Abstract
Keywords: Selenomonas ruminantium, phosphoenolpyruvate carboxykinase, pyruvate kinase, propionate
Abbreviations: Pck, phosphoenolpyruvate carboxykinase; Pyk, pyruvate kinase; PEP, phosphoenolpyruvate; OAA, oxaloacetate; FBP, fructose 1,6-bisphosphate; Ldh, lactate dehydrogenase
The GenBank accession numbers for the S. ruminantium pck and pyk sequences reported in this paper are AB016600 and AB037182, respectively.
One of the most important reductive reactions in the rumen is propionate formation, and a reciprocal relationship is generally observed between methanogenesis and propionate production. For example, the addition of ionophores brings about a decrease in methane and an increase in propionate (Bergen & Bates, 1984 ; Van Nevel & Demeyer, 1988 ), and feeding high-concentrate diets usually decreases methane and increases propionate (Miller, 1995 ). Accordingly, the augmentation of propionate production can be an effective means to reduce methanogenesis. In addition, propionate is a glycogenic substance, which is important for the nutrition of ruminants.
Propionate is produced via either the succinate pathway or the acrylate pathway, depending on the species of ruminal bacteria. In the known species of ruminal bacteria, Megasphaera elsdenii and Prevotella species produce propionate from lactate via the acrylate pathway (Marounek et al., 1989 ; Stewart et al., 1997 ). Other bacteria, such as Selenomonas ruminantium, Succinimonas amylolytica, Propionibacterium acnes and Veillonella parvula, are known to use the succinate pathway (Hungate, 1966 ; Wolin et al., 1997 ). Among these propionate-producing bacteria, Sel. ruminantium is one of the most predominant bacteria in the rumen, and has been reported to account for 2251% of the total viable bacterial counts in the rumen (Caldwell & Bryant, 1966 ). Therefore, augmentation of propionate production by Sel. ruminantium could possibly increase propionate production in the rumen.
In the fermentation of glucose by S. ruminantium, phosphoenolpyruvate (PEP) has been reported to be carboxylated to form oxaloacetate (OAA) by PEP carboxykinase (Pck), which can lead to propionate production via the succinate pathway (Melville et al., 1988 ). PEP is also converted to pyruvate by pyruvate kinase (Pyk), leading to the production of lactate and acetate (Melville et al., 1988 ). The proportion of propionate in total fermentation products is thus determined by the proportion of the flow from PEP to OAA versus the flow from PEP to pyruvate. Since propionate production is possibly affected by both Pck and Pyk activities, it is important to know how Pck and Pyk activities are regulated, especially in response to growth conditions.
The objective of this study is to clarify how the synthesis of Pck and Pyk in S. ruminantium is regulated, especially at the transcriptional level. For this purpose, we analysed the genes encoding Pck (pck) and Pyk (pyk) with primer extension analysis. Then we examined the effect of the alteration of the energy substrate on the levels of pck and pyk mRNAs. In addition, we examined the molecular and enzyme properties of Pck and Pyk.
Bacterial strain and growth conditions.S. ruminantium TH1 was isolated in this laboratory (Asanuma et al., 1998 ) and was grown in batch culture in 120 ml serum vials as described previously (Asanuma & Hino, 1997 ). The media contained (l-1): K2HPO4, 0·45 g; KH2PO4, 0·45 g; (NH4)2SO4, 0·9 g; NaCl, 0·9 g; CaCl2 . 2H2O, 0·12 g; MgSO4 . 7H2O, 0·19 g; Trypticase (BBL Microbiology Systems), 1·0 g; cysteine-HCl, 0·6 g; vitamin solution (Tiwari et al., 1969 ), 10 ml; VFA solution (Tiwari et al., 1969 ), 1·0 ml; and either 15 mM glucose, 75 mM lactate, or 30 mM fumarate. Culture incubation was performed in triplicate, maintaining the pH at 6·87·0, until late-log phase. Cell growth was estimated by measuring the OD600. E. coli HB101 for preparing fusion protein was purchased from Toyobo and aerobically grown in LB.
Assay for the activities of Pck and Pyk.
Cell extracts of S. ruminantium were prepared as described previously (Asanuma & Hino, 1997 ). Pck activity was assayed in both the forward and reverse directions by the method of Schocke & Weimer (1997) . In PEP carboxylation, the reaction mixture contained 8 mM PEP, 4 mM MgCl2, 0·02 mM MnCl2, 25 mM NaHCO3, 1 mM ADP, 0·3 mM NADH and 2 U malate dehydrogenase (from yeast; Oriental Yeast) in 50 mM sodium borate/succinate buffer (pH 7·0). The reaction was initiated by adding cell extracts [1020 µg protein (ml assay mixture)-1] and incubation was carried out at room temperature for 5 min under a stream of O2-free CO2. The rate of NADH oxidation was measured as A340. The effect of pH on enzyme activity was examined by increasing malate dehydrogenase to 6 U, which compensated for a drop in activity at extremes of pH. The rate of OAA decarboxylation was also measured. The reaction mixture contained 8 mM OAA, 4 mM MgCl2, 0·02 mM MnCl2, 25 mM NaHCO3, 5 mM ATP, 5 U each pig heart Pyk and lactate dehydrogenase (Ldh) (Oriental Yeast), 1 mM ADP, 0·3 mM NADH, and cell extracts [1020 µg protein (ml assay mixture)-1] in 50 mM HEPES (pH 7·0).
Pyk activity was assayed by the procedure described by Collins & Thomas (1974) in the PEP to pyruvate direction. The reaction mixture contained 8 mM MgCl2, 80 mM KCl, 5 mM PEP, 5 mM ADP, 2 mM fructose 1,6-bisphosphate (FBP), 10 U Ldh, 0·2 mM NADH and cell extracts [12 µg protein (ml assay mixture)-1] in 50 mM Tris/HCl (pH 7·0). To examine the effect of pH on enzyme activity, Ldh was increased to 20 U. In the reverse reaction, which was used to determine Km, the reaction mixture contained 150 mM MgCl2, 25 mM pyruvate, 375 mM NaHCO3, 300 mM ATP, 5 U malate dehydrogenase and PEP carboxylase (from Escherichia coli; Sigma), 0·3 mM NADH and cell extracts [56 µg protein (ml assay mixture)-1] in 75 mM sodium borate/succinate buffer (pH 7·0).
Cellular nitrogen (N) was determined by the Kjeldahl method, as described previously (Asanuma & Hino, 1997 ). Enzyme activity was expressed as µmol NADH oxidized min-1 (µg cellular N)-1. The activity values represent enzyme activity per dry cell weight, because in each case approximately 95% of cells were disrupted by ultrasonication, and cellular N determined by the Kjeldahal method was parallel to dry cell weight. Since the rates of NADH oxidation in the absence of one of the substrates and auxiliary enzymes were extremely low, NADH oxidase activity was considered to be negligible.
Purification of Pck and Pyk.
Pck and Pyk were purified by column chromatography with DEAE-Sepharose CL-6B (2·5x50 cm column), Sephacryl S-200 HR (2·5x70 cm), Resource Q (6 ml), Mono Q (1 ml) and Superdex 200 HR 10/30 (1·0x30 cm). All the gels were purchased from Amersham Pharmacia Biotech and procedures for chromatography were described previously (Asanuma et al., 1997 ). The purified Pck and Pyk were analysed by SDS-PAGE (Laemmli, 1970 ) to estimate the molecular masses of the enzymes and subunits.
Extraction of genomic DNA and sequencing procedure.
Unless otherwise stated, the handling of DNA was carried out by the standard procedures described by Sambrook et al. (1989) . Nucleotide sequence was determined by using a Big Dye Terminator Sequencing Kit (PE Applied Biosystems) and an ABI PRISM 310 sequencer (PE Applied Biosystems). The sequence data were evaluated as described previously (Asanuma et al., 1999 ).
PCR amplification.
Based on the sequences of the genes encoding Pck (pck) from E. coli, Anaerobiospirillum succiniciproducens and Haemophilus influenzae, oligonucleotide primers for PCR were designed, and two primers, pck-1 (5'-+241ACCGGCCGTTCTCCTAA+257-3') and pck-2 (5'-+1296ACCGAAGCAAGCGGAGAAGGT+1276-3'), were prepared commercially (Espec Oligo Service). The PCR product from genomic DNA of S. ruminantium was a 1056 bp fragment, which was highly homologous to pck of other bacteria (BLAST search). Subsequently, inverse PCR (Howard et al., 1988 ; Trigrlia et al., 1988 ) was carried out on PstI-digested and religated genomic DNA to sequence the regions upstream and downstream of the 1056 bp pck fragment. Sequence analysis showed that the inverse PCR product included the 5' and 3' ends of pck.
The nucleotide sequence of the S. ruminantium Pyk gene (pyk) was determined by the procedure described above. The oligonucleotide primers to amplify pyk, pyk-1 (5'-+292GATACHAAAGGTCCDGAA+309-3') and pyk-2 (5'-+821CCRCGVGCWACCATRATGCC+802-3'), were designed from the pyk sequences of E. coli, Salmonella typhimurium and Bacillus subtilis. Inverse PCR was carried out on EcoRI-digested and religated genomic DNA. The nucleotide sequences of Sel. ruminantium pck and pyk were registered in the GenBank nucleotide sequence database with accession numbers AB016600 and AB037182, respectively.
Primer extension analysis.
This was carried out with IRD41-labelled primers, 5'-+390CAGTTCCTTTTTAGCGATTTCTTTCA+365-3' for pck and 5'-+344ATAACTTTGCCATCTTTGAACTCGC+320-3' for pyk, with a Li-Cor DNA sequencer (Aloka) as described previously (Asanuma et al., 1999 ).
Northern blot analysis of pck and pyk mRNAs.
Northern blot analysis was performed as described previously (Asanuma et al., 1997 ). The probe specific to S. ruminantium pck mRNA was the 1056 bp fragment which had been amplified with pck-1 and pck-2. The PCR product prepared with pyk-1 and pyk-2 was used as a probe for pyk mRNA. The amounts of pck and pyk mRNAs in 10 µg total RNA were estimated from the peak area and intensity by using a Fluor-S Multi Imager (Bio-Rad). To make a standard curve of each mRNA, graded amounts of an identical RNA sample were similarly subjected to Northern blot analysis. The relative amounts of each mRNA in samples were determined from the standard curves.
Determination of the degradation rate of mRNA.
Rifampicin (100 µg ml-1) was added to cultures at the mid-log growth stage and cells were harvested every 5 min after the addition. The degradation rates of pck and pyk mRNAs were estimated from the slopes of plots obtained by Northern blot analysis.
Preparation of antiserum against Pck and Western-blot analysis.
The pck gene was cloned in plasmid pGEX-4T-3, to express a GST fusion protein (Amersham Pharmacia Biotech), and this plasmid was transformed into E. coli HB101. The E. coli harbouring the recombinant plasmid overexpressed recombinant protein. The recombinant protein was purified with Glutathione-Sepharose 4B (Amersham Pharmacia Biotech) and a part of glutathione-S-transferase was cut off with thrombin (Amersham Pharmacia Biotech). Polyclonal antibody against Pck was prepared in a rabbit, and Western blot analysis was carried out with the antibody. All the procedures were as described previously (Asanuma & Hino, 2000 ). The polyclonal antibody against Pck was the primary antibody, alkaline phosphatase-conjugated anti-rabbit goat IgG (Bio-Rad) was the secondary antibody and 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium were the substrates to visualize Pck. The amounts of Pck were estimated with a Fluor-S Multi Imager (Bio-Rad) as described above.
Determination of PEP, pyruvate, adenine nucleotides and fermentation products.
To determine the concentrations of intracellular PEP, pyruvate and adenine nucleotides, cultures were immediately frozen in liquid nitrogen, and 1% (v/v) perchloric acid was added to the frozen samples. After being thawed on ice, the samples were centrifuged (18000 g, 5 min, 4 °C), and the supernatant was neutralized with 50% (w/v) K2CO3. After removal of the precipitate by centrifugation, the supernatant was concentrated to one-tenth volume with a centrifuge evaporator. The concentrated samples were analysed for PEP and pyruvate by the enzymic methods described by Garrigues et al. (1997) . ATP was assayed by measuring the light output from a luciferin/luciferase mix (Micro Tech Nichion) as recommended by the manufacturer. ADP and AMP were assayed by converting to ATP with Pyk and adenylate kinase plus Pyk, respectively, according to Kimmich et al. (1975) . Organic acids produced by S. ruminantium were analysed by HPLC as described previously (Hino et al., 1991 ).
Evaluation of data.
Data were analysed by Tukeys test or Students t-test using the SigmaStat Statistical Analysis System (Jandel Scientific).
The pck operon of S. ruminantium was found to consist of 1620 bp, beginning with ATG and terminating with a TAA codon. pck was deduced to encode a 538 aa protein with a molecular mass of 59573 Da. Primer extension analysis revealed that only one transcriptional start site exists 73 bp upstream from the pck start codon (Fig. 1a).
|
A putative ribosome-binding site, the ShineDalgarno sequence (+54GAAAGA+59), was found 19 bp upstream from the ATG initiation codon. The -35 and -10 promoter regions (-35TTGACA-30 and -12TAATAT-7) were also present. An inverted repeat sequence characteristic of transcriptional terminators was detected between +1706 and +1739, being situated 14 bp downstream of the termination codon. A free-energy change of -10·0 kcal mol-1 in this region of the corresponding mRNA suggested a stemloop structure. These results suggest that S. ruminantium pck is monocistronic.
Analysis of pyk indicated that the operon consists of 1413 bp, beginning with ATG and terminating with TAA. The molecular mass of Pyk was deduced to be 51285 Da. Two unidentified ORFs, 789 bp and 1101 bp, were located 464 bp and 1241 bp, respectively, downstream of the pyk operon. Two products were found by primer extension analysis (Fig. 1b), which indicates that transcription starts from two sites, 93 bp and 120 bp upstream of the pyk ATG start codon. The extension product with higher intensity was shown to end at G+1 on the coding strand, while the other product ended at T-27.
A possible ribosome-binding site, the ShineDalgarno sequence (+71AAAGA+75), was identified at a position 19 bp upstream from the ATG initiation codon of the pyk gene. In addition, the potential -35 (-29CTGATG-24 and -63TTTACT-58) and -10 (-8TTAAAT-3 and -40TAGAAT-35) regions, corresponding to each transcriptional start site, were found. An inverted repeat terminator sequence was situated 59 bp downstream from the termination codon of pyk (between +1565 and +1595). A stemloop structure was inferred in this region of the pyk mRNA, strongly suggesting that pyk is monocistronic.
Molecular mass and the quaternary structure of Pck and Pyk
The molecular mass of purified Pck was estimated to be ∼60 kDa by gel filtration (data not shown). SDS-PAGE of the protein gave a single band at ∼60 kDa, which agreed with the value deduced from the amino acid sequence. These results indicate that S. ruminantium Pck is a monomer. Purified Pyk was approximately 200 kDa, as estimated by gel filtration. Only one peak with Pyk activity was always shown in all the steps of column chromatography, which suggests that S. ruminantium has only one type of Pyk. The SDS-PAGE of the Pyk fraction after gel filtration gave a single band at ∼50 kDa, suggesting that Pyk is a tetramer. Based on its gene structure, S. ruminantium Pyk was concluded to consist of four identical subunits.
Properties of Pck and Pyk
No Pck activity was detected in the absence of Mg2+ or Mn2+ (data not shown), suggesting that S. ruminantium Pck is a typical Pck that requires a divalent transition metal ion (Utter & Kolenbrander, 1972 ; Cannata & de Flombaum, 1974 ). Similar to A. succiniciproducens Pck (Laivenieks et al., 1997 ), both Mg2+ and Mn2+ were required for maximal activity. The requirement for Mg2+ and Mn2+ is consistent with the fact that S. ruminantium Pck has two metal-binding sites at Gly242Thr249 and Leu259Asp263 (Matte et al., 1996 ; Tari et al., 1996 ). Pck had a pH optimum of 7·0, with half-maximal activity being observed at pH 6·0 and 8·5 (data not shown).
From the LineweaverBurk plot of the Pck reaction, Km values were estimated to be 0·55 mM for PEP and 0·46 mM for ADP (data not shown). When GDP and IDP were substituted for ADP, Pck activity was not detected. The specific requirement for ADP is typical of bacterial Pck enzymes (Teraoka et al., 1970 ; Samuelov et al., 1991 ). In the decarboxylation of OAA, the Km values for OAA and ATP were 0·81 and 0·92 mM, respectively.
S. ruminantium Pyk required either Mg2+ or Mn2+, and was activated by 5 mM K+ but not by 100 mM Na+ or 100 mM (data not shown). The optimal pH of Pyk was 7·0 and a change in pH had a smaller effect on Pyk activity than on Pck activity. In the reaction from PEP to pyruvate, Pyk was homotropically activated by the substrate. The K0·5 (Km for an allosteric enzyme) values for PEP and ADP were 0·11 and 0·24 mM, respectively, whereas the values for pyruvate and ATP in the reverse reaction were 0·48 and 0·35 mM, respectively.
Pyk was markedly activated by FBP and the maximal activity was observed at 1·5 mM FBP (Table 1). Pyk activity was inhibited even by 0·1 mM Pi, but the activity was restored by 1·5 mM FBP. In the presence of 30 mM Pi, FBP acted in a dose-response manner and an FBP level higher than the level of Pi was needed for complete restoration of activity. Glucose 6-phosphate, which activates Pyk in E. coli (Waygood et al., 1975 ) and Streptococcus mutans (Abbe & Yamada, 1982 ), had no effect on Pyk activity (data not shown). Neither FBP nor Pi affected Pck activity (Table 1).
Table 1. Effect of Pi and FBP on the activities of Pyk and Pck
Transcription of pck and pyk
The Pck activity per cellular N when cells were grown on lactate was 11-fold higher than the activity when grown on glucose (Table 2); a similar result was obtained by measuring the amount of Pck protein (12-fold higher) by Western blotting (Fig. 2a, Table 2). The level of pck mRNA in lactate-grown cells was also 12-fold higher than that in glucose-grown cells (Fig. 2b, Table 2). Since the decay rate of pck mRNA was not affected by the energy substrate (data not shown), Pck synthesis is considered to be regulated at the transcriptional level. On the other hand, neither Pyk activity per cellular N nor the level of pyk mRNA was affected by the energy substrate (Fig. 3, Table 2).
Table 2. Levels of intracellular Pck and Pyk, and pck and pyk mRNAs, and fermentation products in S. ruminantium grown on glucose or lactate
|
|
Glucose was mainly fermented to lactate, and propionate production was much greater from lactate than from glucose (Table 2). This result was substantially compatible with the data on enzyme activity, although the difference in propionate plus succinate was smaller than the difference in enzyme activity.
In Northern blot analysis, only one band was detected that hybridized with a pck-specific probe (Fig. 2b), which agreed with the result of primer extension analysis. These results indicate that S. ruminantium pck is transcribed in a monocistronic fashion. Similarly, the transcription of S. ruminantium pyk was shown to be monocistronic (Fig. 3).
Effect of energy substrates on the levels of pck and pyk mRNAs
S. ruminantium was grown with lactate until the mid-log stage of growth and then incubated for an additional 20 min after supplementing with 10 mM glucose or fumarate. Addition of glucose and fumarate in the presence of lactate reduced the level of pck mRNA to 11% and 56%, respectively, of the initial value (Fig. 4a). A similar trend was observed in the amount of Pck protein per cellular N, although the changes were smaller (Fig. 4b). These results confirm that Pck synthesis is regulated at the transcriptional level. However, the level of pyk mRNA was not affected by supplementing with glucose or fumarate (data not shown).
|
The concentration of intracellular ATP was raised by supplementing with glucose, and to a lesser extent, with fumarate (Fig. 5a). The levels of ADP and AMP were inversely related to the level of ATP, although the changes were smaller compared to ATP (data not shown). Intracellular PEP and pyruvate were increased by the addition of glucose, but not by fumarate (Fig. 5b). These results suggest that fumarate was mainly metabolized to succinate, which coupled with ATP regeneration via electron transport phosphorylation, and little PEP and pyruvate were produced from fumarate. When S. ruminantium was grown with fumarate and H2, neither PEP nor pyruvate was detected (data not shown). Under this condition, intracellular ATP was below 0·1 µmol (g cellular N)-1 and neither pck mRNA nor Pck protein was detected.
|
S. ruminantium Pck was shown to possess putative functional residues, such as the sites to bind to ATP, Mg2+, Mn2+ and PEP, which have been reported for ATP/ADP-dependent Pck in other bacteria (Matte et al., 1996 ; Tari et al., 1996 ). The amino acid sequence of S. ruminantium Pck was highly homologous to the sequences of E. coli (Medina et al., 1990 ) and A. succiniciproducens Pcks (Laivenieks et al., 1997 ), suggesting that the tertiary structure is also similar.
Pyk has been reported to be a homotropic enzyme in S. ruminantium and other bacteria (Kapoor & Venkitasubramanian, 1981 ; Garcia-Olalla & Garrido-Pertierra, 1987 ; Melville et al., 1988 ). E. coli is known to have two types of Pyk (Waygood et al., 1975 , 1976 ; Mattevi et al., 1996 ): one type is activated by FBP, and the other type is activated by AMP and sugar monophosphates. However, S. ruminantium was shown to possess only one type, which was activated by FBP.
Based on the primary structure of Pyk, bacterial Pyk enzymes can be divided into two groups (Sakai & Ohta, 1993 ): one group includes Bacillus spp. (Sakai & Ohta, 1993 ; Tanaka et al., 1995 ), which has an extra C-terminal sequence, and the other group includes E. coli (GenBank accession numbers M24636 and M63703) and Sal. typhimurium (X99945), which do not contain such a sequence. Sel. ruminantium Pyk was found to belong to the latter group.
Two transcriptional start sites were identified in S. ruminantium pyk, which were close to each other (Fig. 1b). However, in Northern-blot analysis, only one 1·4 kb transcript hybridizing with a pyk probe was observed (Fig. 3). This discrepancy is probably due to the small difference in the length of the two transcripts (26 bp), which made it technically difficult to separate them by Northern blotting. Possibly, S. ruminantium Pyk is transcribed from the two sites, suggesting that this gene is efficiently transcribed. In Lactobacillus delbrueckii subsp. bulgaricus (Branny et al., 1993 ), Lactococcus lactis (Llanos et al., 1993 ), Bacillus psychrophilus and Bacillus licheniformis (Tanaka et al., 1995 ), the gene encoding phosphofructokinase (pfk) exists adjacent to pyk, forming one operon. However, pfk was not found in the region adjacent to pyk in S. ruminantium, supporting the conclusion that S. ruminantium pyk is monocistronic. In Zymomonas mobilis, pyk is a monocistronic gene (Steiner et al., 1998 ).
Properties of Pck and Pyk
For the maximal activity of S. ruminantium Pyk, FBP was required at a level higher than 1·5 mM (Table 2). In addition, the level of FBP needed to be higher than the level of Pi, because Pi severely inhibited the activity. Since the physiological Pi concentration is possibly 2040 mM (Bond & Russell, 1998 ), intracellular Pyk may be present in an inactive state in the absence of FBP. It is conceivable that the Pyk reaction is highly dependent on the concentration of intracellular FBP. Probably, Pyk never acts at the maximal activity in S. ruminantium because the intracellular level of FBP is unlikely to rise to the level of Pi (Garrigues et al., 1997 ; Bond & Russell, 1998 ). The optimal pH of S. ruminantium Pck and Pyk was 7·0, and the effect of low pH on the activities of these enzymes was not great, which is consistent with the observation that fermentation pattern was not greatly affected by culture pH (data not shown).
Melville et al. (1988) reported that the Pck reaction exhibited a sigmoidal saturation curve, as measured with PEP as the substrate, and the K0·5 value for PEP was 5·5 mM. In our experiments, however, Pck was not homotropically activated by PEP and the Km value for PEP was 0·55 mM. This discrepancy is inexplicable at present, but the difference in Km or K0·5 may be explained by the difference in assay conditions: Melville et al. (1988) did not add CO2 and Mn2+ to the reaction mixture, which possibly resulted in a much higher value. In other bacteria, e.g. E. coli (Krebs & Bridger, 1980 ), A. succiniciproducens (Laivenieks et al., 1997 ) and Ruminococcus flavefaciens (Schocke & Weimer, 1997 ), homotropic activation of Pck was not observed, and the Km values were rather close to our value. On the other hand, S. ruminantium Pyk was shown to be activated in a homotropic fashion, which agreed with the result of Melville et al. (1988) . The K0·5 value for PEP was 0·11 mM, which is comparable to the value (0·086 mM) reported by Melville et al. (1988) .
The Km value for PEP in the Pck reaction was not greatly different from the value for OAA in the reverse reaction, and the Km value for ADP was half the value for ATP. Accordingly, the Pck reaction in S. ruminantium is possibly reversible, and Pck may be used for gluconeogenesis. However, the Pck is probably used for ATP formation, when S. ruminantium is actively growing.
In the Pyk reaction, the K0·5 value for pyruvate was 4·4-fold higher than the value for PEP and the value for ATP was 1·5-fold higher than the value for ADP, which suggests that the reaction from PEP to pyruvate is favoured. The equilibrium of the reaction is probably far towards pyruvate, but the reverse reaction may be possible in vivo. Melville et al. (1988) suggested the existence of pyruvate carboxylase in S. ruminantium, but we could not demonstrate the activity of this enzyme by the same assay method. We presume at present that PEP can be formed from lactate by Ldh and Pyk.
Transcription of pck and pyk
When S. ruminantium was grown on glucose, Pyk activity was 40-fold higher than Pck activity, whereas the sum of the amounts of lactate and acetate was fourfold higher than the sum of the amounts of succinate and propionate (Table 2). This is probably because Pyk does not act at its maximal activity, as described above. Since Km values were not greatly different between Pck and Pyk, the enhancement of the activity or amount of Pck possibly augments propionate production.
The level of pck mRNA in glucose-grown cells was much lower than that in lactate-grown cells (Table 2). The level was greatly lowered by supplementing with glucose in the presence of lactate, and to a lesser extent, by supplementing with fumarate (Fig. 4a). There was an inverse relationship between pck mRNA and the ATP level (Fig. 5a), and a positive correlation between pck mRNA and ADP, as well as between pck mRNA and AMP, was observed. Melville et al. (1988) observed in the continuous culture of S. ruminantium that Pck activity was detected at a dilution rate (D) of 0·1 h-1, but not detected at a D of 0·6 h-1. Hobson & Summers (1972) reported that the ATP pool in S. ruminantium increased with an increase in D. These results may suggest that the transcription of S. ruminantium pck is suppressed by ATP, or stimulated by ADP or AMP. When cells are deficient in ATP, the fermentation pathway is possibly regulated to increase the flow from PEP to propionate so that more ATP is regenerated.
In S. ruminantium grown with fumarate and H2, neither pck mRNA nor Pck protein was detected despite a low level of ATP and high levels of ADP and AMP. Since neither PEP nor pyruvate was detected under this condition, it could be presumed that PEP or pyruvate is required for the onset of pck transcription. As an activator, PEP may be a more likely candidate, because it is a substrate of Pck and a phosphorylated compound. On the other hand, the level of intracellular PEP was enhanced by the addition of glucose (Fig. 5b), but the level of pck mRNA declined (Fig. 4a). This result may indicate that ATP suppresses pck transcription, and that the suppression is not relieved even by the high level of PEP.
Collectively, the fermentation pathway of glucose branches out at PEP to pyruvate by Pyk and to OAA by Pck, leading to propionate production (Fig. 6). The amount of propionate is proportional to the activity ratio of Pyk and Pck. The pyk gene is always transcribed, and Pyk is activated by FBP and PEP. FBP alleviates the inhibitory effect of Pi. S. ruminantium regulates Pck synthesis at the transcriptional level, possibly responding to the degree of energy supply. Presumably, ATP and PEP act as a suppressor and an activator, respectively, in the transcription of pck, although this presumption needs to be verified.
|
References
Asanuma, N. & Hino, T.(1997). Tolerance to low pH and lactate production in rumen bacteria. Anim Sci Technol 68, 367-376.
Asanuma, N. & Hino, T.(2000). Effect of pH and energy supply on the activity and amount of pyruvate formate-lyase in Streptococcus bovis. Appl Environ Microbiol 66, 3773-3777.
Asanuma, N., Iwamoto, M. & Hino, T.(1997). Regulation of lactate dehydrogenase synthesis in a ruminal bacterium, Streptococcus bovis. J Gen Appl Microbiol 43, 325-331.
Asanuma, N., Iwamoto, M. & Hino, T.(1998). Formate metabolism by ruminal microorganisms in relation to methanogenesis. Anim Sci Technol 69, 576-584.
Asanuma, N., Iwamoto, M. & Hino, T.(1999). Structure and transcriptional regulation of the gene encoding pyruvate formate-lyase of a ruminal bacterium, Streptococcus bovis. Microbiology 145, 151-157.[Abstract]
Bergen, W. G. & Bates, D. B.(1984). Ionophores: their effect on production efficiency and mode of action. J Anim Sci 58, 1465-1483.
Bond, D. L. & Russell, J. B.(1998). Relationship between intracellular phosphate, proton motive force, and rate of nongrowth energy dissipation (energy spilling) in Streptococcus bovis JB1. Appl Environ Microbiol 64, 976-981.
Branny, P., de la Torre, F. & Garel, J.-R.(1993). Cloning, sequencing, and expression in Escherichia coli of the gene coding for phosphofructokinase in Lactobacillus bulgaricus. J Bacteriol 175, 5344-5349.
Caldwell, D. R. & Bryant, M. P.(1966). Medium without rumen fluid for non-selective enumeration and isolation of rumen bacteria. Appl Microbiol 14, 794-801.[Medline]
Cannata, J. B. & de Flombaum, M. A. C.(1974). Phosphoenolpyruvate carboxykinase from bakers yeast: kinetics of phosphoenolpyruvate formation. J Biol Chem 249, 3356-3365.
Collins, L. B. & Thomas, T. D.(1974). Pyruvate kinase of Streptococcus lactis. J Bacteriol 120, 52-58.
Garcia-Olalla, C. & Garrido-Pertierra, A.(1987). Purification and kinetic properties of pyruvate kinase isoenzymes of Salmonella typhimurium. Biochem J 241, 573-581.[Medline]
Garrigues, C., Loubiere, P., Lindley, N. D. & Cocaign-Bousquet, M.(1997). Control of the shift from homolactic acid to mixed-acid fermentation in Lactococcus lactis: predominant role of the NADH/NAD+ ratio. J Bacteriol 179, 5282-5287.
Hino, T., Miyazaki, K. & Kuroda, S.(1991). Role of extracellular acetate in the fermentation of glucose by a ruminal bacterium, Megasphaera elsdenii. J Gen Appl Microbiol 37, 121-129.
Hobson, P. N. & Summers, R.(1972). ATP pool and growth yield in Selenomonas ruminantium. J Gen Microbiol 70, 351-360.
Howard, O., Gerber, A. S. & Hartl, D. L.(1988). Genetic applications of an inverse polymerase chain reaction. Genetics 120, 621-623.
Hungate, R. E.(1966). Chapter 2. In The Rumen and Its Microbes , pp. 8-90. Edited by R. E. Hungate. New York:Academic Press.
Hungate, R. E., Smith, W., Bauchop, T., Yu, I. & Rabinowitz, J. C.(1970). Formate as an intermediate in the bovine rumen fermentation. J Bacteriol 102, 389-397.
Kapoor, R. & Venkitasubramanian, T. A.(1981). Glucose 6-phosphate activation of pyruvate kinase from Mycobacterium smegmatis. Biochem J 193, 435-440.[Medline]
Kimmich, G. A., Randles, J. & Brand, J. S.(1975). Assay of picomole amounts of ATP, ADP and AMP using the luciferase enzyme system. Anal Biochem 69, 187-206.[Medline]
Krebs, A. & Bridger, W. A.(1980). The kinetic properties of phosphoenolpyruvate carboxykinase of Escherichia coli. Can J Biochem 58, 309-318.[Medline]
Laemmli, U. K.(1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Laivenieks, M., Vieille, C. & Zeikus, J. G.(1997). Cloning, sequencing, and overexpression of the Anaerobiospirillum succiniciproducens phosphoenolpyruvate carboxykinase (pckA) gene. Appl Environ Microbiol 63, 2273-2280.[Abstract]
Llanos, R. M., Harris, C. J., Hillier, A. J. & Davidson, B. E.(1993). Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase. J Bacteriol 175, 2541-2551.
Marounek, M., Fliegrova, K. & Bartos, S.(1989). Metabolism and some characteristics of ruminal strains of Megasphaera elsdenii. Appl Environ Microbiol 55, 1570-1573.
Matte, A., Goldie, H., Sweet, R. M. & Delbaere, L. T. J.(1996). Crystal structure of Escherichia coli phosphoenolpyruvate carboxykinase: a new structural family with the P-loop nucleoside triphosphate hydrolase fold. J Mol Biol 256, 126-143.[Medline]
Mattevi, A., Bolognesi, M. & Valentini, G.(1996). The allosteric regulation of pyruvate kinase. FEBS Lett 389, 15-19.[Medline]
Medina, V., Pontarollo, R., Glaeske, D., Tabel, H. & Goldie, H.(1990). Sequence of the pckA gene of Escherichia coli K-12: relevance to genetic and allosteric regulation and homology of E. coli phosphoenolpyruvate carboxykinase with the enzymes from Trypanosoma brucei and Saccharomyces cerevisiae. J Bacteriol 172, 7151-7156.
Melville, S. B., Michel, T. A. & Macy, J. M.(1988). Pathway and sites for energy conservation in the metabolism of glucose by Selenomonas ruminantium. J Bacteriol 170, 5298-5304.
Miller, T. L.(1995). Ecology of methane production and hydrogen sinks in the rumen. In Ruminant Physiology: Digestion, Metabolism, Growth and Reproduction , pp. 317-331. Edited by W. A. Engelhardt, S. Leonhard-Marek, G. Breves & D. Giesecke. Stuttgart:Ferdinand Enke Verlag.
Sakai, H. & Ohta, T.(1993). Molecular cloning and nucleotide sequence of the gene for pyruvate kinase of Bacillus stearothermophilus and the production of the enzyme in Escherichia coli: evidence that the genes for phosphofructokinase and pyruvate kinase constitute an operon. Eur J Biochem 211, 851-859.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Samuelov, N. S., Lamed, R., Lowe, S. & Zeikus, J. G.(1991). Influence of CO2-HCO3-levels and pH on growth, succinate production, and enzyme activities of Anaerobiospirillum succiniciproducens. Appl Environ Microbiol 57, 3013-3019.
Schocke, L. & Weimer, P. J.(1997). Purification and characterization of phosphoenolpyruvate carboxykinase from the anaerobic ruminal bacterium Ruminococcus flavefaciens. Arch Microbiol 167, 289-294.[Medline]
Steiner, P., Fussenegger, M., Bailey, J. E. & Sauer, U.(1998). Cloning and expression of the Zymomonas mobilis pyruvate kinase gene in Escherichia coli. Gene 220, 31-38.[Medline]
Stewart, C. S., Flint, H. J. & Bryant, M. P.(1997). The rumen bacteria. In The Rumen Microbial Ecosystem , pp. 10-72. Edited by P. N. Hobson & C. S. Stewart. London and New York:Elsevier.
Tanaka, K., Sakai, H., Ohta, T. & Matsuzawa, H.(1995). Molecular cloning of the genes for pyruvate kinases of two bacilli, Bacillus psychrophilus and Bacillus licheniformis, and comparison of properties of the enzymes produced in Escherichia coli. Biosci Biotechnol Biochem 59, 1536-1542.[Medline]
Tari, L. W., Matte, A., Pugazhenthi, U., Goldie, H. & Delbaere, L. T. J.(1996). Snapshot of an enzyme reaction intermediate in the structure of the ATP-Mg2+-oxalate ternary complex of Escherichia coli PEP carboxykinase. Nature Struct Biol 3, 355-363.[Medline]
Teraoka, H., Nishikino, T., Izui, K. & Katsuki, H.(1970). Control of the synthesis of phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in Escherichia coli. J Biochem 67, 567-575.
Tiwari, A. D., Bryant, M. P. & Wolfe, R. S.(1969). Simple method for isolation of Selenomonas ruminantium and some nutritional characteristics of the species. J Dairy Sci 52, 2054-2056.
Trigrlia, T., Peterson, M. G. & Kemp, D. J.(1988). A procedure for in vitro amplification of DNA segments that lie outside of known sequences. Nucleic Acids Res 16, 81-86.
Utter, M. F. & Kolenbrander, H. M.(1972). Formation of oxaloacetate by CO2 fixation on phosphoenolpyruvate. In The Enzymes , pp. 117-168. Edited by P. Boyer. New York:Academic Press.
Van Nevel, C. J. & Demeyer, D. I.(1988). Manipulation of rumen fermentation. In The Rumen Microbial Ecosystem , pp. 387-443. Edited by P. N. Hobson. London and New York:Elsevier.
Waygood, E. B., Rayman, M. K. & Sanwal, B. D.(1975). The control of pyruvate kinases of Escherichia coli. II. Effectors and regulatory properties of the enzyme activated by ribose-5-phosphate. Can J Biochem 53, 444-454.[Medline]
Waygood, E. B., Mort, J. S. & Sanwal, B. D.(1976). The control of pyruvate kinases of Escherichia coli: binding of substrate and allosteric effectors to the enzyme activated by fructose-1,6-bisphosphate. Biochemistry 15, 277-282.[Medline]
Wolin, M. J., Miller, T. L. & Stewart, C. S.(1997). Microbemicrobe interactions. In The Rumen Microbial Ecosystem , pp. 467-491. Edited by P. N. Hobson & C. S. Stewart. London:Blackie.
Received 31 July 2000; revised 23 October 2000; accepted 9 November 2000.