GENES AND GENOMES

Genetic organization of an Acinetobacter baumannii chromosomal region harbouring genes related to siderophore biosynthesis and transport

  • 1Department of Microbiology, Miami University, Oxford, OH 45056, USA
  • 2Department of Biological Science, School of Natural Science and Mathematics, California State University, Fullerton, CA, USA
  • 3Department of Molecular Microbiology and Immunology, Oregon Health and Science University, Portland, OR, USA
  • Correspondence
    Luis A. Actis
    actisla{at}muohio.edu
  • Microbiology 2003; 149(5):1227–1238 · https://doi.org/10.1099/mic.0.26204-0

    View at publisher PubMed

    Abstract

    The Acinetobacter baumannii 8399 clinical isolate secretes dihydroxybenzoic acid (DHBA) and a high-affinity catechol siderophore, which is different from other bacterial iron chelators already characterized. Complementation assays with enterobactin-deficient Escherichia coli strains led to the isolation of a cosmid clone containing A. baumannii 8399 genes required for the biosynthesis and activation of DHBA. Accordingly, the cloned fragment harbours a dhbACEB polycistronic operon encoding predicted proteins highly similar to several bacterial proteins required for DHBA biosynthesis from chorismic acid. Genes encoding deduced proteins related to the E. coli Fes and the Bacillus subtilis DhbF proteins, and a putative Yersinia pestis phosphopantetheinyl transferase, all of them involved in the assembly and utilization of catechol siderophores in other bacteria, were found next to the dhbACEB locus. This A. baumannii 8399 gene cluster also contained the om73, p45 and p114 predicted genes encoding proteins potentially involved in transport of ferric siderophore complexes. The deduced products of the p114 and p45 genes are putative membrane proteins that belong to the RND and MFS efflux pump proteins, respectively. Interestingly, P45 is highly related to the E. coli P43 (EntS) protein that participates in the secretion of enterobactin. Although P114 is similar to other bacterial efflux pump proteins involved in antibiotic resistance, its genetic arrangement within this A. baumannii 8399 locus is different from that described in other bacteria. The product of om73 is a Fur- and iron-regulated surface-exposed outer-membrane protein. These characteristics together with the presence of a predicted TonB box and its high similarity to other siderophore receptors indicate that OM73 plays such a role in A. baumannii 8399. The 184 nt om73p114 intergenic region contains promoter elements that could drive the expression of these divergently transcribed genes, all of which are in close proximity to almost perfect Fur boxes. This arrangement explains the iron- and Fur-regulated expression of om73, and provides strong evidence for a similar regulation for the expression of p114.

    • The GenBank accession number for the sequence of the DNA fragment containing the A. baumannii 8399 ent locus is AY149472.

    INTRODUCTION

    Bacteria survive and multiply under iron-limiting conditions, such as those found in natural and medical environments, by expressing active systems that gather this micronutrient, which is essential for most micro-organisms with some exceptions such as lactobacilli. Some systems involve the secretion of low-molecular-mass ferric-binding compounds called siderophores, which can be classified into different categories based on their chemical structure (Neilands, 1981, 1995). Many of these high-affinity iron-chelating molecules contain catecholate groups that are part of the iron-binding site. Enterobactin, the prototype catechol siderophore produced by Escherichia coli, is a cyclic trimer of 2,3-dihydroxybenzoyl-l-serine (O'Brien & Gibson, 1970; Walsh et al., 1990). In contrast, siderophores such as vibriobactin and anguibactin, produced by Vibrio cholerae (Griffiths et al., 1984) and Vibrio anguillarum (Actis et al., 1986; Jalal et al., 1989), respectively, are non-cyclic derivatives of 2,3-dihydroxybenzoic acid (DHBA). In vibriobactin, the DHBA moiety is linked to l-threonine and norspermidine, while in anguibactin DHBA is linked to l-cysteine and hydroxyhistamine.

    In E. coli, the conversion of chorismate, which is an aromatic amino acid intermediate, into DHBA requires the consecutive action of isochorismate synthase (EntC), isochorismatase (EntB) and 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (EntA) (Earhart, 1996; Walsh et al., 1990). The ent gene cluster encoding these functions also includes entE, which encodes the 2,3-dihydroxybenzoate-AMP ligase activity required for DHBA activation. The entCEBA gene cluster, which is located next to genes encoding enterobactin transport and utilization functions, is a polycistronic operon transcribed from a promoter region that includes Fur repressor-binding sequences (Earhart, 1996). The DHBA genes are present and expressed in other enterobactin-producing bacteria such as Salmonella spp. (Pollack & Neilands, 1970), Shigella spp. (Payne et al., 1983) and Aeromonas spp. (Massad et al., 1994). The plant pathogen Erwinia chrysanthemi, which secretes the siderophore chrysobactin (Persmark et al., 1989), has DHBA genes that are arranged in the same order as in E. coli (Franza & Expert, 1991; Franza et al., 1991). V. cholerae, which produces vibriobactin in response to iron limitation, also contains a cluster harbouring the DHBA biosynthetic genes. However, these genes are organized as an entACEB cluster in which entC and entE are co-transcribed while entA and entB belong to two independent transcriptional units (Wyckoff et al., 1997).

    Acinetobacter baumannii is being increasingly recognized as an important pathogen that causes severe infections in hospitalized patients (Bergogne-Berenzin & Towner, 1996) as well as deadly cases of community-acquired pneumonia (Anstey et al., 1991). We have characterized a high-affinity iron-uptake system expressed by A. baumannii 8399, which was isolated during a nosocomial outbreak of lower-tract respiratory infections (Echenique et al., 1992). This iron-acquisition system includes a catechol siderophore capable of scavenging iron from the high-affinity iron-binding proteins present in the human host. Furthermore, examination of several clinical isolates revealed that all A. baumannii tested produced iron-regulated catechol compounds, while no hydroxamate compounds were detected in the culture supernatants of these strains (Actis et al., 1993). As a first step towards the elucidation of the biosynthetic pathway of the uncharacterized catechol siderophore secreted by the A. baumannii 8399 clinical isolate, we report in this work the cloning and characterization of genes involved in the early steps of the biosynthesis of catechol siderophores and bacterial iron utilization. This work also describes the identification and characterization of genes that code for putative siderophore transport proteins, which flank the siderophore biosynthesis and iron utilization genes found in this gene cluster.

    METHODS

    Bacterial strains, plasmids, and culture conditions.

    Bacterial strains and plasmids used in this work are shown in Table 1. Strains were routinely cultured in L broth or L agar (Sambrook et al., 1989) at 37 °C in the presence of the appropriate antibiotics. Iron-limiting and iron-rich conditions were achieved by the addition of ethylenediamine-di-(o-hydroxyphenyl)acetic acid (EDDHA) and FeCl3, respectively, to liquid or solid media.

    Table 1.

    Bacterial strains and plasmids used in this work

    Production and utilization of siderophore and iron-containing compounds.

    Bacterial cells were cultured in M9 minimal medium (Miller, 1972) supplemented with either 100 μM EDDHA or 100 μM FeCl3. Production of extracellular compounds with siderophore activity was investigated with the Chrome Azurol S (CAS) reagent (Schwyn & Neilands, 1987). The presence of phenolic compounds was detected with the Arnow test (Arnow, 1937). DHBA (Sigma) and enterobactin (kindly provided by J. Neilands) were used as standards in the chemical and biological assays. The presence of DHBA and enterobactin was examined by using the Salmonella typhimurium enb-1 and enb-7 mutants, as previously described (Echenique et al., 1992). Minimal inhibitory concentrations (MICs) of EDDHA were determined in L broth or M9 minimal medium containing increasing concentrations of EDDHA; determinations were repeated at least three times. OD600 was used to monitor cell growth after overnight incubation at 37 °C in an orbital shaker. The siderophores anguibactin, enterobactin, and that produced by the 8399 strain were isolated from iron-deficient culture supernatants of V. anguillarum 775 (Actis et al., 1986), E. coli HB101 (Rogers, 1973) and A. baumannii 8399 (Echenique et al., 1992), respectively.

    Recombinant DNA techniques.

    Restriction endonucleases and DNA modification enzymes were purchased from New England Biolabs and used according to the manufacturer's specifications. Plasmid DNA was isolated by alkaline lysis (Birnboim & Doly, 1979) and further purified by ultracentrifugation in CsCl/ethidium bromide density gradients (Sambrook et al., 1989). The physical maps of recombinant clones and insertional derivatives were obtained by restriction endonuclease digestion and agarose gel electrophoresis (Sambrook et al., 1989). Specific restriction fragments were detected by Southern blot DNA hybridization (Sambrook et al., 1989). DNA restriction fragments or amplicons used to prepare radiolabelled probes were isolated from agarose gels using the GeneClean II kit (Q.Biogene). DNA probes were radiolabelled with [α-32P]dCTP using the oligolabelling method (Feinberg & Vogelstein, 1983). Other recombinant DNA methods were performed according to standard protocols (Sambrook et al., 1989). Nucleotide sequences were determined by automated DNA sequencing (Applied Biosystems) with template plasmid DNA purified with a commercial kit (Qiagen). The nucleotide sequence of the pMU73 insert was determined in both strands, using pUC18 clones containing each HindIII fragment as templates. The order of the HindIII fragments was confirmed by sequencing across each restriction site using the recombinant cosmid pMU73 and the subclones pMU76 and pMU84 as templates (see Fig. 1). Sequences were examined and assembled with Sequencher 4.1.2 (Gene Codes Corp.). Nucleotide and amino acid sequences were analysed with dnastar, gcg, blast (), and the software available through the ExPASy Molecular Biology Server ().

    Figure image not available in archive
    Fig. 1.

    Genetic and physical map of the A. baumannii 8399 DNA fragments cloned in different vectors. The arrows indicate the location and direction of transcription of the ORFs identified by the computer analysis of nucleotide sequence of the complete cloned region. The locations of the HindIII and NcoI restriction sites are indicated by the vertical lines labelled H and N, respectively. The curved arrow in pMU85.1 indicates the insertion site of Tn3-HoHo1 within dhbA.

    Construction of a gene library and cloning of iron-acquisition genes.

    Total genomic DNA from A. baumannii 8399, isolated as described previously (Meade et al., 1982), was partially digested with HindIII and ligated into the HindIII site of the cosmid vector pVK100. Cosmid clones were packaged in vitro and transduced into E. coli LE392 or an ent mutant derivative of E. coli following the conditions suggested by the supplier (Amersham). Purified cosmid or plasmid DNA was introduced into E. coli cells either by chemical transformation (Boyer & Roulland-Doussoix, 1969) or by electroporation. Electrocompetent cells were prepared as described in the Bio-Rad electroporation manual and electroporation was conducted using the 2510 Eppendorf electroporator and 2-mm-wide cuvettes. After electroporation at 2·5 kV, the cells were suspended in 1 ml SOC (Sambrook et al., 1989), allowed to recover for 1 h at 37 °C with shaking, and then plated on L agar containing the appropriate antibiotics.

    Cloning and overexpression of om73.

    The entire om73 ORF was PCR amplified from pMU76 (see Fig. 1) with Pfu DNA polymerase (Stratagene) and the primers 5′-GATAACAATTATCATATGGTAATCG-3′ and 5′-CGCGGATCCGCTTAGAAACTATAAGTCGC-3′, which included NdeI and BamHI restriction sites, respectively. The PCR conditions were as suggested by the manufacturer of Pfu. The amplicon and the vector pET14b were digested with these two restriction enzymes, ligated, and transformed into E. coli BL21(DE3)(pLysE). The recombinant construct was confirmed by nucleotide sequencing using the T7 primer and plasmid DNA isolated from an ampicillin- and chloramphenicol-resistant colony. Induction of protein expression and electrophoretic analysis was done as described previously (Tolmasky et al., 1994). The His-tagged OM73 derivative was purified using the B-Per 6×His Fusion Protein Purification kit from Pierce Biotechnology, with some modifications. Briefly, cells (250 ml induced culture) were lysed with the B-Per lysis solution provided with the kit, and the inclusion bodies were isolated and washed according to the manufacturer's instructions. The pellet was dissolved in 2 ml buffer B (8 M urea, 0·1 M NaH2PO4, 0·01 M Tris/HCl, pH 8·0), which was also used to equilibrate the Ni columns. After the protein solution was loaded, the column was washed twice successively with 4 ml buffer B and buffer C (same as buffer B but pH adjusted to 6·3). The bound protein was eluted with buffer E (same as buffer B but pH adjusted to 4·5). Fractions were collected and analysed by SDS-PAGE as described previously (Actis et al., 1985).

    Isolation and electrophoretic analysis of whole-cell lysates and membrane proteins.

    Bacterial cells used to prepare whole-cell lysates were collected by centrifugation, after overnight culture in L broth or M9 minimal medium under iron-limiting and iron-rich conditions, and washed once with Tris-buffered saline solution (10 mM Tris/HCl, 0·15 M NaCl, pH 7·5). The cells were resuspended in the same buffer to an OD600 value of 15 and then lysed by adding 1 vol. 2× SDS-PAGE sample buffer (Actis et al., 1985) and heating the samples at 100 °C for 10 min. Total and outer membranes were isolated from cells cultured as described above by high-speed centrifugation and selective solubilization as previously reported (Actis et al., 1985).

    Immunoblot analysis.

    Whole-cell lysates and membrane fractions were size-fractionated by SDS-PAGE using 12·5 % polyacrylamide gels. The production of OM73 was examined by Western blot analysis as described before (Smoot et al., 1998). The polyclonal antiserum against OM73 was raised in rabbits as reported before (Actis et al., 1985); the animals were injected three times with 100 μg purified protein and a final boost dose of 200 μg. Specific antibodies were immunopurified with nitrocellulose strips containing the OM73 protein band (Olmsted, 1981). The presence of Fur in cell lysates was tested with anti-Fur serum as described before (Tolmasky et al., 1994). The immunocomplexes were detected by chemiluminescence using protein A labelled with horseradish peroxidase.

    Biotin labelling of cell-surface proteins.

    Outer-membrane proteins exposed to the extracellular environment were biotinylated with the EZ-Link Sulfo-NHS-Biotinylation kit from Pierce. Briefly, bacterial cells grown in M9 minimal medium containing 100 μM EDDHA were washed three times with phosphate-buffered saline solution (PBS) and suspended to a concentration of approximately 20×106 cells ml−1. Then, 0·3 mg Sulfo-NHS-LC-Biotin was added to 1 ml cells and the mixture was incubated at room temperature for 30 min. The cells were washed with PBS and total and outer membranes were isolated as described above. Biotinylated proteins were detected by chemiluminescence with horseradish-peroxidase-labelled avidin (Pierce) and H2O2. The reacting protein bands were detected by exposing the blots to X-ray film.

    Transcriptional analysis of gene expression.

    Expression of polycistronic genes was tested by RT-PCR analysis using total RNA isolated from bacteria grown under iron limitation as described before (Graber et al., 1998). The RNA samples were treated with RNase-free DNase I (Roche) and used with a commercial RT-PCR kit (Qiagen), under the conditions suggested by the manufacturer. The amplicons were analysed by agarose gel electrophoresis (Sambrook et al., 1989). PCR of total RNA without reverse transcription was used to test DNA contamination of RNA samples. The nature of the amplicons was confirmed by automated DNA sequencing.

    RESULTS

    Cloning of siderophore biosynthetic genes

    Transduction of the cosmid library constructed from A. baumannii 8399 into the E. coli entE mutant strain AN93 resulted in the isolation of colonies capable of growing in the presence of 100 μM EDDHA. Restriction analysis of a pVK100 derivative isolated from one of these colonies, which was named pMU73, showed that it contained a 20–22 kb insert encompassing at least 12 HindIII fragments. Purified pMU73 DNA was able to restore, upon transformation, the ability of E. coli AN93 to grow in L broth containing 25–400 μM EDDHA to levels similar to those observed with AN93 cells harbouring pCP410. The latter is a pACYC184 derivative that contains the E. coli entE gene (Pickett et al., 1984). In contrast, the growth of AN93 cells harbouring either the pVK100 or pACYC184 cloning vectors was significantly reduced by the addition of 50 μM EDDHA and impaired further by the addition of increasing concentrations of EDDHA.

    The acid ethyl acetate extracts of M9 minimal medium culture supernatants of E. coli AN93 cells harbouring either pVK100 or pMU73 were positive with the Arnow test. However, only the extract obtained from the culture supernatant of AN93 cells harbouring pMU73 was positive with the CAS reagent. Siderophore utilization bioassays showed that addition of the ethyl acetate extract obtained from AN93 carrying pVK100 could stimulate only the growth of the enb-7 mutant of S. typhimurium, a derivative that uses either DHBA or enterobactin to grow under iron-deficient conditions. In contrast, the organic extract obtained from AN93 harbouring pMU73 enhanced the growth of the S. typhimurium enb-7 mutant as well as that of enb-1, which uses only enterobactin to grow under iron deficiency. These results demonstrate that the biosynthesis of enterobactin in E. coli DHBA biosynthetic mutants is restored only when the cells harbour the pMU73 cosmid clone. In addition, transformation of pMU73 into the E. coli ent mutant, which carries a large chromosomal deletion that encompasses most of the enterobactin-coding region (de Lorenzo et al., 1986; J. Neilands, personal communication), restored the production of DHBA.

    Table 2 shows that the presence of pMU73 in AN193 (entA), AN192 (entB), AN90 (entD) and AB1515.43 (entG) restored ability of these enterobactin mutants to grow under iron limitation, while transformation with pVK100 did not change their iron-uptake-deficient phenotype. Further subcloning and complementation assays using derivatives obtained by ligating the HindIII fragments of pMU73 into pBCSK+ yielded pMU74, a clone that complemented only the entA mutation in AN193. Restriction analysis of this clone showed that it contained a 3·5 kb HindIII fragment, which is the largest A. baumannii 8399 restriction fragment cloned in pMU73.

    Table 2.

    Complementation of E. coli ent mutants by plasmids pVK100 and pMU73

    Cells were incubated in L broth containing increasing concentrations of EDDHA. Bacterial growth was determined after overnight incubation at 37 °C in a rotary shaker. Cultures with OD600 ⩽0·4 at EDDHA concentrations ⩾25 μM were considered negative (−) complementations, while cultures with OD600 ⩾1 at the same wavelength at ⩾25 μM EDDHA were considered positive (+) complementations of the iron-utilization phenotype of the E. coli mutants used in the bioassays. na, Not applicable.

    Nucleotide analysis of siderophore biosynthetic and utilization genes

    Computer analysis showed that the 21 931 bp fragment cloned in pMU73 contains 10 complete ORFs (Fig. 1). ORFs 3 to 6 encode predicted proteins with the highest similarity to the Bacillus subtilis DhbB, DhbE, DhbC and DhbA proteins, respectively (Table 3). Table 3 also shows that these predicted proteins are significantly similar to the E. coli Ent proteins required for enterobactin biosynthesis (Earhart, 1996), an observation that validates the complementation approach used in this work to clone these A. baumannii 8399 genes, which are referred as to the dhb genes. The polycistronic nature of this locus was confirmed by RT-PCR analysis, which yielded the cognate amplicons matching their predicted size (Fig. 2, lanes 2–4) and nucleotide sequence that were obtained with pMU73. These amplicons were not detected when total RNA was used as a template for PCR.

    Figure image not available in archive
    Fig. 2.

    Agarose gel electrophoresis of the amplicons obtained by RT-PCR of total RNA extracted from A. baumannii 8399 cells cultured under iron-deficient conditions. The primers used were designed to detect the expression of ORF 2 (lane 1), ORF 3–ORF 4 (lane 2), ORF 4–ORF 5 (lane 3), ORF 5–ORF 6 (lane 4), ORF 7 (lane 5), ORF 8–ORF 9 (lane 6), and ORF 10 (lane 7). Lane 8, HindIII-digested λ DNA.

    Table 3.

    Sequence analysis of the ORFs located within the insert of the pMU73 cosmid clone

    Introduction of pMU85 (Table 1, Fig. 1) into AN193 restored the iron-uptake phenotype of this E. coli entA strain (Table 2) and the production of enterobactin as detected with the Arnow and CAS reactions and the siderophore utilization bioassays with the S. typhimurium enb-1 and enb-7 mutants. The insertion of Tn3-HoHo1 within dhbA (pMU85.1, see Fig. 1) abolished the complementing activity of pMU85 (Table 2), which confirms the role of this A. baumannii gene in this heterologous system. The dhbA gene encodes a predicted protein with the highest similarity (Table 3) to the B. subtilis DhbA (Rowland et al., 1996), which displays the signature pattern for proteins belonging to the short-chain dehydrogenase/reductase family. ORF 5 encodes a predicted protein highly related to EntC-like proteins, displaying the highest similarity to DhbC from B. subtilis (Rowland et al., 1996) (Table 3). Next is ORF 4 (Fig. 1), which encodes a protein highly similar to several bacterial proteins involved in the activation of DHBA, particularly to DhbE from B. subtilis (Rowland et al., 1996) (Table 3). The restoration of the iron-uptake proficiency and enterobactin production by the presence of pMU73 in the E. coli AN93 entE mutant supports the role of this A. baumannii 8399 siderophore biosynthetic gene. ORF 3, the last component of the A. baumannii 8399 dhbACEB polycistronic locus, encodes a protein related to several EntB-like bacterial proteins, with the highest similarity (Table 3) to the DhbB from B. subtilis (Rowland et al., 1996). The amino end of this predicted protein contains the domain found in other isochorismatases, while its carboxyl end includes an acyl carrier protein phosphopantetheinyl (ACP) domain. The restoration of enterobactin biosynthesis and iron uptake competency in the E. coli AN192 (entB) and AB1515.43 (entG) mutants harbouring pMU73 (Table 2) indicates that the A. baumannii 8399 dhbB gene encodes a bifunctional protein that is required for DHBA biosynthesis and siderophore assembly (Gehring et al., 1997).

    ORF 8 encodes a protein highly similar (Table 3) to DhbF from B. subtilis (Rowland et al., 1996), which is highly related to the E. coli EntF protein that participates in the final stages of enterobactin biosynthesis (Rusnak et al., 1991). RT-PCR experiments proved that this gene is part of a bicistronic message (Fig. 2, lane 6) that includes ORF 9, whose translational product is related to an E. coli efflux pump protein involved in siderophore secretion (Table 3). ORF 10 encodes a protein significantly similar to a Yersinia pestis putative phosphopantetheinyl transferase (Parkhill et al., 2001), when TTG is considered as an alternative initiation codon (Table 3). These A. baumannii and Y. pestis proteins belong to a large family of bacterial proteins related to the EntD enterobactin biosynthetic protein (Armstrong et al., 1989; Coderre & Earhart, 1989). The ability of the cosmid pMU73 to restore the iron-acquisition phenotype of the E. coli AN90 (entD) (Table 2) confirms the siderophore biosynthetic role of this A. baumannii 8399 gene, which is actively transcribed in the natural host cells (Fig. 2, lane 7). The predicted translation product of ORF 7, which is also actively transcribed in A. baumannii 8399 cells (Fig. 2, lane 5), is a protein significantly similar to Fes (Table 3), the E. coli esterase required for the degradation of enterobactin and subsequent release of iron into the bacterial cytoplasm (Brickman & McIntosh, 1992).

    Nucleotide analysis of a siderophore-receptor gene and cellular localization of its translation product

    The first pMU73 ORF encodes a predicted 73·7 kDa outer-membrane protein, referred to as OM73, that is highly related to bacterial iron-regulated siderophore receptors, displaying the highest similarity with the E. coli CirA iron-regulated colicin receptor protein (Nau & Konisky, 1989) (Table 3). Furthermore, OM73 contains a TonB box found in other siderophore receptors, which is involved in the interaction with the TonB energy-transducing protein required for the transport of ferric siderophores (Crosa, 1989). The production and cellular location of OM73 were tested using a specific polyclonal antiserum, which was obtained with His-tagged OM73 that was overexpressed in E. coli BL21 and purified by Ni-affinity column chromatography, and different cellular fractions isolated from cells cultured under iron-rich and iron-deficient conditions. Fig. 3 shows that OM73 is present in the total membrane and outer-membrane fractions of A. baumannii 8399 cells cultured in the presence of the iron chelator EDDHA (lanes 2 and 4), while no signal was detected in the cognate samples prepared from cells incubated under iron-rich conditions (lanes 1 and 3). While similar results were obtained using whole-cell lysates, no signal could be detected in the inner-membrane and cytoplasmic fractions obtained from cells cultured under iron-rich and iron-deficient conditions (data not shown). The surface exposure of OM73 was tested using sulfo-NHS-biotin, a water-soluble N-hydroxysuccinimide ester of biotin that is membrane impermeable and has been extensively used, in conjunction with enzyme-labelled avidin, to examine cell-surface proteins (Wilchek & Bayer, 1988). Electrophoretic analysis showed that several proteins located in the total and outer-membrane fractions obtained from cells incubated under iron limitation were labelled after incubation of whole cells with sulfo-NHS-biotin (Fig. 3, lanes 5 and 6). A 73 kDa protein that co-migrates with the single iron-regulated protein detected with the anti-OM73 serum could be detected among the proteins labelled with sulfo-NHS-biotin (compare lanes 2, 4, 5 and 6 of Fig. 3). Taken together, these results indicate that the iron-regulated OM73 protein is located in the outer membrane of A. baumannii 8399 and appears to be a surface-exposed membrane protein that could function as a siderophore receptor.

    Figure image not available in archive
    Fig. 3.

    Analysis of native and biotin-labelled membrane proteins. Total membrane proteins (lanes 1, 2 and 5) and outer-membrane proteins (lanes 3, 4 and 6) from A. baumannii 8399 cells cultured under iron-rich (lanes 1 and 3) and iron-limiting (lanes 2, 4, 5 and 6) conditions were size-fractionated by SDS-PAGE. Protein samples from native cells (lanes 1–4) were probed with anti-OM73 and the immunocomplexes were detected with protein A labelled with horseradish peroxidase. The biotin-labelled proteins (lanes 5 and 6) were detected with avidin labelled with horseradish peroxidase. The arrows identify the biotin-labelled protein that co-migrates with OM73.

    Analysis of the regulation of the expression of om73

    Inspection of the 184 nt intergenic region which separates ORFs 1 and 2 revealed the presence of a Fur box in the (+) and (−) strand (Fig. 4) that matches 17 of the 19 nucleotides of the GATAATGATAATCATTATC consensus sequence (Calderwood & Mekalanos, 1988). Several sequences resembling the consensus −10 promoter region were also located within this region. These in silico findings are in agreement with the observed iron-regulated expression of OM73 in A. baumannii 8399 cells (Fig. 3, lanes 1–4). The recombinant plasmid pMU76 (Fig. 1, Table 1) was used to test the role of the Fur iron-repressor protein in this regulatory process. Similar levels of OM73 were detected in E. coli BN4020 Fur mutant cells harbouring pMU76 and the pACYC184Δ cloning vector cultured under either iron-rich or iron-limiting conditions (Fig. 5A, lanes 1 and 2). Western blot analysis with anti-Fur confirmed the absence of Fur in these samples (Fig. 5B, lanes 1 and 2). In contrast, co-transformation of E. coli BN4020 with pMU76 and pMU45.184, a pACYC184 derivative that harbours the A. baumannii 8399 fur gene, resulted in the repression (lane 3) and induction (lane 4) of the expression of OM73 under iron-rich and iron-limited conditions, respectively. Similar results were obtained with E. coli BN4020 transformed with pMU76 and pMH15, which harbours the E. coli fur gene (lanes 5 and 6). Immunoblot analysis of the four latter samples confirmed the presence of Fur encoded by pMU45.184 and pMH15 (lanes 3 and 4, and 5 and 6, of Fig. 5B, respectively). The observation that Fur is also detected by immunoblotting in whole-cell lysates of A. baumannii 8399 (data not shown) suggests that this iron repressor controls the expression of OM73 in its native environment.

    Figure image not available in archive
    Fig. 4.

    Nucleotide sequence of the genomic region that encompasses the 5′ regions of om73 and p114 and the 184 nt intergenic region that separates them. The boxed nucleotides identify potential Fur-binding sequences. The characters depicted in bold and italics on the lower and upper strands represent the 5′ end of om73 and p114, respectively.

    Figure image not available in archive
    Fig. 5.

    Analysis of the expression of OM73 and Fur. Whole-cell lysates were prepared from E. coli BN4020 cells harbouring pMU76 and pACYC184Δ (lanes 1 and 2) or pMU76 together with either pMU45.184 (lanes 3 and 4) or pMH15 (lanes 5 and 6) cultured either under iron-rich (lanes 1, 3 and 5) or iron-limiting conditions (lanes 2, 4 and 6). (A) Blotted proteins were probed with anti-OM73. (B) Blotted proteins were probed with anti-Fur. Immunocomplexes were detected with protein A labelled with horseradish peroxidase and chemiluminescence.

    Nucleotide analysis of genes encoding secretion-like proteins

    The second ORF of pMU73, which is actively transcribed in A. baumannii 8399 cells (Fig. 2 lane 1), encodes a 114·5 kDa predicted protein, referred to as P114, that is highly similar to a large number of bacterial multidrug efflux proteins, with a predicted Y. pestis protein (Parkhill et al., 2001) as the top match (Table 3). The long list of highly related proteins includes the Pseudomonas aeruginosa MexB (score 884; E value 0·0) iron-regulated efflux protein, whose gene is upstream of oprM (Poole et al., 1993a, b). All these proteins are integral membrane proteins that belong to the AcrB/AcrD/AcrF family generally known as the resistance-nodulation-cell division (RND) transporters, some of which are part of active transport systems involved in bacterial drug resistance (Borges-Walmsley & Walmsley, 2001; Paulsen et al., 1996). The predicted structure of P114 includes membrane-spanning helices and motifs found in different members of this family of bacterial proteins (Paulsen et al., 1996). The om73p114 intergenic region contains potential sequences that could serve as the promoter element of this gene, which are in close proximity to the almost perfect Fur boxes predicted within this genomic area (Fig. 4). These observations strongly suggest that the expression of p114 could also be regulated by iron and Fur.

    The pMU73 ORF 9, which is part of the bicistronic message containing ORF 8 (Fig. 2, lane 6), encodes a 45 kDa protein highly similar to the E. coli P43 membrane protein (Table 3). The latter, which was recently named EntS, is encoded by the ybdA gene of the E. coli ent operon (Chenault & Earhart, 1991; Shea & McIntosh, 1991) and participates in the secretion of enterobactin (Furrer et al., 2002). The A. baumannii P45 and E. coli P43 proteins contain, with the exception of one, equivalent transmembrane (TM) domains (Fig. 6). The exception is the predicted TM 11 region that has a high probability to be such a domain in P43, while the P45 counterpart seems to have a lower score for a membrane-spanning helix. However, analysis of P45 with HMMTOP predicts 12 membrane-spanning helices. These two proteins showed 43·7 % identity and 55·3 % similarity when aligned with GAP. This analysis also showed that the apparent disparity between the predicted structures of P43 and P45 is consistent with the differences in amino acid sequences between them, particularly within the last half of the predicted amino acid sequence (Fig. 6C). The ATG initiation codon of p45 is part of the TGA termination codon of the dhbF-like gene, a finding that is in accordance with the RT-PCR results that showed that these two ORFs are part of a polycistronic mRNA (Fig. 2, lane 6). Analysis of the nucleotide region upstream of the latter gene, which is predicted to contain the promoter of this polycistronic locus, showed the presence of the nucleotide sequence GTTAACCATTAATCCTTTTC, which matches 15 of the 19 nucleotides of the Fur-box consensus sequence (Calderwood & Mekalanos, 1988).

    Figure image not available in archive
    Fig. 6.

    Comparative analysis of the A. baumannii 8399 P45 and E. coli P43 proteins. The predicted secondary structures of P45 (A) and P43 (B) were obtained with TMHMM. Potential inside and outside protein regions are labelled as I and O, respectively. Black blocks with numbers represent the transmembrane regions predicted in each protein. (C) Alignment of P45 and P43 using gap.

    DISCUSSION

    The finding of dhb genes in the genome of A. baumannii 8399 is in accordance with our previous report showing that this clinical isolate expresses a catechol-based siderophore that scavenges iron from human high-affinity iron-binding proteins (Echenique et al., 1992). The genetic arrangement of this gene cluster, which encodes proteins highly similar to other bacterial proteins involved in DHBA biosynthesis, is the same as that found in the B. subtilis dhbACEB (Rowland et al., 1996) and the V. cholerae vibACEB (Wyckoff et al., 1997) loci. However, the A. baumannii 8399 and B. subtilis loci are transcribed in the same direction as a single polycistronic unit, while the V. cholerae locus is organized in three transcriptional units. Interestingly, the predicted proteins encoded by the A. baumannii 8399 dhb genes are more similar to those found in Gram-positive than in Gram-negative bacteria. This observation suggests that unrelated bacteria acquired these essential iron-acquisition genes from different natural sources. Nevertheless, our findings provide more support to the hypothesis that catechol biosynthetic genes are highly conserved among Gram-positive and Gram-negative bacteria. Genetic complementation assays and siderophore utilization tests proved that the A. baumannii dhbA, dhbB and dhbE genes encode active proteins that restore enterobactin biosynthesis and iron uptake proficiency when introduced in E. coli ent mutants. These assays also showed that the dhbB translational product is a bifunctional protein that is required for the biosynthesis of catechol siderophores such as enterobactin (Earhart, 1996) and anguibactin (Crosa & Walsh, 2002; Welch et al., 2000). This chromosomal region, which is part of the pMU73 insert DNA, also includes genes encoding predicted proteins that belong to the EntD and EntF family. The latter proteins are required for the biosynthesis of catechol siderophores in different bacteria (Crosa & Walsh, 2002). Taken together, the data provide strong evidence that A. baumannii 8399 harbours all the genetic determinants required for the biosynthesis of the catechol siderophore detected in iron-limited culture supernatants of this pathogen (Echenique et al., 1992), whose structure is still unknown.

    This set of dhb genes could also be present in the genome of the A. baumannii 19606 prototype strain that produces DHBA and acinetobactin (Yamamoto et al., 1994), a catechol siderophore almost identical to anguibactin, the siderophore produced by the fish pathogen V. anguillarum (Jalal et al., 1989). However, it is important to note that the A. baumannii 8399 catechol siderophore appears to be different from acinetobactin and anguibactin. This hypothesis is based on the observation that histamine, a precursor for anguibactin (Tolmasky et al., 1995) and most likely acinetobactin biosynthesis, could be detected in culture supernatants of V. anguillarum (Barancin et al., 1998) and A. baumannii 19606 (Actis et al., 1999). In contrast, the mass spectral analysis of A. baumannii 8399 culture supernatants did not reveal the presence of this biogenic amine, which serves as a siderophore precursor (Actis et al., 1999). Furthermore, preliminary tests showed that the production of OM73 could be detected only in cells of 8399, while the production of an outer-membrane protein related to FatA, the receptor for anguibactin in V. anguillarum (Actis et al., 1988), was detected only in iron-starved cells of 19606 (C. W. Dorsey, M. S. Beglin & L. A. Actis, unpublished). The results of this protein analysis are further supported by the fact that the genes encoding OM73 and the FatA-like proteins could be detected only in strains 8399 and 19606, respectively. These data are consistent with the possibility that the A. baumannii 8399 and 19606 clinical isolates express similar but unrelated iron-acquisition systems.

    The A. baumannii 8399 region cloned in pMU73 also includes a fes-like gene that is actively transcribed and encodes a deduced protein related to the Fes enterobactin esterase (Brickman & McIntosh, 1992). This protein is present in bacteria such as E. coli, Salmonella and Shigella, which acquire iron via the production and uptake of ferric enterobactin. The presence and expression of this gene in A. baumannii 8399 could be explained by the potential but untested capacity of this pathogen to use ferric enterobactin. However, this iron chelator must be provided by an exogenous source since siderophore utilization bioassays and chemical tests proved that the 8399 isolate does not produce and secrete enterobactin (Echenique et al., 1992). The production of a siderophore similar but not identical to enterobactin is another alternative that can explain the presence of the fes-like gene, a possibility that could be elucidated after the structure of the A. baumannii 8399 siderophore is determined.

    Similar to other bacterial gene clusters involved in iron acquisition, this A. baumannii 8399 genomic region also contains genes encoding proteins that are highly related to iron-transport proteins. One of them is OM73, which is one of several iron-regulated outer-membrane proteins detected previously in iron-starved A. baumannii 8399 cells (Echenique et al., 1992). This protein is clearly located in the outer-membrane fraction and exposed to the extracellular environment. These properties, together with its iron-regulated expression mediated by Fur, the presence of a TonB box in its predicted amino acid sequence, and its significant similarity to other bacterial siderophore receptors, provide strong support for its potential role as a receptor for ferric siderophore complexes.

    Another protein potentially involved in iron acquisition is P45, whose deduced amino acid sequence and secondary structure are highly similar to those of the E. coli P43 protein (Chenault & Earhart, 1991; Shea & McIntosh, 1991). This finding is significant in light of the recent report showing that the latter, also known as EntS, is involved in the secretion of enterobactin (Furrer et al., 2002). P45 also showed significant similarity to six P. aeruginosa proteins that belong to the major facilitator superfamily (MFS) class (Borges-Walmsley & Walmsley, 2001; Paulsen et al., 1996) but not to OprM, which is an iron-regulated efflux pump protein that appears to function as the pyoverdin exporter (Poole et al., 1993a, b). The presence of a Fur box located within the promoter region of the entF-like–p45 bicistronic locus suggests that the expression of P45 is regulated by iron and Fur. Thus, the location of p45 within a cluster of genes encoding iron-acquisition functions, the high similarity of its translation product to a siderophore secretion protein, and its potential iron-regulated expression via Fur provide strong support for its possible role in the secretion of the catechol siderophore produced by A. baumannii 8399.

    P114, the third protein encoded within this A. baumannii 8399 gene cluster, has striking similarity to a large number of bacterial membrane proteins involved in resistance to antimicrobial agents. Among them is AdeB, an efflux protein produced by the A. baumannii BM4454 isolate, which is encoded by a gene that is part of a gene cluster that encodes all the components of an RND-type efflux system that confers aminoglycoside resistance upon this strain (Magnet et al., 2001). Another protein highly similar to P114 is the P. aeruginosa MexB protein, an iron-regulated protein that is part of a polycistronic message that includes oprM (Poole et al., 1993a, b). Although the role of MexB in antibiotic resistance was proven, the participation of this type of efflux pump protein in iron acquisition and siderophore export remains to be tested. It is clear that the genetic arrangement of the A. baumannii 8399 locus that contains p114, in which this gene is flanked by iron transport and siderophore biosynthetic genes, is different from that reported for other bacterial efflux operons (Paulsen et al., 1996), including that found in the genome of P. aeruginosa PAO1 (Stover et al., 2000) and A. baumannii BM4454 (Magnet et al., 2001). Thus, it is tempting to speculate that P114 functions in siderophore secretion, either by itself or in conjunction with P45 or another undetermined protein(s).

    It is worthy of note that several attempts to generate isogenic derivatives affected in some of the functions described in this work, using several well-established insertional systems and different experimental conditions, failed to yield the expected and predicted derivatives. These results suggest that the A. baumannii clinical isolates, such as the 8399 strain, may not be as amenable as other bacteria to this type of genetic manipulation. This hypothesis is supported by our recent observation that among the different systems tested with the prototype strain 19606, electroporation of transposon–transposase complexes is the most efficient approach to obtain isogenic insertion derivatives of this pathogen (Dorsey et al., 2002). We are currently testing this approach with strain 8399 and developing the genetic tools required for the functional analysis of the genes described in this work in an isogenic background.

    Acknowledgments

    This work was supported by a grant from the American Lung Association and research funds from Miami University and by United States Public Health Service Grants AI44776 and DE13657-02 (to L. A. A.) and AI19018 (to J. H. C.) from the National Institutes of Health. We thank C. Wood, coordinator of the Miami University Center of Bioinformatics and Functional Genomics, for his support and assistance with automated DNA sequencing and nucleotide sequence analysis.

    References