Abstract
Keywords: white-rot fungi, metallochaperone, laccase
Abbreviations: BCS, bathocuproinedisulfonic acid; DABA, diaminobenzaldehyde; Ferrozine, 3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine-4',4'-disulfonic acid; IS, insertion sequence; SOD, superoxide dismutase
Although being an essential co-factor, copper can be toxic even at low concentrations: Cu(I) and Cu(II) ions may bind with high affinity to inappropriate sites in non-copper proteins (Predki & Sakar, 1992 ) and they can participate in the aerobic generation of oxygen radicals, thus catalysing the auto-oxidation of biomolecules such as lipids, proteins and nucleic acids (Halliwell & Gutteridge, 1984 ). Organisms possess several mechanisms to maintain intracellular copper concentrations at adequate levels. These include various copper homeostasis factors that control the uptake, distribution and sequestration of this metal inside the cell. For example, under high copper concentrations, cells express metallothionein-like proteins that bind the metal tightly. Under normal cellular copper concentrations, estimated for the yeast cell model to be less than one atom of free copper per cell (Rae et al., 1999 ), cells express so-called copper metallochaperones that guide and protect the copper ions, and facilitate their proper delivery to their different destinations, e.g. to mitochondria, to the secretory pathway and to cytoplasmic enzymes (OHalloran & Culotta, 2000 ).
In the yeast Saccharomyces cerevisiae there is an overlap between copper homeostasis and oxygen-radical metabolism (Culotta et al., 1995 ; Tamai et al., 1993 ). The yeast gene encoding the copper metallochaperone Atx1p (anti-oxidant) was originally isolated as a gene conferring protection against oxidative stress in yeast (Lin & Culotta, 1995 ). Atx1p is a cytoplasmic copper chaperone that binds copper and delivers it to an intracellular copper-transporting P-type ATPase, Ccc2p, located in the Golgi compartment of the secretory pathway (Pufahl et al., 1997 ). Ccc2p pumps copper into the lumen of the Golgi, where copper is then inserted into secreted copper-dependent enzymes. The protein factors involved in cellular copper homeostasis are highly conserved between eukaryotes: copper metallochaperones homologous to Atx1p and to the copper-transporting P-type ATPases have been described in yeast, mammal, nematode and plant systems (Himelblau et al., 1998 ; Hirayama et al., 1999 ; Hung et al., 1997 ; Klomp et al., 1997 ; Payne & Gitlin, 1998 ; Wakabayashi, 1998 ). However, these factors seem to be regulated differently in the various systems.
In filamentous fungi there are no factors described to date that mediate copper supply to the secretory pathway (i.e. copper chaperone and P-type ATPase). As these factors appear to play an important role in the biogenesis of the copper-dependent laccases thought to participate in lignin degradation, we decided to characterize them in a fungal system and study their regulation.
Our organism of choice, Trametes versicolor, is a white-rot fungus capable of secreting substantial amounts of laccases. Here we describe the identification of the gene tahA (Trametes ATX homologue) from the basidiomycete T. versicolor, which encodes a protein of 72 aa with 56% sequence identity to yeast Atx1p. We characterized the gene and its product on the structural, biochemical and functional levels. We studied its transcriptional regulation when exposed to different concentrations of metals, such as copper or iron, of xenobiotica, such as diaminobenzaldehyde (DABA), and of the redox-cycling drug paraquat, and discuss the results in relevance to conserved motifs found in the 5'-non-coding regulatory sequence of tahA and to the expression or biogenesis of laccases.
Organisms and culture conditions.The Escherichia coli strain used in this study was XL-1 Blue MRF'. The S. cerevisiae strains used were EG103 (MATa/MATα leu2-3/his3-112Δ1/trp289a/ura3-52/GAL+), SL103 (isogenic to EG103 with Δatx1::LEU2) and SL133 (isogenic to EG103 with Δsod::URA3, Δsod2::TRP1, Δatx1::LEU2); they were obtained from Valeria Culotta, John Hopkins University School of Public Health, Baltimore, MD, USA. S. cerevisiae strains were grown in yeast nitrogen base (YNB) in liquid and on solid medium. Carbon sources were used at a concentration of 2%. 3-(2-Pyridyl)-5,6-diphenyl-1,2,4-triazine-4',4'-disulfonic acid (Ferrozine) was added up to a concentration of 2·5 mM, bathocuproinedisulfonic acid (BCS) was added up to a concentration of 50 µM and paraquat was added up to a concentration of 50 µM to solid medium.
The basidiomycete T. versicolor belongs to the ecological group of white-rot fungi. In this study, the dikaryotic strain TV-1 [deposited in the DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1B, D-38124 Braunschweig, Germany) as DSM 11523] and two monokaryotic strains, F6 and Sp4, derived from TV-1 via sporulation and harbouring distinct alleles of tahA were used. T. versicolor was maintained at 4 °C on malt agar plates (3% malt extract, 0·3% peptone, 1·5% agar, pH 5·0). Liquid cultures were grown at 30 °C in minimal medium comprising 20 g glucose, 1 g potassium dihydrogen phosphate, 0·5 g magnesium sulfate, 0·1 g disodium hydrogen phosphate, 27·5 mg adenine, 0·15 g DL-phenylalanine, 2·5 g L-asparagine, 0·48 mg thiamin, 10 mg calcium phosphate, 10 mg ferric sulfate, 2 mg cupric sulfate, 1 mg zinc sulfate and 1 mg manganese sulfate per litre. Three agar plugs (diameter, 7 mm) of a fungal colony (grown for up to 7 days on malt agar) were used to inoculate 100 ml liquid standing cultures in 550 ml (182 cm2) tissue-culture flasks. These pre-cultures were homogenized with an UltraTurrax apparatus (3500 r.p.m., 1 min) and used as the inoculum for the main culture. The main cultures of T. versicolor were grown in 300 ml minimal medium on a rotary shaker (110 r.p.m.) at 28 °C. Laccase expression was induced by adding 20 µg DABA ml-1 to a 4-day-old culture.
Plasmids and DNA libraries.
A genomic DNA library from T. versicolor was obtained from Dr Rupert Pfaller. The library was constructed with partially (Sau3A) digested total T. versicolor (TV-1) DNA that had been separated on a preparative gel. Fragments of between 5 and 25 kb in size were cloned into the BamHI site of the vector Lambda ZAP Express (Stratagene) and amplified in XL-1 Blue according to the supplied protocol.
A Trametes cDNA library that we had previously constructed in the two-hybrid vector pJG4-5 was used as a template for the isolation of tahA by PCR. For the construction of the T. versicolor cDNA library in pJG4-5, the purified mRNA was converted into cDNA using the cDNA Synthesis Kit (Stratagene). The first strands were synthesized as described in the protocol supplied, with a linker-primer that contained a XhoI site. After synthesis of the second strands, ligation of the EcoRI linkers and restriction with XhoI, the resulting cDNA was separated by gel filtration (using CL-Sepharose); the 0·25 kb fragments were pooled and used for directional ligation into the yeast two-hybrid vector pJG4-5. As tested with restriction analysis of inserts from different clones, the cDNA library contains inserts ranging from 0·1 to 3·5 kb in size. This library was used for the isolation of tahA fragments by PCR with degenerate oligonucleotides and for the isolation of full-length tahA clones.
A tahA-overexpressing yeast vector was constructed from pZErO-tah20, a pZErO (Invitrogen) derivative carrying the tahA cDNA in its multiple-cloning site. The tahA cDNA from pZErO-tah20 was excised with EcoRI and XhoI and directionally ligated into the yeast centromere plasmid pAH (Feldmann et al., 1996 ) via the EcoRI and SalI sites. The single-copy vector pAH is a derivative of pRS313 (Sikorski & Hieter, 1989 ) and carries ars/CEN sequences and the HIS3 gene for maintenance and selection in yeast. The resulting yeast yCp plasmid, pAH-tah, harbours the tahA cDNA under the control of the yeast ADH1 promoter and terminator, and carries the HIS3 gene for selection in yeast. The identity of tahA was verified by DNA sequencing. As a positive control, the yeast ATX1 gene was cloned into pAH. To create an EcoRI site at the 5' end and an XhoI site at the 3' end of ATX1, two primers (ATX-Eco-FW, 5'-GGA ATT ACC ATG GCA GAG ATA AAA CAT TA-3', and ATX-Xho-RV, 5'-CG CTC GAG TCA CAA TTG TTT GCC AGA T-3') were used in a PCR with Pwo polymerase (Roche) and yeast genomic DNA. The ATX1 gene obtained was directionally ligated into pAH, resulting in the vector pAH-ATX as confirmed by DNA sequencing. This vector served as a positive control in drop-test experiments. The original vector, pAH, was used as the negative control.
Preparation of Trametes DNA and Southern blot analysis.
For preparation of DNA, mycelia of T. versicolor were separated from the culture medium by filtration through a double layer of cheese cloth, washed with distilled water, dried between paper towels and frozen in liquid nitrogen. Large amounts of cells (up to 5 g of semi-dried mycelia) were disrupted by grinding with a pestle and mortar in liquid nitrogen. Smaller amounts of mycelia (up to 400 mg of semi-dried mycelia) were disrupted using the Micro-Dismembrator U (B. Braun Biotech). The ground mycelia were then dissolved in 5 ml extraction buffer (200 mM Tris/HCl, pH 8·5, 250 mM NaCl, 25 mM EDTA, 0·5% SDS) (g mycelia)-1. Proteins were separated from DNA by phenol extraction according to Sambrook et al. (1989 ). The DNA was precipitated from the aqueous phase with 0·54 vols 2-propanol, washed with 70% ethanol and then dissolved in TE buffer (10 mM Tris/HCl, pH 8, 1 mM EDTA).
For Southern blot analyses, DNA samples of the diploid (dikaryon TV-1) and the haploids (monokaryons F2, F6, SP4 and SP17) were digested with XhoI and XbaI. In each lane, 10 µg DNA was digested with 10 U restriction enzyme (µg DNA)-1 for 12 h. The DNA was separated by 1% agarose gel electrophoresis and transferred to a nylon membrane by capillary blotting. For the probe, cDNA of tahA was cut out of the yeast expression vector pAH (Feldmann et al., 1996 ) and labelled with [32P]dATP using the Random Primers Labelling System (Gibco). The blot was hybridized with the probe according to Church & Gilbert (1984) overnight at 65 °C, washed and then exposed to a phosphorous screen (Kodak).
Isolation of mRNA from T. versicolor for library construction.
Total RNA from T. versicolor was prepared according to Logemann et al. (1987) , starting with 2 g of semi-dried mycelium. The frozen mycelium together with 7 ml Z6 buffer (8 M guanidium hydrochloride, 20 mM MES, pH 7·0, 20 mM EDTA) and 1% (v/v) ß-mercaptoethanol was ground with a pestle and mortar in liquid nitrogen. After phenol extraction and ethanol precipitation, total RNA was dissolved in up to 1 ml diethylpyrocarbonate (DEPC)-treated water. The amount of total RNA obtained ranged from 1 to 1·5 mg. Isolation of mRNA from total RNA was performed using the mRNA Purification Kit (Pharmacia) according to the manufacturers instructions.
Isolation of total RNA from T. versicolor for Northern and S1-protection analyses.
Mycelia (500 mg) were frozen in liquid nitrogen and then ground with the Micro-Dismembrator U (B. Braun Biotech). RNA from the ground cells was isolated with 5 ml TRIZOL-Reagent (Gibco-BLR) according to the plant protocol. To remove the polysaccharides, the RNA was precipitated with a high-salt buffer also described in the Gibco protocol. The resulting RNA was then dissolved in 100 µl H2O for further use. The S1-protection assay was performed according to Weaver & Weissmann (1979) with 2 pmol each of primer tah (5'-*GTAAGTGTGCTCGGACATGGTGTATATCGGTTCAAGAGGCGGGGGATCGAACGGGCAGGGGGTGCGGAGGCAGAAGTCAGTCAGCA-3') and primer gapDH (5'-*GTGGGCGTGCGAGGAGTCCCAAGGAGGCCGTTGAATGCGGCAGAAAGGCCCGCCATTCAGTCAGCA-3') that had been end-labelled (*) with 150 µCi (5·55 MBq) [γ-32P]ATP using polynucleotide kinase. The labelled primers (103 c.p.m.) were then added to 50 µg total RNA in 1 M NaCl/330 µM EDTA (pH 8)/160 mM HEPES (pH 7·5), heated to 75 °C for 10 min and then hybridized at 55 °C overnight. S1-nuclease digestion was carried out with 150 U S1 nuclease (Amersham) in 270 µl of the provided buffer. The reaction was stopped after 3060 min by adding 3 µl of 0·5 M EDTA followed by precipitation of the RNA with 0·7 ml ethanol. The pellet was dried and after resuspending it in 95% formamide/0·025% SDS/0·025% bromophenol blue/0·025% xylenexylanol blue, the fragments were heated to 90 °C for 2 min and then analysed by 8% denaturing PAGE. The detection of the signal was carried out as described for Northern blots (see below).
For Northern analyses, 10 µg total RNA was separated on a horizontal agarose gel and then transferred to a nylon membrane (Hybond-N+; Amersham) by capillary transfer, according to Sambrook et al. (1989) and Wahl et al. (1987) . RNA was transferred under mildly alkaline conditions using 5x SSC/10 mM NaOH for 2 h as recommended by Löw & Rausch (1994) . Hybridization with the radioactive probes was carried out overnight according to Church & Gilbert (1984) . The blot was then washed and exposed to a phosphor screen (Kodak) overnight. The screen was scanned with Storm 860 (Amersham) and analysed with the IMAGE-QUANT software (Amersham).
Generation of a tahA fragment from a Trametes cDNA library by PCR with degenerate primers.
For the isolation of a cDNA fragment of tahA, two guessmer primers were used: primer A (5'-GTC GNN ATG ACC TGC-3') is homologous to the region V(M)G(D/V)MT(S)C, near the N-terminal copper-binding motif MTCxxC, and primer B (5'-CTT RCC GGT CTT-3') is the reverse complement to the lysine-rich C-terminal motif KTGK found in all four proteins of the different organisms described in Fig. 4 (the one-letter code of nucleotides is also explained in the legend for Fig. 4). As a template, the pJG4-5 Trametes cDNA library was used. PCR was performed with Taq polymerase at an annealing temperature of 42 °C in a Corbet Research FTS Capillary Fast Thermal Sequencer. A PCR fragment of 170 bp was obtained, subcloned in pCR2.1 (Invitrogen) and sequenced.
|
Isolation of genes from a Trametes genomic library.
The genomic Trametes library was screened as recommended in the protocol supplied with the lambda ZAP Express cloning system (Stratagene). In a first screening round, E. coli XL-1 Blue MRF' was cultivated on 10 Petri dishes and infected with 50000 phages per Petri dish. After an overnight incubation at 37 °C, the phages were transferred onto nylon membranes (Amersham) according to the protocol of the supplier (Stratagene). The filters were hybridized with the 170 bp tah cDNA fragment (obtained from the PCR described above) using the Rapid Hybridization buffer (Amersham) at 65 °C. Cross-reacting clones were picked and further purified by two additional screening rounds. Nine independent cross-reacting clones were obtained. Using the in vivo excision protocol of the supplier, the phages were subcloned into pBKCMV (Stratagene), and analysed by restriction enzyme and Southern analyses. Two full-length alleles of tahA, each with their 5'- and 3'-regulatory sequences, were obtained from five overlapping clones.
Sequence analysis.
Clones were sequenced completely from their 5' and 3' ends by cycle sequencing on an automated sequencer (Laboratorium für molekulare Biologie, Abt. Genomics, München). Database searches with DNA-fragment-derived protein sequence data were performed with the program BLASTX (National Institutes of Health; http://www.nih.gov/). Alignments were generated using the CLUSTAL X.63B Multiple Sequence Alignment Program, a multiple alignment tool developed by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Further sequence analysis and data processing were performed with the GENE INSPECTOR 1.5 program (Textco).
Isolation of full-length cDNA clones of tahA.
To obtain full-length cDNA clones of tahA, two primers were designed based on the information obtained from the partial tahA fragment generated by the first PCR. The primer TCC-ord (5'-GCT GAA GAA GAC GGA CGG TGT-3') is homologous to a region near the 5' end of the tahA fragment obtained by guessmer PCR. The primer TCC-rev (5'-GTC GTC GTA CGG AAT CGT GCC-3') is the reverse complement to a region near the 3' end of this tahA fragment. Each primer was combined in a separate PCR with either one of two vector-specific primers, pJG-ord (5'-TTG CTG AGT GGA GAT GCC TCC-3') or pJG-rev (5'-TCC AGA CTT GAC CAA ACC TCT G-3'), in such a way that the 3' and 5' ends of the cDNAs of tahA were obtained. These fragments were overlapping in the centre, meaning a full-length sequence of tahA cDNA (two different alleles) could be obtained. Taq polymerase was used according to the suppliers instructions (Roche). The reaction volume was 18 µl and contained 10 ng pJG4-5 cDNA library, buffer, 1 U Taq polymerase, 1·5 mM MgCl2, 0·2 mM each of the four dNTPs and 100 pmol each of the primers TCC-ord and pJG-rev (for the amplification of the 3' end) and in a parallel tube 100 pmol each of the primer TCC-rec and pJG-ord (for the amplification of the 5' end). The PCR conditions used were 3 min at 94 °C, followed by 30 cycles of 30 s at 94 °C, 10 s at 70 °C and 1 min at 72 °C. Under these conditions, PCR products of approximately 450 bp (for the 3' end) and 300 bp (for the 5' end) in size were obtained. The PCR fragments were purified by gel electrophoresis and cloned into the vector pCR2.1 (Invitrogen); from each fragment, five independent clones were sequenced. The information obtained from these overlapping sequences was used to generate primers for the isolation of full-length cDNAs of tahA: the primers cTAH-FW (5'-ACC ATG TCC GAG CAC ACT TAC-3') and cTAH-RV (5'-GA TCA TAC CAC CGT CTC TCC-3') were used in a PCR with Pwo polymerase (Roche) and the pJG4-5 cDNA library as a template. The PCR conditions were the same as described, except that the annealing temperature was 65 °C instead of 70 °C. The resulting DNA band of 224 bp was purified by gel electrophoresis, subcloned into pZErO (Invitrogen), and five independent clones were sequenced.
Complementation of yeast by tahA.
The yeast strains SL103 (Δatx1) and SL133 (Δsod1 Δsod2 Δatx1) were transformed with pAH-tah, pAH-ATX (positive control) or pAH (negative control), using the high-efficiency lithium acetate method (Gietz & Schiestl, 1995 ). To test for the restoration of iron uptake, SL103 transformants were grown on synthetic glucose medium (without histidine) (YNB without amino acids; Difco) buffered with 50 mM Mes/Tris (pH 5·2), and with 2·5 mM Ferrozine (Sigma), with or without 350 µM ferrous ammonium sulfate for 35 days at 30 °C. To test for the reversal of lysine and methionine auxotrophy, the SOD1-deficient SL133 transformants were grown on synthetic glucose medium without lysine and on synthetic glucose medium without methionine, under aerobic and anaerobic conditions. Anaerobic conditions were generated with the Anaerocult A system (Merck). To test for reversal of paraquat toxicity, SL133 transformants were grown on synthetic glucose medium containing 50 µM paraquat. Growth of the different transformants was monitored by drop tests, where serial dilutions of yeast cultures were spotted onto agar plates (Fig. 2).
|
Metal-dependent gene expression.
For copper-dependent expression analysis of tahA, the dikaryon TV-1 was initially grown on medium without extra copper for 4 days. For induction with different copper concentrations, 0, 2, 5, 10, 100 or 500 µM CuSO4 was added to each culture flask. To achieve extreme copper starvation, 100 µM BCS was added to one flask one day before induction (negative control). As a positive control, 200 µM CuSO4 was added to a culture containing 100 µM BCS. After induction (1·5 h) the cells were harvested and frozen in liquid nitrogen, followed by total RNA preparation (Wahl et al., 1987 ). S1 analyses were performed as described above. To test lower copper concentrations, the strains F6, harbouring allele tahA-1, and SP4, harbouring allele tahA-2, were used. Culture conditions were as above, but the copper concentrations were 10-fold lower (0, 0·1, 0·25, 0·5, 1, 2·5, 5, 10, 25 or 100 µM). Two controls with either 50 µM BCS or 50 µM BCS+100 µM CuSO4 were included, and expression was measured using Northern blots.
Induction under iron-starvation conditions was tested by growing cells in minimal medium for 24 days and then adding 2·5 mM Ferrozine to the cultures. After 1·5 h, cells were harvested and frozen in liquid nitrogen, followed by preparation of RNA. DABA and paraquat induction were tested by adding either 40 µg DABA ml-1 or 100 µM paraquat to cultures growing in minimal medium. In each expression experiment, two independent parallel cultures were analysed; each experiment was repeated three times.
Identification and characterization of tahASequence comparisons between cytoplasmic copper chaperones from four different organisms, i.e. yeast Atx1p, nematode Cuc1p, human Hah1p and plant Cchp, revealed two short conserved regions, which were used as rough templates for designing the degenerate primers A and B. Using these primers, designed such that only those codons frequently used by T. versicolor were chosen (i.e. a high G+C content with preference for C or G over U or A), a 170 bp PCR tahA fragment was obtained with a Trametes cDNA library (as described in Methods). This partial sequence encoded a peptide that showed homology to other copper chaperones. The 5' and 3' ends of tahA were obtained in two parallel PCR experiments, where two gene-specific primers (either homologous to the 5' end or complementary to the 3' end of tahA) were combined individually with one of two vector backbone-specific primers (located either in the GAL1 promoter or in the ADH1 terminator) to yield two overlapping tahA sequences from which the full-length cDNA was obtained by a subsequent PCR.
Two slightly different full-length genomic tahA clones (GenBank AY166609 and AY166608) including their 5'-and 3'-regulatory sequences were obtained from a genomic Trametes phage library by using the 170 bp tahA fragment as a probe. Southern blot analysis with genomic DNA from dikaryotic (TV-1) and monokaryotic (F2, F6, SP4 and SP17) T. versicolor strains confirmed that there was a single copy of tahA per T. versicolor haploid genome and that the two different sequences were alleles (data not shown).
The two tahA alleles differ in nine nucleotides between the start codon ATG and the stop codon TGA, of which eight are located within (non-consensus) intron sequences. The nucleotide exchange in exon III (ACG to ACA) is conservative, as both codons code for threonine. Thus, both alleles, although different at the DNA level, code for identical polypeptides. The five introns are located in the same positions, as confirmed by comparing the genomic sequences with the cDNA sequences. The overall consensus of the 5' and 3' splice sites in tahA is 5'-GTRVKK------YAG-3', which fits well with the consensus described for filamentous fungi (Ballance, 1986 ). The size of the introns ranges from 57 to 66 nt and is typical for filamentous fungi. The translation initiation environment is ACC ATG. The nucleotide at position -3 is an A, which is in agreement with the findings of Kozak (1984) , who defined a consensus ATG environment for filamentous fungi. These sequences are presumably involved in the recognition of the correct AUG by the ribosome and are thought to play an important role in the efficiency of translation initiation in eukaryotes (Kozak, 1986 ). The G+C content of the coding region is 56·5%, which is also reflected in the codon usage.
The 7·9 kDa protein encoded by tahA is 56% identical and 76% similar to yeast Atx1p, 41% identical and 66% similar to plant Cch1p, and 43% identical and 63% similar to human Hah1p (data not shown). TahAp contains the conserved copper-binding motif MxCxxC (Lin & Culotta, 1995 ) near the N terminus, which plays a role in copper binding and is also found in the copper-transporting P-type ATPases Ccc2p from S. cerevisiae, Mnkp and Wndp from humans, and CopA from Enterococcus hirae. TahAp also contains the highly conserved sequence KTGK near the C terminus, which was shown to be important for copper trafficking in Atx1p (Portnoy et al., 1999 ; not shown).
Complementation of atx1 and sod1 mutant yeast strains
In yeast, Atx1p is involved in copper trafficking to the secretory pathway, where copper is inserted into the copper-dependent ferroxidase Fet3p, which is essential for the high-affinity iron uptake at the plasma membrane (Pufahl et al., 1997 ). Thus, an atx1 mutant is deficient in the high-affinity iron transport system and cannot take up iron from media containing the iron chelator Ferrozine (Lin et al., 1997 ). To test whether tahA could complement the copper-chaperoning function of ATX1 in yeast, we constitutively expressed the full-length tahA-1 cDNA in a yeast atx1 mutant. The tahA-1 cDNA was expressed under the control of the strong ADH1 promoter carried on a low-copy vector in the Δatx1 yeast strain SL103. Serial dilutions of transformants were made on Ferrozine-containing media with and without supplementary iron (Fig. 1). Transformants expressing either tahA or ATX1 were able to grow on Ferrozine in the absence of iron. Expression of either ATX1 or tahA-1 complemented the iron-deficient growth phenotype of the SL103 mutant. The growth of tahA- and ATX1-overexpressing cells was comparable (Fig. 1).
|
The copper chaperone gene ATX1 was originally isolated by complementation of a Δsod1 Δsod2 deletion mutant (Culotta et al., 1995 ) due to its anti-oxidant activity. We thus tested whether tahA could also rescue the growth defects of a Δsod1 Δsod2 mutant on paraquat-containing media or on lysine- or methionine-deficient media. The same expression constructs as in the previous complementation experiment (Fig. 1) were transformed into the sod deletion mutant SL133. Only transformants overexpressing either tahA-1 or ATX1 were able to grow aerobically on lysine- or methionine-deficient media (Fig. 2). A similar result was observed on media containing 50 µM of the redox-cycling drug paraquat (Fig. 2).
The anti-oxidant effect of tahA-1-overexpressing Δsod1 Δsod2 strains was abolished on media made copper-deficient with 50 µM of the copper chelator BCS, indicating that the ability of tahA to protect Δsod1 Δsod2 cells from oxygen toxicity is dependent on copper availability (Fig. 2). Interestingly, a mutant form of ATX1 (designated ATX1*), which has an amino acid substitution of Arg68 to Lys68, restored the high-affinity iron uptake to Δatx1 yeast, but not the aerobic methionine auxotrophy or the paraquat toxicity to Δsod1 Δsod2 yeast (compare Figs 1 and 4).
In summary, tahA fully restores ATX1 functions in yeast, i.e. copper chaperoning to the secretory pathway and protection against oxygen toxicity.
Sequence analysis of the tahA 5''-regulatory sequence
An insertion sequence (IS) of 425 bp was found in the tahA-2 allele. This IS is flanked by inverted repeats 29 nt in length. Another pair of inverted repeats, each 16 nt long, localized between positions 150 and 173 of the IS are not separated by any nucleotides (Fig. 3). Whether these inverted repeats induce secondary structure in the DNA, and thus might enhance transcription or recombination, remains to be determined. It was estimated by Southern hybridization that four to six copies of this IS are present per haploid nucleus (data not shown).
|
The IS is located 183 nt upstream of the transcription start site and 129 nt upstream of the putative TATA box. It does not have the potential to code for any polypeptide, but several sequences similar to yeast regulatory elements, i.e. GCN4, GCR1 and GAL4, are located within the IS. However, it remains to be elucidated whether any of these sequences has the potential to act as an upstream activating sequence. Several direct repeats were also found. No homology to known fungal ISs, transposons or enhancer elements has been identified. Unexpectedly, a FASTA search revealed a 197 nt overlap with 59·4% identity (63·6% ungapped) to the stealth virus, a double-stranded DNA virus that belongs to the group of Herpesviridae. The stealth virus has been reported to have a wide host range and is discussed as a natural vector in the transfer of genetic information between viral, bacterial and eukaryotic genomes (Martin, 1999 ).
The main transcription start site is located 116 nt upstream of the start codon ATG, as all independent cDNA clones isolated begin with the same nucleotide. The transcription start site resides in the middle of a pyrimidine-rich sequence, which is typical for genes of filamentous fungi. The main site for poly A addition occurs 111 nt downstream from the stop codon, behind a C. No sequences with homology to known 3'-terminal consensus sequences were found.
Apart from the 425 nt IS, the 5' regulatory sequences of the two tahA alleles differ in 67 out of 693 nt. Screening the 5'-non-coding region of tahA-1 for fungal or yeast upstream activating sequences, which bind regulatory proteins and consequently control the level of transcription, revealed four sequences at positions -385, -455, -710 and -763 (Fig. 4) that showed homology to the consensus sequence, HTHnnGCTGD, of metal-responsive elements (MREs) (Macreadie et al., 1994 ). This suggests that the expression of tahA might be controlled by the availability of metal ions, with copper being the most probable candidate since tahA possesses the copper-binding motif MxCxxC. The two MRE-like sequences closest to the transcription start site are mutated in allele tahA-2. Furthermore, one sequence with homology to the anti-oxidant-responsive element (ARE), with the consensus sequence RRTGACnnnGC, was found at position -536.
tahA expression
To find out whether tahA transcription is regulated by either metals or the toxic compound DABA, we performed S1-protection assays and Northern blot analysis. The dikaryon and both alleles of tahA (with and without IS) were tested under different copper and iron concentrations, and on DABA and paraquat. Fig. 5 shows that copper-dependent transcription of tahA in the dikaryon TV-1 is already fully induced at 2 µM copper. Transcription of tahA is clearly downregulated under copper starvation, where only 10% of fully induced levels are observed. Lower copper concentrations were tested with F6, harbouring the tahA-1 allele, and SP4, harbouring the tahA-2 allele, as described in Methods. Northern blot analysis of the RNA showed that tahA was induced at concentrations of 0·25 µM CuSO4 and repressed when no copper was available, i.e. by adding BCS (Fig. 6). The different alleles showed little difference in their copper regulation, except that the IS-containing allele (tahA-2) showed a basal transcription at copper concentrations from 0·1 to 1·0 µM and a 1·5-fold increase of signal at 2·5 µM copper, whereas the tahA-1 allele (without IS) had a basal induction from 0 to 10 µM copper and a twofold increase of signal at 25 µM copper (Fig. 6).
|
|
Iron starvation did not seem to have a significant effect on tahA transcription in T. versicolor, independent of allele type. Similarly, DABA and paraquat did not affect tahA transcription, as determined by Northern blots (data not shown). Laccases contain four copper ions per molecule, and not only are regarded as potential pathogenic factors produced by fungi but are also of great interest in biotechnology, particularly since they are capable of oxidizing a wide variety of phenolic compounds. For example, they may be used in chlorine-free paper bleaching processes (Call & Mücke, 1997 ), detoxification of xenobiotic compounds, organic syntheses (Sariaslani, 1989 ; Rosenau et al., 1996 ), dye bleaching or binding of wood composites (Felby et al., 1997 ). In T. versicolor, Aspergillus nidulans, S. cerevisiae and Pichia pastoris, the formation of (functional) laccases depends on elevated copper concentrations in the medium (our observations). However in general, almost nothing is known about the copper-homeostasis factors that participate in the trafficking of copper to laccases in higher fungi.
We identified two genomic alleles of a gene called tahA from T. versicolor that encodes a polypeptide of 7·9 kDa. The TahA protein displays homology to copper chaperones from other organisms, including a metal-binding motif, MxCxxC, which is typical for diverse metal-binding proteins. Moreover, TahA proved not only a structural but also a functional homologue of ATX1, since expression of tahA cDNA could both complement the growth defect of Δatx1 yeast mutants on iron-limiting media and protect Δsod1 Δsod2 yeast mutants from oxygen toxicity. Interestingly, a chance point mutation of ATX1 (ATX1*; amino acid substitution Arg68 to Lys68), although in a non-conserved region of Atx1, impairs the SOD-like activity of Atx1. In other words, ATX1* restored high-affinity iron uptake to Δatx1 yeast, but not the aerobic methionine auxotrophy or the paraquat toxicity to Δsod1 Δsod2 yeast, indicating that the anti-oxidant function of the protein but not its copper chaperone function is impaired.
Since TahA can replace Atx1p in high-affinity iron transport, TahA can probably interact with Ccc2p, resulting in transport of copper into the lumen of the post-Golgi vesicles of yeast cells. In fact, it was shown (A. Uldschmid & K. Marbach, unpublished data) that T. versicolor expresses a gene homologous to CCC2. Thus, it is very likely that the transport of copper to laccase uses this copper chaperonecopper ATPase route in T. versicolor.
We observed that tahA in T. versicolor is moderately upregulated when copper is present (>0·25 µM) and downregulated when no copper is available (addition of BCS). In the 5'-regulatory region of tahA, we found four sequences with similarity to metal-responsive elements. Since the gene regulation between S. cerevisiae and basidiomycetes is probably quite different, we did not expect to find any homology to S. cerevisiae Ace1p upstream activating sequence sites. Indeed, we were astonished to find sequences that not only correlated with the S. cerevisiae consensus but were also located upstream of the MT gene of Neurospora crassa (Munger et al., 1985 ).
These four putative copper-sensing sequences were compared with the consensus of the S. cerevisiae Ace1p binding sites in CUP1 and SOD1 (Thiele & Hamer, 1986 ; Gralla et al., 1991 ), of the Candida glabrata Amt1 binding sites in MTI and MTII (Zhou et al., 1992 ) and of the Schizosaccharomyces pombe Cuf1 binding site in ctr4 (Beaudoin & Labbé, 2001 ). The similarities of the sequences suggest that they are likely candidate target sequences for a copper-sensing transcriptional activator or repressor controlling the expression of copper-regulated genes. However, it remains to be elucidated by further experiments whether any or all of these putative copper-sensing sequences of the tahA promoter are indeed functional. The fact that the sequences were similar to Ace1 upstream activating sequence provides a starting point for further analyses of the relevant sites and factors involved in tah1 induction.
Transcriptional regulation of ATX1 in yeast is not influenced by copper but is influenced by iron and oxygen (Lin & Culotta, 1995 ). In contrast, tahA is not regulated by iron in T. versicolor but by copper. This difference might be explained by the fact that basidiomycetes are strictly aerobic fungi, in contrast to yeasts, which also grow via fermentation. It is thought that basidiomycetes take up iron mainly via siderophores, again in contrast to yeasts, where iron uptake is accomplished via the Fet3pFtr1 complex (and also non-self-made siderophores when present). In Arabidopsis thaliana, however, the copper chaperone CCH was shown to be downregulated by copper treatment in contrast to metallothionein (Himelblau et al., 1998 ), thus showing a different regulation compared to T. versicolor and yeasts.
It is not known whether Trametes uses a Fet3 protein for iron uptake. However, since it has been demonstrated that the basidiomycete Ustilago spaerogena (Eckert & Emery, 1983 ) possesses two different iron uptake systems one reductive and one non-reductive (i.e. via siderophores) it is very likely that Trametes also contains a Fet3 protein, although we have, as yet, been unable to detect any sequence homologues in extensive cDNA library screening (not shown). Regulation of ATX1 and FET3 by iron makes sense in yeast, but in Trametes the structural homologues of yeast Fet3p are apparently the laccases, secreted proteins that require copper. Even if Fet3p should prove to be present, it has been shown that Trametes cultures produce five to six different laccase isoenzymes that can be secreted in very high quantities (i.e. between 0·1 and 1 mg l-1; Yaver & Golightly, 1996 ; Yaver et al., 1996 ). Thus, in Trametes it makes sense that the laccases are primarily provided with copper by the TahAp-encoding gene tahA. Further studies of tahA and a better understanding of copper-homeostasis factors in these organisms could reveal the basis for the hierarchy of copper distribution inside the cells (mitochondria cytoplasma Golgi), which is observed under copper-starvation conditions.
Finally, basidiomycetes are good candidates for the large-scale industrial production of technical enzymes that require co-factors such as copper and iron. Indeed, basidiomycetes are better producers of laccases than the usual sources that employ Aspergillus and Pichia systems, although the reason for this is currently unknown. In addition to their many known and potential uses in biotechnology, discussed above, the laccases are involved in a wide variety of different cellular reactions, for example, detoxification of toxic compounds, morphogenesis and melanin formation. A better understanding of copper-homeostasis factors, copper-chaperone routes and copper trafficking in these higher fungi could help to generate strains that are better laccase producers suited for large-scale laccase production.
This work was supported financially by the Consortium für elektrochemische Industrie, München, Germany. We thank Dr Rupert Pfaller from the Consortium für elektrochemische Industrie, München, for his very helpful cooperation. We warmly thank Valeria Culotta for providing the Δatx1 yeast strain and the Δsod knock-out strains SL103 and SL13 used in the complementation assays.References
Beaudoin, J. & Labbé, S. (2001). The fission yeast copper-sensing transcription factor Cuf1 regulates the copper transporter gene expression through an Ace1/Amt1-like recognition sequence. J Biol Chem 276, 15472-15480.
Call, H. P. & Mücke, I. (1997). History, overview and applications of mediated lignolytic systems, especially laccase-mediator-systems (Lignozym®-process). J Biotechnol 53, 163-202.
Church, G. M. & Gilbert, W. (1984). Genomic sequencing. Proc Natl Acad Sci USA 81, 1991-1995.
Culotta, V. C., Joh, H. D., Lin, S. J., Slekar, K. H. & Strain, J. A. (1995). Physiological role for Saccharomyces cerevisiae copper/zinc superoxide dismutase in copper buffering. J Biol Chem 270, 29991-29997.
Eckert, D. J. & Emery, T. (1983). Iron uptake from ferrichrome A and iron citrate in Ustilago sphaerogena. J Bacteriol 155, 616-622.
Felby, C., Pedersen, L. S. & Nielsen, B. R. (1997). Enhanced auto adhesion of wood fibers using phenol oxidases. Holzforschung 51, 281-286.
Feldmann, H., Driller, L., Meier, B., Mages, G., Kellermann, J. & Winnacker, E. L. (1996). HDF2, the second subunit of the Ku homologue from Saccharomyces cerevisiae. J Biol Chem 271, 27765-27769.
Gietz, R. D. & Schiestl, R. H. (1995). Transforming yeast with DNA. Methods Mol Cell Biol 5, 255-269.
Gralla, E. B, Thiele, D. J, Silar, P. & Valentine, J. S. (1991). ACE1, a copper-dependent transcription factor, activates expression of the yeast copper, zinc superoxide dismutase gene. Proc Natl Acad Sci USA 88, 8558-8562.
Halliwell, B. & Gutteridge, J. M. C. (1984). Oxygen toxicity, oxygen radicals, transition metals and disease. Biochem J 219, 1-14.[Medline]
Himelblau, E., Mira, H., Lin, S. J., Culotta, V. C., Penarrubia, L. & Amasino, R. M. (1998). Identification of a functional homolog of the yeast copper homeostasis gene ATX1 from Arabidopsis. Plant Physiol 117, 1227-1234.
Hirayama, T., Kieber, J. J., Hirayama, N. & 7 other authors (1999). RESPONSIVE-TO-ANTAGONIST1, a Menkes/Wilson disease-related copper transporter, is required for ethylene signaling in Arabidopsis. Cell 97, 383393.[Medline]
Hung, I. H., Suzuki, M., Yamaguchi, Y., Yuan, D. S., Klausner, R. D. & Gitlin, J. D. (1997). Biochemical characterization of the Wilson disease protein and functional expression in the yeast Saccharomyces cerevisiae. J Biol Chem 272, 21461-21466.
Klomp, L. W., Lin, S. J., Yuan, D. S., Klausner, R. D., Culotta, V. C. & Gitlin, J. D. (1997). Identification and functional expression of HAH1, a novel human gene involved in copper homeostasis. J Biol Chem 272, 9221-9226.
Kozak, M. (1984). Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res 12, 857-872.
Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiation codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292.[Medline]
Lin, S. J. & Culotta, V. C. (1995). The ATX1 gene of Saccharomyces cerevisiae encodes a small metal homeostasis factor that protects cells against reactive oxygen toxicity. Proc Natl Acad Sci USA 92, 3784-3788.
Lin, S. J., Pufahl, R. A., Dancis, A., OHalloran, T. V. & Culotta, V. C. (1997). A role for the Saccharomyces cerevisiae ATX1 gene in copper trafficking and iron transport. J Biol Chem 272, 9215-9220.
Logemann, J., Schell, J. & Willmitzer, L. (1987). Improved method for the isolation of RNA from plant tissues. Anal Biochem 163, 16-20.[Medline]
Löw, R. & Rausch, T. (1994). Sensitive, nonradioactive northern blots using alkaline transfer of total RNA and PCR-amplified biotinylated probes. BioTechniques 17, 1026-1030.[Medline]
Macreadie, I. G., Sewell, A. K. & Winge, D. R. (1994). Metal ion resistance and the role of metallothionein in yeast. In Metal Ions in Fungi. Mycology Series , pp. 279-310. Edited by G. Winkelmann & D. R. Winge. New York:Marcel Dekker.
Martin, W. J. (1999). Bacteria-related sequences in a simian cytomegalovirus-derived stealth virus culture. Exp Mol Pathol 66, 8-14.[Medline]
Munger, K., German, U. A. & Lerch, K. (1985). Isolation and structural organization of the Neurospora crassa copper metallothionein gene. EMBO J 4, 2665-2668.[Medline]
OHalloran, T. V. & Culotta, V. C. (2000). Metallochaperones, an intracellular shuttle service for metal ions. J Biol Chem 275, 25057-25060.
Payne, A. S. & Gitlin, J. D. (1998). Functional expression of the Menkes disease protein reveals common biochemical mechanisms among the copper-transporting P-type ATPases. J Biol Chem 273, 3765-3770.
Portnoy, M. E., Rosenzweig, A. C., Rae, T., Huffman, D. L., OHalloran, T. V. & Culotta, V. C. (1999). Structurefunction analyses of the ATX1 metallochaperone. J Biol Chem 274, 15041-15045.
Predki, P. F. & Sakar, B. (1992). Effect of replacement of zinc finger zinc on estrogen receptor DNA interactions. J Biol Chem 267, 5842-5846.
Pufahl, R. A., Singer, C. P., Peariso, K. L., Lin, S. J., Schmidt, P. J., Fahrni, C. J., Culotta, V. C., Penner-Hahn, J. E. & OHalloran, T. V. (1997). Metal ion chaperone function of the soluble Cu(I) receptor Atx1. Science 278, 853-856.
Rae, T. D., Schmidt, P. J., Pufahl, R. A., Culotta, V. C. & OHalloran, T. V. (1999). Undetectable intracellular free copper: the requirement of a copper chaperone for superoxide dismutase. Science 284, 805-808.
Rosenau, T., Potthast, A., Chen, C. L. & Gratzl, J. S. (1996). A mild, simple and general procedure for the oxidation of benzyl alcohols to benzaldehydes. Synth Commun 26, 315-320.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sariaslani, F. S. (1989). Microbial enzymes for oxidation of organic molecules. Crit Rev Biotechnol 9, 171-257.[Medline]
Sikorski, R. S. & Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.
Tamai, K. T., Gralla, E. B., Ellerby, L. M., Valentine, J. S. & Thiele, D. J. (1993). Yeast and mammalian metallothioneins functionally substitute for yeast copperzinc superoxide dismutase. Proc Natl Acad Sci USA 90, 8013-8017.
Thiele, D. J. & Hamer, D. H. (1986). Tandemly duplicated upstream control sequences mediate copper-induced transcription of the Saccharomyces cerevisiae copper-metallothionein gene. Mol Cell Biol 6, 1158-1163.
Wahl, G. M., Meinkoth, J. L. & Kimmel, A. R. (1987). Northern and Southern blots. Methods Enzymol 152, 572-581.[Medline]
Wakabayashi, T., Nakamura, N., Sambongi, Y., Wada, Y., Oka, T. & Futai, M. (1998). Identification of the copper chaperone, CUC-1, in Caenorhabditis elegans: tissue specific co-expression with the copper transporting ATPase, CUA-1. FEBS Lett 440, 141-146.[Medline]
Weaver, R. F. & Weissmann, C. (1979). Mapping of RNA by a modification of the BerkSharp procedure: the 5' termini of 15 S ß-globin mRNA precursor and mature 10 s ß-globin mRNA have identical map coordinates. Nucleic Acids Res 7, 1175-1193.
Yaver, D.S. & Golightly, E. J. (1996). Cloning and characterization of three laccase genes from the white-rot basidiomycete Trametes villosa: genomic organization of the laccase gene family. Gene 181, 95-102.[Medline]
Yaver, D. S, Xu, F., Golightly, E. J. & 7 other authors (1996). Purification, characterization, molecular cloning, and expression of two laccase genes from the white rot basidiomycete Trametes villosa. Appl Environ Microbiol 62, 834841.[Abstract]
Zhou, P., Szczypka, M. S., Sosinowski, T. & Thiele, D. J. (1992). Expression of a yeast metallothionein gene family is activated by a single metalloregulatory transcription factor. Mol Cell Biol 12, 3766-3775.
Received 10 May 2002; revised 17 June 2002; accepted 5 September 2002.