Research Article

Isolation and characterization of 14 additional genes specifying the anaerobic biosynthesis of cobalamin (vitamin B12) in Propionibacterium freudenreichii (P. shermanii)

Microbiology 2002; 148(6):1845

PubMed

Abstract

A search for genes encoding enzymes involved in cobalamin (vitamin B12) production in the commercially important organism Propionibacterium freudenreichii (P. shermanii) has resulted in the isolation of an additional 14 genes encoding enzymes responsible for 17 steps of the anaerobic B12 pathway in this organism. All of the genes believed to be necessary for the biosynthesis of adenosylcobinamide from uroporphyrinogen III have now been isolated except two (cbiA and an as yet unidentified gene encoding cobalt reductase). Most of the genes are contained in two divergent operons, one of which, in turn, is closely linked to the operon encoding the B12-dependent enzyme methylmalonyl-CoA mutase. The close linkage of the three genes encoding the subunits of transcarboxylase to the hemYHBXRL gene cluster is reported. The functions of the P. freudenreichii B12 pathway genes are discussed, and a mechanism for the regulation of cobalamin and propionic acid production by oxygen in this organism is proposed.

Keywords: hem operon, methylmalonyl-CoA mutase, transcarboxylase, metabolic regulation, genetic linkage

The GenBank accession numbers for the sequences reported in this paper are AY033235, AY033236, U13043 and U51164.

a Present address: Protein Engineering, Iogen Corp., 400 Hunt Club Road, Ontario, Ottawa, Canada K1V 1C1.

Vitamin B12 is produced commercially by two organisms, Pseudomonas denitrificans and Propionibacterium freudenreichii (P. shermanii) (Vorobjeva, 2000 ). The genes that determine the aerobic biosynthetic route to B12 in Ps. denitrificans were isolated by complementation of mutants, and most of the encoded enzymes have been assigned functions (Table 1) (for reviews see Blanche et al., 1995 ; Roessner et al., 2001 ). Genes for the biosynthesis of B12 via an alternative anaerobic pathway have been isolated and sequenced from other bacteria having systems amenable to genetic manipulation such as Salmonella typhimurium (Roth et al., 1993 ) and Bacillus megaterium (Raux et al., 1998 ). Recently, B12 biosynthesis genes of both the aerobic and anaerobic pathways have been revealed in several other Eubacteria and Archaea as the result of genomic sequencing projects and have been annotated on the basis of sequence similarities.


Table 1. Reactions and genes required for the transformation of 5-aminolaevulinic acid (ALA) into adenosylcobalamin


Prior to the age of recombinant DNA technology, the majority of research on cobalamin biosynthesis was undertaken with extracts of P. freudenreichii (see, for example, Battersby, 1979 ; Scott, 1979 ) with little attention paid to molecular genetics or control and regulation of the pathway. Even two of the more recent studies (Scott et al., 1996 ; Wang et al., 1996 ) on the biosynthesis of the vitamin in P. freudenreichii were performed with little knowledge of the genetics of this organism. Indeed, only a few genes have so far been isolated from P. freudenreichii, including four, hemL, hemB, cobA and cbiO, from the early part of the B12 pathway (Hashimoto et al., 1996 ; Sattler et al., 1995 ). We report here the isolation and sequencing of an additional 14 P. freudenreichii genes homologous to 17 genes encoding proteins involved in vitamin B12 biosynthesis in S. typhimurium and B. megaterium, describe their positions relative to other known P. freudenreichii genes, and demonstrate the activity of two of them through complementation of mutants. This information will not only allow engineered overproduction of the cobalamin biosynthetic enzymes and the deduction of pathway intermediates, but will also permit the design of experiments to monitor the function of the pathway enzymes under a range of different physiological conditions.

Note on nomenclature. Since it has been demonstrated that Ps. denitrificans requires O2 for the synthesis of B12 and that S. typhimurium synthesizes B12 only under strict anaerobic conditions, the nomenclatures assigned to the Ps. denitrificans genes (cobAV) and the S. typhimurium genes (cysG, cbiAQ and cobSTU) have become associated with the aerobic and anaerobic pathways to B12, respectively (see Table 1). P. freudenreichii synthesizes B12 anaerobically; therefore the S. typhimurium nomenclature will be used herein as much as possible. Unfortunately, no convention was followed when naming the genes from different organisms, with result that many of the genes encoding the same enzyme have different names whereas some of the genes with the same name encode different enzymes in the two organisms (e.g. cobA, cobB, cobC, cobD, cobS, cobT, cobU). Since two P. freudenreichii cobA genes are described in this manuscript, they will be distinguished by using cobA for the gene encoding uroporphyrinogen III methyltransferase, based on prior usage (Sattler et al., 1995 ), and cobAadoT for the gene encoding ATP:corrinoid adenosyltransferase.

Strains and plasmids.
These are listed in Table 2.


Table 2. Plasmids and strains used in this study


Isolation, sequencing and subcloning of B12 biosynthesis genes.
The cobalamin biosynthetic genes were isolated from a genomic P. freudenreichii library contained within bacteriophage lambda EMBL 4 previously used for isolation of the gene encoding pyrophosphate-dependent phosphofructokinase (Ladror et al., 1991 ). EMBL 4 clones containing the cobalamin biosynthetic genes were identified by screening the library with two labelled probes (cbiT probe and cbiP probe) that were generated by PCR amplification of portions of the P. freudenreichii cbiT and cbiP genes using P. freudenreichii genomic DNA as template and primers derived from conserved DNA sequences found within the similar genes of S. typhimurium and Ps. denitrificans. An additional probe was generated by PCR amplification of a portion of the P. freudenreichii cbiO gene using primers derived from the P. freudenreichii cbiO gene sequence, which was previously reported to be contiguous with cobA (Sattler et al., 1995 ). The PCR products were labelled with the Genius I nonradioactive labelling kit from Boehringer Mannheim. Screening and subcloning of restriction fragments of the phage inserts into pBluescript for sequencing were performed using standard techniques (Maniatis et al., 1982 ). Sequences were determined using an ABI model 373A sequencer and the dideoxy termination method (Sanger et al., 1977 ) with fluorescent dye detection. Sequence analysis was performed with software provided by the Genetics Computer Group, and protein similarities were determined using the BLAST program provided by the National Center for Biotechnology Information.

For SDS-PAGE analysis of the gene products of the cbiXcysGB and cbiEGH genes described herein (Fig. 1), the genes were amplified by PCR providing optimal Escherichia coli translational signals and inserted into expression vectors as previously described (Roessner et al., 1995 ). The sequence of the cbiXcysGB forward primer was: CCCGGGGTCGACAAGCTTAGGAATTTAAAATGACTGATCTCGTCCC-ACTGGTCATTGCC, providing a 5' HindIII site (underlined), a ribosome-binding site (italics) and codons for the first 10 amino acids of the protein including the ATG start codon. The sequence of the cbiXcysGB reverse primer was CCCGGGTCTAGAGGATCCTTAGACCTGGAGCGCC-TTGAGGAGCTCGTCGCG, providing a 3' BamHI site (underlined), a stop anticodon (TTA) and anticodons for the last 10 amino acids of the protein. The PCR product was cut with HindIII and BamHI and ligated into pUC19 to give pCR487. The sequence of the cbiEGH forward primer was GGTACCCGGGGATCCAGGAGGAATTTAAAATGATTCGCGTACATGGTTTCCTCGGCGGC, providing a 5' BamHI site (underlined), a ribosome-binding site (italics) and codons for the first 10 amino acids of the protein including the ATG start codon. The sequence of the cbiEGH reverse primer was CGCGCAAGCTTTTAGTCATGGGAATCCTCCTGGGTGGGGACATCGGAGCC, providing a 3' HindIII site (underlined), a stop anticodon (TTA) and anticodons for the last 12 amino acids of the protein. The PCR product was cut with BamHI and HindIII and ligated into pET23a(+) to form pCR571.



(14K):

Fig. 1. The structure of four fragments of P. freudenreichii DNA containing vitamin B12 biosynthetic genes. The arrows indicate regions of previously unreported sequence which have been assigned the following GenBank accession numbers: (a) U13043; (b) AY033236; (c) AY033235; (d) derived from U51164 and D85417 (Hashimoto et al., 1996 ).

For complementation studies, the cbiXcysGB PCR product was also inserted in front of the P. freudenreichii cobA gene in pISA417 (Sattler et al., 1995 ) to give pCR488. Similarly, the P. freudenreichii cbiL gene was inserted into pKK223.3 for complementation studies of the cbiL mutants AR3711 and AR3717 as previously described (Raux et al., 1996 ). Plasmids pCR487 and pCR571 were transformed into E. coli strains TB1 and BL21DE3, respectively, to allow protein overproduction of CbiXCysGB and CbiEGH. The cells were grown at 37 °C in LB medium containing 50 µg ampicillin ml-1 to OD600 0·8, induced by the addition of IPTG to 1·0 mM, and incubated at 37 °C for an additional 16 h. SDS-PAGE analysis was performed as described previously (Roessner et al., 1995 ). Isolation and sequence of P. freudenreichii vitamin B12 biosynthetic genes
Screening of a P. freudenreichii genomic library in bacteriophage lambda resulted in isolation of four phages: one that hybridized with the cbiO probe, one that hybridized with the cbiP probe, and two that hybridized with the cbiT probe. Sequencing of the inserts of these phages has revealed a number of ORFs with a high degree of similarity to known cbi genes. These genes appear to be clustered into three discrete regions of the genome as described below and shown in Fig. 1(ac). In total we have now identified 16 genes including cobA, cbiB, C, D, EGH, F, J, L, M, N, O, P, Q, T, cbiXcysGB and cobAadoT. With the exception that cbiA (encoding cobyrinic acid a,c-diamide synthase) and an unidentified gene encoding a cobalt reductase are yet to be found, these genes encode all of the enzymes believed to be responsible for the transformation of uroporphyrinogen III into adenosylcobinamide in P. freudenreichii (Fig. 2).



(35K):

Fig. 2. Proposed pathway for the conversion of uroporphyrinogen III to adenosylcobinamide in P. freudenreichii. (a) The pathway from uroporphyrinogen III to cobyrinic acid. (b) The pathway from cobyrinic acid to adenosylcobinamide.

P. freudenreichii has a cobalt transport system similar to that of S. typhimurium
We previously reported the isolation and sequence of the P. freudenreichii cobA gene (Sattler et al., 1995 ) and the presence of the cbiO gene at its 5' end. Extension of this sequence 5' to cbiO has now revealed the presence of the cbiM, cbiN and cbiQ genes (Fig. 1a). The homologues of these genes in S. typhimurium are found in a B12 operon and, as discussed by Roth et al. (1993) , are believed to encode a cobalt transport system. The association of these genes with cobA, encoding uroporphyrinogen III methyltransferase, an enzyme essential for the biosynthesis of both sirohaem (see below) and B12 in P. freudenreichii, suggests that this operon may be specific for B12 biosynthesis and that another cobA or cysG locus may exist for sirohaem synthesis.

The genes necessary for the conversion of precorrin 2 to cobyrinic acid in P. freudenreichii are contained in two convergent operons
In Ps. denitrificans the eight genes required for the aerobic conversion of precorrin 2 to hydrogenobyrinic acid (cobFM) are contiguous (Crouzet et al., 1990 ). Similarly, the genes of S. typhimurium and B. megaterium believed to be necessary for the anaerobic conversion of cobalt-precorrin 2 to cobyrinic acid are found in large B12 operons (Roth et al., 1993 ; Raux et al., 1998 ). Within an 11·6 kb fragment of P. freudenreichii DNA (Fig. 1b), we found genes homologous to 10 different genes of S. typhimurium (cysGB, cibC, cbiD, cbiE, cbiF, cbiG, cbiH, cbiJ, cbiL and cbiT) and to one gene of B. megaterium (cbiX). However, since some of the genes are combined into a single larger gene in P. freudenreichii, the two operons encode only eight proteins (see Fig. 1b and discussed below).

CysG has been proposed to be a multifunctional enzyme for the synthesis of sirohaem in E. coli and S. typhimurium (Spencer et al., 1993 ; Warren et al., 1994 ). The C-terminal domain of CysG (CysGA) is a methyltransferase that catalyses the attachment of the first two methyl groups to uroporphyrinogen III to form precorrin 2, whereas the N-terminal domain (CysGB) is believed to catalyse the NADP-dependent dehydrogenation of the macrocycle and iron chelation to give sirohaem. Genetic evidence has been provided (Fazzio & Roth, 1996 ; Raux et al., 1998 ) that, in S. typhimurium, CysG may also catalyse not only the bismethylation of uroporphyrinogen III but also the insertion of cobalt into precorrin 2 (Fig. 2a) to give cobalt-precorrin 2, an intermediate unique to the anaerobic vitamin B12 pathway (cobalt insertion occurs at a much later stage in the aerobic pathway into hydrogenobyrinic acid a,c-diamide to form cobyrinic acid a,c-diamide, the structure of which is shown in Fig. 2b). However, it has also been demonstrated that S. typhimurium has an additional gene, cbiK, that can substitute for cysGB (Raux et al., 1997 ) and may encode the actual cobaltochelatase. A gene encoding uroporphyrinogen III methyltransferase was previously isolated from P. freudenreichii (Sattler et al., 1995 ) which, in contrast to cysG, contained no dehydrogenase or chelatase (cysGB) encoding region. It was therefore called cobA rather than cysG after the similar gene in Ps. denitrificans. The P. freudenreichii homologue to cysGB is found within a gene whose product is similar not only to cysGB but also to cbiX found in B. megaterium (Raux et al., 1998 ). The P. freudenreichii gene encodes a protein of 414 amino acids, the C-terminal 150 of which are similar (32% identity, 50% similarity) to CysGB, and the N-terminal 264 of which are similar to CbiX. Further evidence that cbiXcysGB is a single gene was provided by SDS-PAGE analysis of the overproduced protein which showed (Fig. 3) that its molecular mass is consistent with the value (44·3 kDa) calculated from the amino acid sequence. In an experiment similar to that reported previously for the analysis of S. typhimurium cbiK gene (Raux et al., 1997 ), plasmids for the expression of the P. freudenreichii cobA and cbiXcysGB genes, either by themselves or together, were constructed and tested for the ability to complement an E. coli cysG deletion mutant (CB302Δa). The mutant was complemented by a plasmid (pCR488) bearing both genes but not by a plasmid bearing either cobA (pISA417) or cbiXcysGB (pCR487) by itself. Based on these results, we propose that cbiXcysGB encodes dehydrogenase and/or chelatase activities necessary for cobalamin biosynthesis in P. freudenreichii, although the precise functions of the two domains have not yet been firmly established.



(138K):

Fig. 3. SDS-PAGE analysis of the gene products of the cbiXcysGB and cbiEGH genes of P. freudenreichii. Lane 1, TB1(pUC19). Lane 2, TB1(pUC19:cbiXcysGB); the overexpressed protein is indicated by the arrow, predicted molecular mass 44·3 kDa. Lane 3, BL21DE3(pET23a); the arrow indicates endogenous ß-galactosidase, molecular mass 107 kDa. Lane 4, BL21DE3(pET23a:cbiEGH); the overexpressed protein is indicated by the arrow, predicted molecular mass 91·4 kDa. Lane 5, molecular mass markers. From the top: 66, 45, 36, 29 and 24 kDa.

The functions of the enzymes encoded by the other seven genes have been deduced from homology with the corresponding enzymes from Ps. denitrificans and S. typhimurium (Table 1). Based on its similarity to CobI, CbiL has been predicted to be the C-20 methylase in S. typhimurium and, thus, P. freudenreichii. The S. typhimurium enzyme has been shown to have methyltransferase activity (Roessner et al., 1992 ) and is believed to methylate C-20 of cobalt-precorrin 2 to yield cobalt-precorrin 3 (Fig. 2a). A plasmid, pERcbiL, bearing the P. freudenreichii cbiL gene was able to complement two different cbiL mutants (AR3711 and AR3717) of an engineered E. coli strain that synthesizes cobinamide using the S. typhimurium cbi genes. The homologous gene, cobI, from the aerobic Ps. denitrificans pathway does not complement the same mutants (Raux et al., 1996 ), which is most likely a reflection of the difference in the substrates for the two encoded enzymes (precorrin 2 for CobI and cobalt precorrin 2 for CbiL).

In S. typhimurium, cbiE, cbiG and cbiH are all individual genes, but in P. freudenreichii their homologues are found in a single ORF (Fig. 1b). Evidence that cbiEGH is a single gene was also provided by SDS-PAGE analysis of the overproduced protein, which showed (Fig. 3) that its molecular mass is consistent with the value (91·4 kDa) calculated from the amino acid sequence. In Synechocystis sp., cbiG and cbiH are also apparently found in one gene (Kaneko et al., 1996 ). CbiH of S. typhimurium has recently been shown to be responsible for C-17 methylation of cobalt-precorrin 3 (Fig. 2a), leading to formation of the ring-contracted, lactonized intermediate, cobalt-precorrin 4 (Santander et al., 1997 ). Although the function of CbiG is unknown, the occurrence of CbiG and CbiH as a single enzyme in two different organisms suggests that CbiG may operate either immediately before or immediately after CbiH. However, the association of CbiE with CbiG and CbiH in P. freudenreichii is not as easily rationalized since it is believed that, based on its similarity to CobL, CbiE catalyses the methylation of C-5 and C-15 but only after methylation of C-11 and C-1, extrusion of acetaldehyde, and reduction of the macrocycle (Fig. 2a). C-11 methylation is catalysed by CbiF (Roessner et al., 1992 ) but the enzyme responsible for C-1 methylation and extrusion of acetaldehyde has yet to be identified. The corresponding process (C-1 methylation and extrusion of acetic acid) in Ps. denitrificans is catalysed by CobF, for which no homologous enzyme exists in S. typhimurium. No gene corresponding to CobF was found within the P. freudenreichii operons reported here. In the anaerobic pathway, these steps are presumably carried out by one of the other methyltransferases, perhaps CbiF, or by CbiD as suggested by Raux et al. (1998) . On the basis of homology with the corresponding enzymes of Ps. denitrificans, CbiJ is responsible for the NADPH-dependent reduction of the C-18,19 double bond, CbiT catalyses decarboxylation of the C-12 acetate, and CbiC catalyses the final step in the biosynthesis of cobyrinic acid, migration of the methyl group at C-11 to C-12 (Fig. 2a).

Other B12 biosynthesis genes
In addition to the genes required for the conversion of uroporphyrinogen III to cobyrinic acid, we have isolated a fragment of P. freudenreichii DNA (Fig. 1c) bearing genes encoding enzymes similar to CbiB, CbiP, and CobAadoT of S. typhimurium (Roth et al., 1993 ; Suh & Escalante-Semerena, 1993 ) involved in the attachment of aminopropanol, amidation of the b, d, e, and g acetate and propionate side chains, and transfer of an adenosyl group to the cobalt metal ion (Fig. 2b). The CobA adenosyltransferase is also similar to BtuR of E. coli (Lundrigan & Kadner, 1989 ), responsible for adenosylation of imported B12. The P. freudenreichii genes for the biosynthesis of adenosylcobalamin from 5-aminolaevulinic acid that have not yet been isolated include the early-pathway genes hemC, hemD and cbiA, and the late-pathway genes cobU, cobS and cobT (see Table 1 for functions). In addition, the gene encoding the enzyme necessary for the reduction of cobalt(II) to cobalt(I) prior to adenosylation has not yet been determined in any organism.

Other P. freudenreichii genes (non-B12)
During our search for B12 biosynthesis genes, we rediscovered partial sequences for most of the P. freudenreichii genes previously isolated, which has allowed the positioning of these genes relative to the sequences described herein. Hashimoto et al. (1996) reported the isolation of an 8 kb fragment of DNA bearing the hemY, hemH, hemB (5-aminolaevulinic acid dehydratase) and hemL (glutamate-1-semialdehyde aminotransferase) genes and two additional, non-B12 biosynthesis genes encoding a probable membrane-associated antibiotic-resistance protein and its regulator. We extended this sequence in the 3' direction and discovered a portion of the gene encoding the 5S subunit of methylmalonyl-CoA transcarboxylase (Thornton et al., 1993a ). Since the genes encoding the 12S and 1·3S subunits of the transcarboxylase are contiguous with the 5S gene (Thornton et al., 1993b ), the structure of the 12 kb fragment of P. freudenreichii DNA bearing all of these genes may be deduced as shown in Fig. 1(d).

The 3' end of the fragment bearing most of the B12 biosynthesis genes (Fig. 1b) also harbours the araD and bcp genes encoding proteins similar to L-ribulose-5-phosphate 4-epimerase and bacterioferritin comigratory protein, respectively. Of particular interest, however, is the presence of another operon at the 5' end of this fragment, divergently transcribed from the B12 operon, containing the mutA and mutB genes that encode the two subunits of the adenosylcobalamin-dependent enzyme methylmalonyl-CoA mutase (Marsh et al., 1989 ). A similar arrangement of operons occurs in S. typhimurium (Roth et al., 1993 ), in which the major B12 operon is divergently transcribed from the operon encoding propanediol dehydratase, encoded by the pduC and pduD genes (Walter et al., 1997 ), which is also B12 dependent. In S. typhimurium, B12 is produced only anaerobically (Jeter et al., 1984 ) and production of the vitamin is also inhibited by exogenous B12. Both operons are positively regulated by the PocR protein (Bobik et al., 1992 ; Rondon & Escalante-Semerena, 1992 ), the gene for which lies between the two operons, and whose level is highest under anaerobic conditions in the presence of propanediol. Upstream from the B12 operon lies a B12 box, a short conserved sequence also found before the Ps. denitrificans cobP gene and the E. coli btuB gene (Roth et al., 1993 ). B12 has been shown to regulate the synthesis of BtuB by binding to the B12 box in the mRNA, thus interfering with ribosomal binding (Nou & Kadner, 2000 ).

By analogy with the regulatory system in S. typhimurium, it is interesting to suggest that the region between the divergently transcribed methylmalonyl-CoA mutase and B12 operons of P. freudenreichii described here (Fig. 1b) would be an ideal location for the observed inhibition of B12 production by exogenous B12 and of the inhibition of propionate and B12 production by oxygen (Quesada-Chanto et al., 1998 ; Vorobjeva, 2000 ). Methylmalonyl-CoA mutase is a key enzyme in the production of propionic acid (see Vorobjena, 2000, for a review of metabolic pathways in propionibacteria), and a decrease in the enzyme level in the presence of oxygen, by inhibiting synthesis either of the cofactor or of the apoenzyme, would result in decreased propionate levels. In the P. freudenreichii sequence reported here, there is a small ORF (Fig. 1b, orf1) between the first known gene (cbiL) of the B12 operon and the first gene of the methylmalonyl-CoA mutase operon (mutA). This ORF could encode a protein involved in the regulation of the two operons. The encoded protein, however, has no similarity to PocR or any other known protein. Within orf1, however, there is a 17 base sequence that is a close match to the B12 box sequence (Fig. 4) which may be responsible for regulation of cobalamin production by exogenous B12 in P. freudenreichii.



(14K):

Fig. 4. Homology between a proposed vitamin B12 binding consensus sequence and 17 bases found between the P. freudenreichii methylmalonyl-CoA mutase and vitamin B12 operons.
We thank R. G. Kemp for providing the P. freudenreichii genomic library in bacteriophage lambda EMBL 4, Chris Brooks for technical assistance, and Aventis (Romainville, France) and NIH for financial support through MERIT award no. 2 R01 DK32034-18 to A.I.S.

References

Baldwin, T. O., Berends, T., Bunch, T. A., Holtzman, T. F., Rausch, S. K., Shamansky, L. & Treat, M. L. (1984). Cloning of the luciferase structural genes from Vibrio harveyi and expression of bioluminescence in Escherichia coli. Biochemistry 23, 3663-3667.[Medline]

Battersby, A. R. (1979). Recent biosynthetic researches on vitamin B12. In Vitamin B12 , pp. 217-246. Edited by B. Zagalak & W. Friedrich. New York:Walter de Gruyter.

Blanche, F., Cameron, B., Crouzet, J., Debussche, L., Thibaut, D., Vuilhorgne, M., Leeper, F. J. & Battersby, A. R. (1995). Vitamin B12: how the problem of its biosynthesis was solved. Angew Chem Int Ed Engl 34, 383-411.

Bobik, T. A., Ailion, M. & Roth, J. R. (1992). A single regulatory gene integrates control of vitamin B12 synthesis and propanediol degradation. J Bacteriol 174, 2253-2266.[Abstract/Free Full Text]

Crouzet, J., Cameron, B., Cauchois, L., Blanche, F., Rigault, S., Rouyez, M.-C., Thibaut, D. & Debussche, L. (1990). Genetic and sequence analysis of an 8·7-kilobase Pseudomonas denitrificans fragment involved in transformation of precorrin-2 to cobyrinic acid. J Bacteriol 172, 5980-5990.[Abstract/Free Full Text]

Fazzio, T. G. & Roth, J. R. (1996). Evidence that the CysG protein catalyzes the first reaction specific to B12 synthesis in Salmonella typhimurium, insertion of cobalt. J Bacteriol 178, 6952-6959.[Abstract/Free Full Text]

Griffiths, L. A. & Cole, J. A. (1987). Lack of redox control of the anaerobically-induced nirB+ gene of Escherichia coli K-12. Arch Microbiol 147, 364-369.[Medline]

Hashimoto, Y., Yamashita, M. & Murooka, Y. (1996). The Propionibacterium freudenreichii hemYHBXRL gene cluster which encodes enzymes and a regulator involved in the biosynthetic pathway from glutamate to protoheme. Appl Microbiol Biotechnol 47, 385-392.

Jeter, R., Olivera, B. M. & Roth, J. R. (1984). Salmonella typhimurium synthesizes cobalamin (vitamin B12) de novo under anaerobic growth conditions. J Bacteriol 159, 206-216.[Abstract/Free Full Text]

Kaneko, T., Sato, S., Tanaka, A. & 21 other authors (1996). Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3, 109136.[Abstract]

Ladror, U. S., Gollapudi, L., Tripathi, R. L., Latshaw, S. P. & Kemp, R. G. (1991). Cloning, sequencing and expression of pyrophosphate-dependent phosphofructokinase from Propionibacterium freudenreichii. J Biol Chem 266, 16550-16555.[Abstract/Free Full Text]

Lundrigan, M. D. & Kadner, R. J. (1989). Altered cobalamin metabolism in Escherichia coli btuR mutants affects btuB gene regulation. J Bacteriol 171, 154-161.[Abstract/Free Full Text]

Maniatis, T., Fritsch, E. F. & Sambrook. J. (1982). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Marsh, E. N., McKie, M., Davis, N. K. & Leadlay, P. F. (1989). Cloning and structural characterization of the genes coding for adenosylcobalamin-dependent methylmalonyl-CoA mutase from Propionibacterium shermanii. Biochem J 260, 345-352.[Medline]

Nou, X. & Kadner, R. J. (2000). Adenosylcobalamin inhibits ribosome binding to btuB RNA. Proc Natl Acad Sci USA 97, 7190-7195.[Abstract/Free Full Text]

Quesada-Chanto, A., Silveira, M. M., Schmid-Meyer, A. C., Schroeder, A. G., DaCosta, J. P. C. L., Lopez, J., Carvalho-Jonas, M. F., Artolozaga, M. J. & Jonas, R. (1998). Effect of the oxygen supply on pattern of growth and corrinoid and organic acid production of Propionibacterium shermanii. Appl Microbiol Biotechnol 49, 732-736.

Raux, E., Lanois, A., Levillayer, F., Warren, M. J., Brody, E., Rambach, A. & Thermes, C. (1996). Salmonella typhimurium cobalamin (vitamin B12) biosynthetic genes: functional studies in S. typhimurium and Escherichia coli. J Bacteriol 178, 753-767.[Abstract/Free Full Text]

Raux, E., Beck, R., Levillayer, F., Rambach, A., Thermes, C. & Warren, M. J. (1997). A role for Salmonella typhimurium cbiK in cobalamin (vitamin B12) and siroheme biosynthesis. J Bacteriol 179, 3202-3212.[Abstract/Free Full Text]

Raux, E., Lanois, A., Warren, M. J., Rambach, A. & Thermes, C. (1998). Cobalamin (vitamin B12) biosynthesis: identification and characterization of a Bacillus megaterium cobI operon. Biochem J 335, 159-166.

Roessner, C. A., Warren, M. J., Santander, P. J., Atshaves, B. P., Ozaki, S., Stolowich, N. J., Iida, K. & Scott, A. I. (1992). Expression of 9 Salmonella typhimurium enzymes for cobinamide biosynthesis: identification of the 11-methyl and 20-methyl transferases of corrin biosynthesis. FEBS Lett 301, 73-78.[Medline]

Roessner, C. A., Spencer, J. B., Ozaki, S. & 7 other authors (1995). Overexpression in Escherichia coli of twelve vitamin B12 biosynthetic enzymes. Protein Expr Purif 6, 155163.[Medline]

Roessner, C. A., Santander, P. J. & Scott, A. I. (2001). Multiple biosynthetic pathways for vitamin B12: variations on a central theme. In Vitamins and Hormones , pp. 267-297. Edited by G. Litwack & T. Begley. San Diego, CA:Academic Press.

Rondon, M. R. & Escalante-Semerena, J. C. (1992). The poc locus is required for 1,2-propanediol-dependent transcription of the cobalamin biosynthetic (cob) and propanediol utilization (pdu) genes of Salmonella typhimurium. J Bacteriol 174, 2267-2272.[Abstract/Free Full Text]

Roth, J. R., Lawrence, G. J., Rubenfield, M., Kieffer-Higgens, S. & Church, G. M. (1993). Characterization of the cobalamin (vitamin B12) biosynthetic genes of Salmonella typhimurium. J Bacteriol 175, 3303-3316.[Abstract/Free Full Text]

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 3303-3316.

Santander, P. J., Roessner, C. A., Stolowich, N. J., Holderman, M. T. & Scott, A. I. (1997). How corrinoids are synthesized without oxygen: Natures first pathway to vitamin B12. Chem Biol 4, 659-666.[Medline]

Sattler, I., Roessner, C. A., Stolowich, N. J., Hardin, S. H., Harris-Haller, L. W., Yokubaitis, N. T., Murooka, Y., Hashimoto, Y. & Scott, A. I. (1995). Cloning, sequencing and expression of the uroporphyrinogen III methyltransferase cobA gene of Propionibacterium freudenreichii (shermanii). J Bacteriol 177, 1564-1569.[Abstract/Free Full Text]

Scott, A. I. (1979). Intermediary metabolism of cobyrinic acid. In Vitamin B12 , pp. 247-277. Edited by B. Zagalak & W. Friedrich. New York:Walter de Gruyter.

Scott, A. I., Stolowich, N. J., Wang, J., Gawatz, O., Fridrich, E. & Müller, G. (1996). Biosynthesis of vitamin B12: factor IV, a new intermediate in the anaerobic pathway. Proc Natl Acad Sci USA 93, 14316-14319.[Abstract/Free Full Text]

Spencer, J. B., Stolowich, N. J., Roessner, C. A. & Scott, A. I. (1993). The Escherichia coli cysG gene encodes the multifunctional enzyme, siroheme synthase. FEBS Lett 355, 57-60.

Suh, S. & Escalante-Semerena, J. C. (1993). Cloning, sequencing and overexpression of cobA which encodes ATP:corrinoid adenosyltransferase in Salmonella typhimurium. Gene 129, 93-97.[Medline]

Thornton, C. G., Kumar, G. K., Shenoy, B. C. & 7 other authors (1993a). Primary structure of the 5S subunit of transcarboxylase as deduced from the genomic DNA structure. FEBS Lett 330, 191196.[Medline]

Thornton, C. G., Kumar, G. K., Haase, F. C. & 7 other authors (1993b). Primary structure of the monomer of the 12S subunit of transcarboxylase as deduced from DNA and characterization of the product expressed in Escherichia coli. J Bacteriol 175, 53015308.[Abstract/Free Full Text]

Vorobjeva, L. I. (2000). Propionibacteria. Dordrecht: Kluwer.

Walter, D., Ailion, M. & Roth, J. (1997). Genetic characterization of the pdu operon: use of 1,2-propanediol in Salmonella typhimurium. J Bacteriol 179, 1013-1022.[Abstract/Free Full Text]

Wang, J., Stolowich, N. J., Santander, P. J., Park, J.-H. & Scott, A. I. (1996). Biosynthesis of vitamin B12: concerning the identity of the two-carbon fragment eliminated during anaerobic formation of cobyrinic acid. Proc Natl Acad Sci USA 93, 14320-14322.[Abstract/Free Full Text]

Warren, M. J., Bolt, E. L., Roessner, C. A., Scott, A. I., Spencer, J. B. & Woodcock, S. C. (1994). Gene dissection reveals that the E. coli cysG gene encodes a multifunctional enzyme. Biochem J 302, 837-844.

Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.[Medline]

Received 22 October 2001; revised 28 January 2002; accepted 27 February 2002.