the enzyme level? We report here on the PCR amplification, the cloning and the sequence analysis of dcmA genes from DCM-degrading strains and from other sources, and on the functional characterization of some of the corresponding enzymes.

Materials.
All chemicals were reagent grade or better and were purchased from Fluka, unless otherwise indicated.

Bacterial strains and growth conditions.
DCM-degrading strains (Table 1) were grown in liquid cultures at 30 °C in phosphate minimal medium with DCM as the carbon source, as described previously (Scholtz et al., 1988 ). Enrichment cultures of DCM-degrading strains were obtained in the same medium by incubating sewage sludge (1%, w/v, pelleted and washed inoculum) in the presence of 100 µg cycloheximide ml-1; this was followed by periodic serial transfer (1:1000, v/v, inoculum) into fresh medium. Escherichia coli XL-1 Blue (Stratagene) was used in conjunction with plasmid pBLS KS II(+) (Stratagene) for cloning and grown in LuriaBertani medium supplemented with ampicillin (100 µg ml-1) when appropriate.


Table 1. Origin of cloned DCM dehalogenase sequences and summary of observed sequence variation


DNA techniques.
Cloning procedures followed standard methods (Ausubel et al., 19872000 ). Restriction and DNA-modifying enzymes were purchased from Fermentas. Oligonucleotides were purchased from Microsynth.

DNA isolation.
Sequencing-quality plasmid DNA from E. coli was obtained with Jetstar ion-exchange columns (Genomed). Total DNA from enrichment cultures and methylotrophic DCM-degrading strains was isolated by using the cetyltrimethylammonium bromide method (Ausubel et al., 19872000 ). Total DNA from sludge was isolated as follows. Sewage sludge (160 ml) was collected by centrifugation (10 min, 9000 r.p.m.), resuspended in 50 ml cold extraction buffer [100 mM Tris/HCl, pH 7·6; 10 mM EDTA; 5 mM thiourea; 10 mM DTT; 1·5% w/v SDS; 1%, w/v, deoxycholate; 1%, w/v, Nonidet P-40 (Sigma)] with 5 g glass beads (0·11 mm diameter), treated for 1 min in a cooled Mini-Beadbeater (Biospec Products), and immediately put on ice. The resulting emulsion was centrifuged (10 min, 12000 r.p.m., 4 °C) and the resulting supernatant was extracted once with phenol and twice with chloroform. After the addition of 0·1 vol. 3 M sodium acetate (pH 5·4), total DNA was precipitated with 2 vols cold ethanol, resuspended in 40 µl HPLC-grade water, incubated briefly with 0·5 ml polyvinylpolypyrrolidone (Aldrich) suspension (7·5 %, w/v; Holben et al., 1988 ), and recovered by centrifugation through a spin column (Bio101) (Berthelet et al., 1996 ).

PCR amplification.
Amplifications were performed with Taq polymerase for the detection of dcmA genes, and with either a 10:1 mix of Taq polymerase with Vent polymerase exo- (New England Biolabs), TaqExpand (Roche Diagnostics) or Pfu polymerase (Stratagene) for the cloning of dcmA genes from genomic DNA. Amplifications were performed with 100300 ng total DNA in a 50 µl volume for 30 cycles of denaturation (95 °C), annealing (50 °C, unless otherwise indicated) and extension (72 °C) of 1 min each, using 0·2 mM dNTP and 50 pmol of each primer (see Fig. 1). Degenerate primers Cfor (ATSATCYKGCRTCMCAGC) and Crev (TMAGCMAGTAWTYCTA), corresponding to conserved DNA and amino acid sequence segments in DM4 and DM11 DCM dehalogenases, were used to detect dcmA dehalogenases from all DCM-degrading methylotrophic bacteria containing a dcmA gene (a 450 bp product for DM4-like dcmA genes and a 441 bp product for the DM11 dcmA gene). A 1225 bp PCR product encompassing the dcmA gene in strains closely related to strain DM4 was amplified (annealing temperature 55 °C) using primers DMfor (AAAAAAAACATCTAGAGAATGACAACCGTGCGC, an intergenic sequence at position -193 to -169 upstream of the dcmA gene start codon) and DMrev (AAAAAAAAAAGGATCCGGTCATCGAAGGAATGC; position 125149 relative to the dcmA gene stop codon, in the orf353 gene of unknown function downstream of dcmA). These sequences permitted the introduction of XbaI and BamHI restriction sites (underlined) to facilitate the cloning of PCR products. For direct amplification of the strongly conserved dcmA gene region from total DNA from sludge samples, an initial PCR reaction (annealing temperature 65 °C) was performed with primers DMforout (CCTCCCGTTACGCCTTCCTCCCC; position -376 to -354 relative to the dcmA gene start codon in the upstream intergenic region) and DMrevout (TCCCGATGTTCCATCACCGCCC; position 302323 relative to the dcmA gene stop codon in orf353 downstream of dcmA). The primers were chosen as a suitable pair for amplification using the program PRIMER3 (Rozen & Skaletsky, 1998 : http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). The resulting 1566 bp product (1 µl of the 50 µl reaction) was then used in a second PCR reaction with primers DMfor and DMrev as described above.


Table 2).


Table 2. Summary of observed variation in cloned DCM dehalogenase sequences


Cloning of PCR products.
PCR products were purified from agarose gels by using the QIAquick gel extraction kit (Qiagen), digested with XbaI and BamHI and then ligated to the pBLS KS II(+) vector (Stratagene) cut with the same enzymes.

DNA sequencing.
Complete (1159 bp) DNA sequences of cloned PCR products were obtained for both strands by cycle sequencing, with DIG-labelled primers and using a GATC 1500 direct blotting electrophoresis system as described (Pohl & Maier, 1995 ), or with the ABI Prism dye terminator ready reaction mix and an ABI Prism 310 genetic analyser (Perkin-Elmer). Sequences were obtained from two clones each from at least two independent PCR amplification reactions. The different 1159 nt sequences obtained and analysed here were submitted to the GenBank/EMBL database.The GenBank accession numbers are as follows: AJ271131 (strains DM1 and DM5, identical to Methylobacterium dichloromethanicum DM4), AJ271132 (Hyphomicrobium sp. DM2), AJ271133 (Methylorhabdus multivorans DM13), AJ271134 (Hyphomicrobium sp. GJ21); AJ271136 (LZ), AJ271135 (S2-E1), AJ271138 (S3-E1) and AJ271137 (S1).

Sequence analysis.
Sequence alignments were generated using the programs PILEUP and LINEUP from the GCG package (version 10.0). Phylogenetic analysis was performed using the PHYLIP package of programs (version 3.5; Felsenstein, 1993 : http://evolution.genetics.washington.edu/phylip.html). Distance measurements were performed using the Kimura default option and the programs DNADIST or PROTDIST. Trees were constructed with FITCH, DNAPARS and PROTPARS, using the global optimization and randomized input options (100 jumbles). Bootstrapping analysis was performed with the same programs by first generating 1000 bootstrapped datasets from the original datasets, using SEQBOOT, and then calculating the consensus tree with CONSENSE. Trees were visualized using NJPLOT (Perrière & Gouy, 1996 : http://pbil.univ-lyon1.fr/software/njplot.html).

DCM dehalogenase purification.
DCM dehalogenases were purified from cell-free extracts of methylotrophic bacteria by ammonium sulfate fractionation and anion-exchange chromatography as described previously (Vuilleumier & Leisinger, 1996 ). An additional hydrophobic-interaction chromatography step (Resource Iso; Pharmacia 50% saturated ammonium sulfate in 100 mM phosphate pH 8 buffer to 100 mM phosphate pH 8 buffer) was performed when required. The protein concentration was determined using a commercial Bradford reagent (Bio-Rad) with bovine serum albumin as the standard.

Enzyme assays.
DCM dehalogenase activity was determined by detecting the dihydropyridine derivate of formaldehyde at 412 nm, or with the formaldehyde dehydrogenase coupled assay by monitoring NADH formation at 340 nm as described previously (Vuilleumier & Leisinger, 1996 ). The specific activity of DCM dehalogenases was determined at 30 °C in 100 mM phosphate buffer (pH 8), using 1 mM DCM or dibromomethane and 2 mM glutathione. The kinetic parameters Km and kcat for DCM and glutathione were obtained as described previously (Vuilleumier & Leisinger, 1996 ) under the same conditions, by fitting data directly to the MichaelisMenten equation by non-linear least-square minimization using KALEIDAGRAPH (Abelbeck Software). Standard errors were observed to be less than 20% of the Km values and less than 10% of the kcat values, respectively. The pH optimum of DCM dehalogenases was obtained with the formaldehyde derivatization assay by measuring specific activity in MES buffer (pH 5·36·5), phosphate (pH 6·57·7), Bicine (pH 7·48·8) and glycine (pH 8·99·9) buffers of constant (200 mM) buffer strength.

DCM dehalogenase inactivation.
The residual activity of DCM dehalogenases in the presence of different concentrations of urea (electrophoresis grade; Bio-Rad) was investigated with the formaldehyde derivatization assay, by measuring their specific activity (V) in 200 mM Bicine buffer (pH 8·3) with 2 mM glutathione and 1 mM DCM at T=25 °C. The urea concentration at half-maximal enzyme activity, [U]1/2, was determined.

Detection of DCM dehalogenase genes by PCR
We developed a PCR-based strategy for the detection and isolation of dcmA genes in DNA from purified strains, sludge and other samples (Fig. 1). Adequate combinations of primers useful for detecting both the DM4 (La Roche & Leisinger, 1990 ) and DM11 (Bader & Leisinger, 1994 ) types of genes were difficult to design, because of the large differences between DM4 and DM11 gene sequences (56% sequence pairwise identity). Using the 32-/16-fold degenerate primer pair Cfor/Crev, which leads to the amplification of an internal dcmA gene fragment with both DM4 and DM11 strains, DM4-like dcmA genes were readily detected in sludge from wastewater treatment plants, as well as in enrichment cultures derived from them, but DM11-like genes were not observed (data not shown). Although some dcmA genes may have remained undetected with this approach, these results confirm findings obtained previously by hybridization analysis using DM4- and DM11-specific dcmA probes (Gisi et al., 1998 ).

Following these observations, other sets of primers were used for further characterization of dcmA genes closely similar to that of strain DM4. It was possible to amplify a 1·2 kb PCR product from DNA of DCM-degrading DM strains DM1 to DM14, except Methylophilus sp. strain DM11, using the non-degenerate primers DMfor and DMrev (corresponding to flanking sequences of the dcmA gene from strain Methylobacterium dichloromethanicum DM4) (Fig. 1). This confirmed the extremely conserved character of the DNA region encompassing the dcmA gene of DCM-degrading strains with a DCM dehalogenase closely related to that in strain DM4 hinted at by previous hybridization studies (Scholtz et al., 1988 ; Schmid-Appert et al., 1997 ). In sludge, however, DM4-like dcmA genes were present at very low levels, and the resulting PCR products were detected only upon subsequent hybridization with a dcmA probe (data not shown). In such cases, dcmA genes were amplified and cloned using a nested PCR strategy, by prior amplification with primers DMforout and DMrevout flanking the dcmA gene sequence from strain DM4 and subsequent amplification of the resulting 1·5 kb product with DMfor and DMrev.

Sequence analysis of cloned PCR products
DCM-degrading bacteria with a DM4-like dcmA gene were previously classified into different groups based on the arrangement of insertion-sequence elements flanking the conserved 4·2 kb BamHI DNA fragment with the dcmA gene (Scholtz et al., 1988 ; Schmid-Appert et al., 1997 ). PCR products were obtained with primers DMfor and DMrev from total DNA of representative strains of each subgroup, as well as from enrichment cultures and sludge samples (Table 1). These products were cloned by taking advantage of restriction sites introduced into the primers used for PCR amplification (Fig. 1). In all cases, two clones from two independent amplifications were sequenced in order to avoid PCR artefacts (Table 2). For strain DM1, which belongs to the group of strains possessing two copies of the dcmA gene on distinct DNA fragments (Schmid-Appert et al., 1997 ), amplicons from both copies of the gene were obtained from sized fractions of PstI-digested total DNA containing either the 7 kb or the 10·5 kb PstI fragment with a copy of the dcmA gene (Schmid-Appert et al., 1997 ). Amplicons were also characterized from total DNA of a prototype bioreactor for DCM removal from waste air (Zuber, 1995 ; Zuber et al., 1997 ; Table 1), and from enrichment liquid cultures, derived from sludge from three different wastewater treatment plants (Table 1), growing with DCM as the sole carbon source. PCR products were obtained and cloned directly from sludge from an industrial wastewater treatment plant, but not from two municipal plants that were investigated (Table 1).

In all cases, the sequenced DNA fragment was 1159 bp in length, comprising the 867 bp of the complete dcmA gene and 292 bp in the upstream and downstream regions. This fragment was identical to that of strain DM4 in both dcmA gene copies of strain DM1, in strain DM5 and in the enrichment culture S1-E1 derived from industrial sludge. Nucleotide differences were found in nine other amplicons that were sequenced (Fig. 1, Table 1). Identical changes relative to the DM4 sequence were observed in sequences from samples and strains isolated at different locations and at different times (Table 2). In total, eight different gene sequences encoding seven different protein sequences (287 amino acids) were obtained. The sequence displaying most sequence differences relative to strain DM4 was that of strain GJ21, isolated in the Netherlands (Ottengraf et al., 1986 ; Janssen et al., 1991 ), having 15 base differences encoding nine amino acid differences (Fig. 1, Tables 1 and 2). The observed nucleotide differences showed a striking bias for changes that encoded a different amino acid (Tables 1 and 2). Of the 19 base differences observed relative to the dcmA gene from strain DM4, 16 encoded differences in the protein sequence of the DCM dehalogenase. Upstream of the dcmA gene, differences in the nucleotide sequence were observed, altbeit repeatedly, at one position only (Fig. 1, Table 2). Downstream of dcmA, a single difference was noted in the case of the sequence from strain GJ21 (Fig. 1, Table 2).

Phylogenetic analysis of DCM dehalogenase genes
Distance-based and parsimony methods yielded the same tree topology describing the relationships between DCM dehalogenases using both DNA (Fig. 2) and protein (not shown) sequence information. The nodes in the preferred tree topology were the highest-ranking clusters obtained by bootstrapping analysis, with the exception of the position of the LZ sequence, which, at the protein level, clustered with either the DM2/DM4 or the GJ21/S2-E1 group (data not shown). The low bootstrapping values obtained (Fig. 2) can be explained by the limited information present in the sequences (13 and nine phylogenetically informative positions at the DNA and protein levels, respectively). A reliable rooting of the tree using the DM11 sequence as an outgroup was not possible, because of the extensive differences beween DM4-like sequences and the DM11 sequence. Indeed, at least 332 substitutions separate the DM4 sequence from the DM11 sequence (Table 1) (Lewontin, 1989 ); this compares with just 15 substitutions from the most divergent DM4-like sequence found (that of strain GJ21).


Table 1) obtained with the DNADIST, FITCH and DNAPARS programs from the PHYLIP package (Felsenstein, 1993 ). Isolated DCM-degrading strains are indicated in bold. Numbers above and below branches indicate the percentages at which the branches were obtained, as calculated by bootstrap analysis (SEQBOOT, 1000 replicates) using distance-based (FITCH) and parsimony (DNAPARS, italics) methods, respectively.


Functional consequences of sequence variation in DCM dehalogenases
The consequences of sequence variation at the enzyme level were evaluated in the case of the DCM dehalogenases from strains DM2, DM4, DM13 and GJ21 (Table 3, Fig. 3), which were purified from their natural host. Purification factors (five- to sixfold) similar to those obtained previously for strain DM2 (Kohler-Staub & Leisinger, 1985 ) rather than to that of strain DM11 (13-fold; Scholtz et al., 1988 ) were noted for these enzymes. For DCM, the kinetic parameters kcat and Km of DM4-type enzymes very closely resembled those of the DM4 strain (Vuilleumier et al., 1997 ). However, the kcat for dibromomethane and the Km for glutathione of the enzymes from Hyphomicrobium sp. GJ21 and Methylorhabdus multivorans DM13 appeared more similar to those of the DM11 enzyme (Table 3). Notably, the enzymes from DM13 and GJ21 display the same residue at position 27 as the DM4 enzyme. The single difference between DM2 and DM4 enzymes at position 27 was previously shown to be associated with a minor difference in the glutathione affinity of the enzyme (Vuilleumier et al., 1997 ; Table 3), and variants of the DM11 enzyme with differences at the corresponding position obtained by protein engineering also displayed an altered affinity for glutathione (Vuilleumier et al., 1997 ). Therefore, the residue at position 27 of DM4-like DCM dehalogenases is not unique in modulating the affinity of DCM dehalogenases for the glutathione cofactor.


Table 3. Properties of purified DCM dehalogenases from isolated DCM-degraders



(17K):

Fig. 3. Dependence of DCM dehalogenase activity from isolated DCM-degraders on (a) pH and (b) urea concentration. Methylobacterium dichloromethanicum DM4 (•, solid line), Methylophilus sp. DM11 (, dotted line), Hyphomicrobium sp. GJ21 (, broken line), and Methylorhabdus multivorans DM13 (, broken/dotted line). The data for Hyphomicrobium sp. DM2 were omitted, for clarity, since they did not differ significantly from those of Methylobacterium dichloromethanicum DM4.

The pH optimum and resistance towards inactivation of DM4-like DCM dehalogenases was determined (Fig. 3). The pH optima were very similar. However, the DM13 and GJ21 enzymes were more active at the low and high ends of the pH range (Fig. 3a). What was striking (and previously unremarked upon) was the qualitative difference in pH profiles between DM4-like and DM11 enzymes, the latter showing a plateau extending up to pH 10 rather than a pH optimum around pH 8·5 (Fig. 3a).

Sequence variation may result in increased structural stability, rather than in increased catalytic proficiency. Systematic protein-engineering studies in many systems have demonstrated that single amino acid changes can significantly affect the stability of an enzyme (Fersht, 1999 ). The retention of DCM dehalogenase activity upon urea denaturation was remarkably similar (Fig. 3b, Table 3) among the enzymes, although those of DM13 and GJ21 were slightly more resistant to inactivation than those of DM2 and DM4.

Strains and environmental samples containing DM4-like dcmA genes showed, at most, 15 nucleotide differences with respect to the DM4 sequence in a fragment of 1159 nt encompassing the entire dcmA gene. This low sequence variability may reflect constraints in the recovery of a functional dcmA gene when DCM is the sole growth substrate, but perhaps there is also a bias arising from the conditions used for cultivation. Indeed, DCM-degraders with dcmA genes closely related to the DM4 sequence were predominantly obtained. In particular, only the DM4 sequence was recovered from enrichment culture S1-E1 derived from industrial wastewater sludge, whereas in this sludge itself, a sequence with seven nucleotide differences relative to the DM4 sequence (S1) had been detected (Table 1). Sequences of dcmA genes from strains isolated by other workers showed more variation relative to the DM4 sequence; these included the sequences from DM13 (Doronina et al., 1995 ) and GJ21 (Ottengraf et al., 1986 ; Janssen et al., 1991 ), as well as the sequence LZ obtained from a bioreactor initially inoculated with strain DM4 but operated under different conditions (Zuber, 1995 ).

Notably, the few differences in DCM dehalogenase sequences recovered in this analysis were exclusively single nucleotide exchanges. Triazine dehalogenase gene sequences from different bacteria were also observed to be very strongly conserved (De Souza et al., 1998 ), and haloalkane dehalogenase (dhlA) genes from several different strains showed a sequence identical to that originally published for Xanthobacter autotrophicus GJ10 (van den Wijngaard et al., 1992 ). In contrast, however, haloalkane dehalogenase variants selected by growth on an alternative substrate of the enzyme displayed quite extensive differences, including several insertions and deletions, relative to the wild-type enzyme (Pries et al., 1994 ). In addition, representatives of another class of haloalkane dehalogenases encoded by the dhaA gene and characterized in Rhodococcus and Mycobacterium species (see Poelarends et al., 2000 ) display enzymic and structural properties that are related to, but distinct from, dhlA-type dehalogenases (see Newman et al., 1999 ), but which show little similarity (approx. 30% identity) at the protein-sequence level. In the case of bacterial DCM dehalogenases, the most distant sequence is that of Methylophilus sp. DM11 (56% identity), which encodes an enzyme with lower affinity, but higher turnover with DCM and dibromomethane, than the enzyme from strain DM4 (Table 3) (see Vuilleumier & Leisinger, 1996 ; Gisi et al., 1998 ). Unlike haloalkane dehalogenases, however, which have a relatively broad substrate range, bacterial DCM dehalogenases are strongly specific for dihalomethanes as substrates. Therefore, the observed 1·7-fold higher activity of DCM dehalogenases from strains DM13 and GJ21 with dibromomethane compared to DCM (Table 3) may represent a significant property of these enzymes one which confers a selective advantage upon the corresponding strains in the presence of this compound. Growth of methylotrophic bacteria with dibromomethane has not yet been thoroughly investigated, however, because of the higher toxicity, to bacteria, of dibromomethane compared to DCM (Scholtz et al., 1988 ; Goodwin et al., 1998 ).

The possibility that selection for altered enzymic functional properties of the enzyme has been operating in different environments contaminated with DCM warrants further consideration. Indeed, the large proportion of nucleotide differences in DM4-like DCM dehalogenases that lead to differences in the protein sequence (Fig. 1, Table 1) is quite striking. Despite the relatively minor differences detected in the enzymic properties of DCM dehalogenases (Table 3, Fig. 3), the possibility that some of these variations confer a selective advantage under certain conditions in vivo, or that they affect properties of the enzyme that are not manifested in the in vitro assays (Gillespie, 1991 ), cannot be ruled out. Certainly, much of the observed sequence variation appears to be clustered in certain parts of the protein sequence, suggesting that the corresponding residues contribute to the definition of the active site of the enzyme. In the absence of structural information on DCM dehalogenases, however, this remains entirely speculative.

The rare occurrence of base changes leading to synonymous codons rather than amino acid changes (Fig. 1) might also reflect strongly constrained codon usage (Akashi & Eyre-Walker, 1998 ) in the highly expressed dcmA gene (520% of the soluble cell protein in shaken batch cultures; Gisi et al., 1998 ). This would imply either that codon usage is the same in the different DCM-degraders studied or that the dcmA genes recovered in our analysis were acquired by their host too recently for codon optimization to have already taken place.

Sequence-variation data such as those obtained here may be used to infer pathways of enzyme evolution (see Eulberg et al., 1998 ; Hill et al., 1999 ; Poelarends et al., 2000 , and references cited therein). However, the observed differences with respect to the canonical sequence of strain DM4 appear to be at odds with the notion of a single evolutionary pathway connecting different DCM dehalogenases. For example, pairwise comparisons between DM13, GJ21 and LZ DCM dehalogenases show that DM13 and LZ sequences display the same residue at position 20, that the GJ21 and LZ sequences display the same residues at positions 27 and 277, and that the GJ21 and DM13 sequences display the same residues at positions 46 and 276, respectively (Table 2). In addition, the patterns of insertion sequences flanking the dcmA gene in different strains (Schmid-Appert et al., 1997 ) do not always correlate with differences in the corresponding dcmA gene. For example, the same dcmA sequence as that in strain DM4 was found in strains DM1 and DM5 (Table 1), which, however, display a different arrangement of insertion sequences. Furthermore, the pattern of insertion sequences associated with one copy of the dcmA gene in strain DM1 was also found in strain Hyphomicrobium sp. GJ21, but the latter strain features a dcmA gene with nucleotide differences at 15 positions relative to that of strain DM4 (Table 1). Thus, the succession of events that led to the observed patterns of sequence variation in strains capable of mineralizing DCM, both at the level of dcmA and at the level of the genes flanking it, remains elusive.

To conclude, we note that the sequence and catalytic properties of DCM dehalogenases are strongly conserved among aerobic DCM-degrading methylotrophic bacteria. However, gene-sequence variations with more pronounced effects would be expected to be selected under conditions in which increased enzyme efficiency is an advantage. Thus, it will be interesting to investigate whether any of the sequence differences observed in the present study are selected when gene evolution in the laboratory (see e.g. Myazaki & Arnold, 1999 ; Sutherland, 2000 ) is performed with the dcmA gene of strain DM4 as a starting point.

We thank the following students involved in the early stages of this work: Karin Wüthrich, Kurt Zoller, Hubert Traber, Helga Sorribas, Michael Stumpp and Philipp Krummenacher. We are also grateful to Dietmar Stax for advice on isolation of DNA from sludge. This work was supported by grant 5002-037905 from the Biotechnology Priority Programme of the Swiss National Science Foundation.

References

van Agteren, M. H., Keuning, S. & Janssen, D. B. (1998). In Handbook on Biodegradation and Biological Treatment of Hazardous Organic Compounds, chapter 3, pp. 7991. Dordrecht: Kluwer.

Akashi, H. & Eyre-Walker, A.(1998). Translational selection and molecular evolution. Curr Opin Genet Dev 8, 688-693.[Medline]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (19872000). Current Protocols in Molecular Biology. New York: Wiley-Interscience.

Bader, R. & Leisinger, T.(1994). Isolation and characterization of the Methylophilus sp. strain DM11 gene encoding dichloromethane dehalogenase/glutathione S-transferase. J Bacteriol 176, 3466-3473.[Abstract/Free Full Text]

Berthelet, M., Whyte, L. G. & Greer, C. W.(1996). Rapid, direct extraction of DNA from soils for PCR analysis using polyvinylpolypyrrolidone spin columns. FEMS Microbiol Lett 138, 17-22.[Medline]

De Souza, M. L., Seffernick, J., Martinez, B., Sadowsky, M. J. & Wackett, L. P.(1998). The atrazine catabolism genes atzABC are widespread and highly conserved. J Bacteriol 180, 1951-1954.[Abstract/Free Full Text]

Doronina, N. V., Braus-Stromeyer, S. A., Leisinger, T. & Trotsenko, Y. A.(1995). Isolation and characterization of a new facultatively methylotrophic bacterium: description of Methylorhabdus multivorans, gen. nov., sp. nov. Syst Appl Microbiol 18, 92-98.

Doronina, N. V., Trotsenko, Y. A., Tourova, T. P., Kuznetzov, B. B. & Leisinger, T.(2000). Methylophila helvetica sp. nov. and Methylobacterium dichloromethanicum sp. nov. novel aerobic facultatively methylotrophic bacteria utilizing dichloromethane. Syst Appl Microbiol 23, 210-218.[Medline]

Eulberg, D., Kourbatova, E. M., Golovleva, L. A. & Schlömann, M.(1998). Evolutionary relationship between chlorocatechol catabolic enzymes from Rhodococcus opacus 1CP and their counterparts in proteobacteria: sequence divergence and functional convergence. J Bacteriol 180, 1082-1094.[Abstract/Free Full Text]

Felsenstein, J. (1993). PHYLIP (phylogeny inference package) version 3.5c. Department of Genetics, University of Washington, Seattle, USA.

Fersht, A. R. (1999). Structure and Mechanism in Protein Science. New York: W. H. Freeman.

Gillespie, J. H. (1991). The Causes of Molecular Evolution. Oxford: Oxford University Press.

Gisi, D., Willi, L., Traber, H., Leisinger, T. & Vuilleumier, S.(1998). Effects of bacterial host and dichloromethane dehalogenase on the competitiveness of methylotrophic bacteria growing with dichloromethane. Appl Environ Microbiol 64, 1194-1202.[Abstract/Free Full Text]

Goodwin, K. D., Schaefer, J. K. & Oremland, R. S.(1998). Bacterial oxidation of dibromomethane and methyl bromide in natural waters and enrichment cultures. Appl Environ Microbiol 64, 4629-4636.[Abstract/Free Full Text]

Green, T.(1997). Methylene chloride induced mouse liver and lung tumours: an overview of the role of mechanistic studies in human safety assessment. Hum Exp Toxicol 16, 3-13.[Abstract/Free Full Text]

Hill, K. E., Marchesi, J. R. & Weightman, A. J.(1999). Investigation of two evolutionarily unrelated halocarboxylic acid dehalogenase gene families. J Bacteriol 181, 2535-2547.[Abstract/Free Full Text]

Holben, W. E., Jansson, J. K., Chelm, B. K. & Tiedje, J. M.(1988). DNA probe method for the detection of specific microorganisms in the soil bacterial community. Appl Environ Microbiol 54, 703-711.[Abstract/Free Full Text]

Janssen, D. B., van den Wijngaard, A. J., van der Waarde, J. J. & Oldenhuis, R.(1991). Biochemistry and kinetics of aerobic degradation of chlorinated aliphatic hydrocarbons. In On-site Bioreclamation , pp. 92-112. Edited by R. E. Hinchee & R. F. Olfenbuttel. Boston, MA:Butterworth-Heinemann.

Josephy, P. D. (1997). Molecular Toxicology. Oxford: Oxford University Press.

Keith, L. H. & Telliard, W. A.(1979). Priority pollutants I a perspective view. Environ Sci Technol 13, 416-423.

Kohler-Staub, D. & Leisinger, T.(1985). Dichloromethane dehalogenase of Hyphomicrobium sp. strain DM2. J Bacteriol 162, 676-681.[Abstract/Free Full Text]

Kohler-Staub, D., Hartmans, S., Gälli, R., Suter, F. & Leisinger, T.(1986). Evidence for identical dichloromethane dehalogenases in different methylotrophic bacteria. J Gen Microbiol 132, 2837-2844.

La Roche, S. D. & Leisinger, T.(1990). Sequence analysis and expression of the bacterial dichloromethane dehalogenase structural gene, a member of the glutathione S-transferase supergene family. J Bacteriol 172, 164-171.[Abstract/Free Full Text]

Lewontin, R. C.(1989). Inferring the number of evolutionary events from DNA coding sequence differences. Mol Biol Evol 6, 15-32.[Abstract]

Mckay, D., Shiu, W. Y. & Ma, K. C. (1993). In Volatile Organic Chemicals, vol. 3, pp. 400406. Boca Raton, FL: Lewis.

Myazaki, K. & Arnold, F. H.(1999). Exploring nonnatural evolutionary pathways by saturation mutagenesis: rapid improvement of protein function. J Mol Evol 49, 716-720.[Medline]

Newman, J., Peat, T. S., Richard, R., Kan, L., Swanson, P. E., Affholter, J. A., Holmes, I. H., Schindler, J. F., Unkefer, C. J. & Terwilliger, T. C.(1999). Haloalkane dehalogenases: structure of a Rhodococcus enzyme. Biochemistry 38, 16105-16114.[Medline]

Ottengraf, S. P. P., Meesters, J. J. P., van den Oever, A. H. C. & Rozema, H. R.(1986). Biological elimination of volatile xenobiotic compounds in biofilters. Bioprocess Eng 1, 61-69.

Perrière, G. & Gouy, M.(1996). WWW-Query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364-369.[Medline]

Poelarends, G. J., Kulakov, L. A., Larkin, M. J., Vlieg, J. & Janssen, D. B.(2000). Roles of horizontal gene transfer and gene integration in evolution of 1,3-dichloropropene- and 1,2-dibromoethane-degradative pathways. J Bacteriol 182, 2191-2199.[Abstract/Free Full Text]

Pohl, T. M. & Maier, E.(1995). Sequencing 500 kb of yeast DNA using a GATC 1500 direct blotting electrophoresis system. Biotechniques 19, 482-486.[Medline]

Pries, F., van der Wijngaard, A. J., Bos, R., Pentenga, M. & Janssen, D. B.(1994). The role of spontaneous cap domain mutations in haloalkane dehalogenase specifity and evolution. J Biol Chem 26, 17490-17494.

Rozen, S. & Skaletsky, H. J. (1998). Primer3. Code available at http://www-genome.wi.mit.edu/genome-software/other/primer3.html.

Schmid-Appert, M., Zoller, K., Traber, H., Vuilleumier, S. & Leisinger, T.(1997). Association of newly discovered IS elements with the dichloromethane utilization genes of methylotrophic bacteria. Microbiology 143, 2557-2567.[Abstract/Free Full Text]

Scholtz, R., Wackett, L. P., Egli, C., Cook, A. M. & Leisinger, T.(1988). Dichloromethane dehalogenase with improved catalytic activity isolated from a fast-growing dichloromethane-utilizing bacterium. J Bacteriol 170, 5698-5704.[Abstract/Free Full Text]

Stucki, G., Gälli, R., Ebersold, H. R. & Leisinger, T.(1981). Dehalogenation of dichloromethane by cell extracts of Hyphomicrobium DM2. Arch Microbiol 130, 366-371.

Sutherland, J. D.(2000). Evolutionary optimisation of enzymes. Curr Opin Chem Biol 4, 263-269.[Medline]

Vuilleumier, S.(1997). Bacterial glutathione S-transferases: what are they good for? J Bacteriol 179, 1431-1441.[Free Full Text]

Vuilleumier, S. (2001). Coping with a halogenated one-carbon diet: aerobic dichloromethane-mineralising bacteria. In Biotechnology for the Environment, Focus on Biotechnology Series, vol. 3. Edited by M. Hofman & S. Agathos. Dordrecht: Kluwer (in press).

Vuilleumier, S. & Leisinger, T.(1996). Protein engineering studies of dichloromethane dehalogenase/glutathione S-transferase from Methylophilus sp. strain DM11. Ser12 but not Tyr6 is required for enzyme activity. Eur J Biochem 239, 410-417.[Medline]

Vuilleumier, S., Sorribas, H. & Leisinger, T.(1997). Identification of a novel determinant of glutathione affinity in dichloromethane dehalogenase/glutathione S-transferases. Biochem Biophys Res Commun 238, 452-456.[Medline]

van den Wijngaard, A. J., van der Kamp, K. W. H. J., van der Ploeg, J., Pries, F., Kazemier, B. & Janssen, D. B.(1992). Degradation of 1,2-dichloroethane by Ancylobacter aquaticus and other facultative methylotrophs. Appl Environ Microbiol 58, 976-983.[Abstract/Free Full Text]

Zuber, L. (1995). Trickling filter and three-phase airlift bioreactor for the removal of dichloromethane from air. PhD thesis, ETH Zürich, Switzerland.

Zuber, L., Dunn, I. J. & Deshusses, M. A.(1997). Comparative scale-up and cost estimation of a biological trickling filter and a three-phase airlift bioreactor for the removal of methylene chloride from polluted air. J Air Waste Manag Assoc 47, 969-975.

Received 12 July 2000; revised 20 October 2000; accepted 20 November 2000.