Abstract
Abbreviations: ARHDO, aromatic-ring-hydroxylating dioxygenase
The GenBank/EMBL/DDBJ accession numbers for the novel bphA1 core segment sequences reported in this study are AJ544517AJ544525.
Previous studies with class II ARHDO systems have demonstrated that the major determinants of the fundamental catalytic properties such as substrate and product spectra reside within the C-terminal part of the large or α-subunit (Erickson & Mondello, 1993; Kimura et al., 1997; Mondello et al., 1997; Beil et al., 1998; Zielinski et al., 2002), although the small or β-subunit has occasionally been reported to exert some influence on these properties (Furukawa et al., 1994; Hurtubise et al., 1998). Recently, it has been shown that the C-terminal 60 aa of the α-subunit are of minor importance for these properties (Zielinski et al., 2002). Thus, if consensus oligonucleotide primers could be derived from conserved sequences flanking the part of the gene that encodes the catalytic centre, such segments could be rapidly amplified from, for example, bacterial isolates, microbial consortia or just samples of nucleic acids. These segments could be reconstituted into complete ARHDO gene clusters by fusion with the missing sequences from a helper operon. If the resulting hybrid genes would express catalytically active enzymes, such a system should be a powerful tool for the rapid isolation and characterization of naturally occurring ARHDO activities.
Chemicals and oligonucleotides.Chemicals were of analytical grade, if available. Oligonucleotides were synthesized by Gibco/Life Technologies. Their sequences (5'→3') were as follows: BPH2454M, ATGACGATCTTCCGGATCTGGCACCCTCGAGGTCCCAATG; BPH-2651M, TGGCCTTGTACCCTCTTAAGCCCTTCTGGATCTCC; BPH2632M, CTTAAGAGGGTACAAGGCCAAGAGCCAGC; BPH-2711, AATCAGGGTGACCGGTCTGC; HDO2AF, AGGCACGCGTGGAGACCTACAAGGGCCTGATTTTCGCCAACTGGGA; HDO2AR, GCCTTGTGGCCGCTTAAGACGTGCTGGATCTCGACCCAGTTCTCGCCGTCGTCCTG. The MluI and AflII sites in HDO2AF and HDO2AR, respectively, are underlined.
Bacterial strains and plasmids.
The following strains were used in this study: Escherichia coli strains DH5α (Grant et al., 1990), DH10B (Grant et al., 1990) and BL21(DE3)(pLysS) (Studier, 1991); Burkholderia sp. strain LB400 (Bopp, 1986; Fain & Haddock, 2001); Pseudomonas sp. strains B2A, B3B, B4, B6K and B7A (Bartels et al., 1999); Ralstonia eutropha H850 (Bedard et al., 1987; Williams et al., 1997); Ralstonia sp. strains B11 and B15 (Bartels et al., 1999); Rhodococcus globerulus P6 (Furukawa et al., 1978; Asturias et al., 1994); Rhodococcus opacus BIE-20 (Wagner-Döbler et al., 1998); Sphingomonas yanoikuyae Q1 (Furukawa et al., 1983; Wang & Lau, 1996). pAIA6000 is a pT7-6-based expression plasmid harbouring genes bphA1m2A3A4BC of strain LB400; bphA1m contains silent mutations that generate NdeI and XhoI sites (Zielinski et al., 2002).
Bacterial cultures and preparation of resting cells.
Soil bacteria were grown at 30 °C in Luria broth (Bopp et al., 1983) or in minimal medium with biphenyl as carbon source as described previously (Bartels et al., 1999). E. coli DH strains harbouring a pAIA plasmid were grown at 37 °C in LB medium (Sambrook et al., 1989) containing 100 µg ampicillin ml-1. E. coli BL21(DE3)(pLysS) strains harbouring a pAIA plasmid were grown at 30 °C in LB medium containing 50 µg chloramphenicol ml-1 and 100 µg ampicillin ml-1. For the preparation of resting cells, the latter strains were grown to an OD600 value of about 1·0. IPTG was then added to 0·4 mM (final concentration), and the incubation was continued for another 45 min. Cells were harvested, washed with 50 mM sodium phosphate buffer (pH 7·5) and then resuspended in the same buffer to an OD600 value of 5·0.
DNA techniques.
In vitro DNA modifications, agarose gel electrophoresis (AGE) and transformations were carried out according to standard protocols (Sambrook et al., 1989), unless described in detail.
The introduction of an AflII site into bphA1m-LB400 was done as follows. Plasmid pAIA6000 was used as template to amplify two overlapping parts of its bphA1m gene by PCR (Mullis & Faloona, 1987), using primers BPH2454M and BPH-2651M or BPH2632M and BPH-2711, respectively. Both PCR products (198 and 80 bp, respectively) were purified via AGE and then used as template for overlap extension PCR (Higuchi et al., 1988) with primers BPH2454M and BPH-2711. The gel-purified product (258 bp) was cut with XhoI and AgeI and then cloned into identically cleaved, dephosphorylated pAIA6000. This yielded plasmid pAIA6100. The integrity of its insert was verified by DNA sequencing.
For PCRs with consensus primers, a small sample of cells was suspended in 20 µl of water and heated to 95 °C for 4 min. After spinning down cell debris with a table top centrifuge, 2 µl of supernatant were used as template in the PCR. Thirty cycles with an annealing temperature of 60 °C, an elongation time of 90 s (with an increment of 3 s per cycle) and otherwise standard conditions were used.
To generate ARHDO α-subunit fusion genes, PCR products of the consensus primers were purified by AGE, cut with MluI and AflII and then ligated with identically cleaved, dephosphorylated pAIA6100. The resulting clones were screened for ARHDO activity (see below) and further analysed by restriction and insert sequencing.
For DNA sequence determinations, about 1 µg of plasmid or 0·050·2 µg of PCR product was subjected to Taq DNA polymerase-catalysed cycle sequencing as described previously (Bartels et al., 1999). The sequences of the novel bphA1 core segments have been deposited in the EMBL/GenBank/DDBJ data libraries under accession numbers AJ544517AJ544525.
Protein gel electrophoresis.
Resting cells were lysed with a cracking buffer (Tabor & Richardson, 1985) and proteins were separated by 0·1 % SDS-15 % PAGE as described previously (Hofer et al., 1993). Gels were stained with Coomassie brilliant blue R250 (Sambrook et al., 1989).
ARHDO activity measurements.
ARHDO activity was assayed with biphenyl as substrate. Colonies were tested by dispensing some crystals of biphenyl into the lid of the Petri dish. As pAIA6100 and its derivatives also expressed bphB and bphC, ARHDO activity led to the conversion of biphenyl into 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate, which was observed by eye (λmax=434 nm). ARHDO activity of resting cells was determined by incubation of a cell suspension with an OD600 value of 5·0 with 0·1 mM biphenyl at room temperature. At intervals, the A434 values of the supernatants were measured.
Depletion of aromatic compounds.
A mixture of aromatic compounds (see Table 2) and 2,4,6,2',4'-pentachlorobiphenyl (as internal standard) were added to resting cells with an OD600 value of 5·0 to a final concentration of 12 µM each. After vortexing for 10 s, the teflon-sealed tubes were shaken at 30 °C for 24 h. Thereafter, the suspensions were extracted with 1 volume of n-hexane, and 5 µl of the organic phase were analysed in an HP 5890 Series II gas chromatograph (GC) equipped with a flame-ionization detector and an HP Ultra2 column (length, 50 m; inner diameter, 0·2 mm; film thickness, 0·11 µm). The carrier gas was hydrogen. The injector was held at 250 °C. The GC temperature programme used was as follows: 5 min at 40 °C, linear gradient of 4 °C min-1 to 288 °C and 10 min at 288 °C. The flame-ionization detector was operated at 300 °C. GC peak areas were normalized to the internal standard. Background depletion of substrates was determined by using resting cells devoid of ARHDO genes.
Table 2. Depletion of aromatic compounds by E. coli BL21(DE3)(pLysS) recombinants and parental strains Values shown represent the mean of three replications and are shown±SD.
Design and construction of a system for the rapid isolation of ARHDO activitiesConsensus oligonucleotide primers for the multiplication of gene segments encoding α-subunit cores of enzymes which predominantly dioxygenate benzene or benzene derivatives were derived from sequences around positions 510 (for the forward primer) and 1180 (for the reverse primer). These segments encode the major determinants of substrate and product spectra, according to biochemical studies with enzyme variants (Erickson & Mondello, 1993; Kimura et al., 1997; Mondello et al., 1997; Beil et al., 1998; Zielinski et al., 2002). They also encode all amino acid residues that, by analogy with the three-dimensional crystal structure of a related naphthalene dioxygenase (Carredano et al., 2000), form the substrate-binding pocket (see also Fig. 2). In order to convert these fragments into complete ARHDO gene clusters, the missing parts were supplemented by an appropriate helper operon. This may be joined with core segments by overlap extension PCR (Higuchi et al., 1988). However, to facilitate this fusion, the primer consensus sequences were designed to contain restriction sites for MluI and AflII, respectively, at positions that lead to in-frame ligations with the recipient gene cluster. The sequences of these consensus primers (HDO2AF and HDO2AR) are given in Methods.
|
Genes bphA1A2A3A4 of the ARHDO (biphenyl dioxygenase) system of Burkholderia sp. strain LB400 (encoding hydroxylase α- and β-subunits, a ferredoxin and a ferredoxin reductase) were chosen as the recipient gene cluster for the exchange of α-subunit gene cores. This choice was based on the following findings. It has been shown that the genes for the bph-encoded wild-type hydroxylase of strain LB400 can be expressed to high levels in E. coli (Seeger et al., 1997). Moreover, it has been demonstrated for the LB400 dioxygenase system that the replacement of various regions of the large subunit by ARHDO segments that share 5970 % sequence identity in most cases resulted in catalytically active enzymes (Zielinski et al., 2002). The bphA1 gene, which already contains an appropriate recognition sequence for MluI, was modified to create an AflII site by the introduction of four silent mutations. These alterations, yielding plasmid pAIA6100, did not significantly affect the level of bphA1 expression (see also Fig. 3).
|
The basic features of the approach are depicted in Fig. 1. As each of the core segment primers encodes consensus peptides that differ somewhat from the respective BphA1-LB400 sequences, the final hybrid protein consists of five segments which are derived from three different sources, BphA1-LB400, the consensus peptides and the segment encoded by the novel gene. If advantageous, the primer-specific sequences of the amplified product may be exchanged, for example, against the respective sequences of the recipient gene cluster. This could, for example, be done by re-amplification of the primary product, using appropriate primers.
|
Experimental evaluation of the system
Bacterial isolates obtained from different locations and known to aerobically metabolize predominantly bicyclic aromatic compounds were chosen to evaluate the approach described here. The ARHDO genes of these organisms were unknown, except for R. globerulus P6 (Asturias et al., 1995). In 10 out of 11 cases, PCR fragments of the expected lengths were obtained (Table 1). Only S. yanoikuyae Q1 gave no product. The sequence of an extradiol dioxygenase of this strain has been determined (Taira et al., 1988). Interestingly, it is most closely related to sequences found in polycyclic aromatic hydrocarbon (PAH) degraders (Hofer et al., 1993). Thus, the ARHDO gene of this strain may also be of the PAH type. These genes are usually so divergent that they do not permit annealing of the consensus primers. DNA sequencing revealed that the sequences of the amplified segments were typical for the cores of α-subunit genes and were devoid of MluI and AflII sites other than those bestowed by the primer sequences. Some pairs of core segments showed 100 % sequence identity with each other, namely those from strains B6K and B7A, B11 and B15, and H850 and LB400. An alignment of the deduced protein sequences is shown in Fig. 2. Sequence identity of these segments with the replaced polypeptide segment of strain LB400 ranged from 68 to 100 %.
Table 1. Amplification, sequencing, cloning and expression of core gene segments of ARHDO α-subunits
Four of the seven different PCR products representing differing degrees of sequence identity with the LB400 gene were selected to replace the bphA1 core segment in pAIA6100. In each case, ARHDO activity was restored (Table 1). The newly introduced segments of the clones were re-sequenced. All sequences were identical to the uncloned PCR products with one exception; one clone contained a point mutation leading to a substitution of His by Arg in the segment encoded by the reverse primer.
The concentrations of wild-type and hybrid α-subunits and of wild-type β-subunits were analysed by denaturing PAGE of SDS-lysed cells (Fig. 3). After staining with Coomassie blue, bands of both subunits were clearly visible in all cases, indicating high level expression of the respective genes.
Substrate specificities of the hybrid ARHDOs were assessed by incubation of a mixture of aromatic compounds with the respective E. coli recombinants and analysis of their depletion. The data show that the substrate spectra of the hybrid enzymes differed from each other and from that of the strain LB400 ARHDO (Table 2). This result confirms that the substrate range is crucially determined by the replaced α core segment. A detailed analysis of substrate and product spectra of selected hybrid ARHDOs will appear elsewhere.
For comparison, the same assays were carried out with the donor strains of the core segments (Table 2). In most cases, similar degrees of substrate depletion were observed as with the respective E. coli recombinants, indicating that the properties of the hybrid ARHDOs often, but not always, reflect the properties of the donor strains. Minor differences were found occasionally that indicated more depletion by the recombinants. This may result from a higher level of gene expression in the E. coli strains that harbour multiple gene copies downstream of a strong phage T7 late promoter. Whenever major deviations in substrate depletion occurred, donors exhibited significantly higher depletions of certain compounds than the recombinants. A straightforward explanation would be the existence of more than one ARHDO in these strains. This has previously been observed in bacteria (Kim & Zylstra, 1999; Kitagawa et al., 2001).
The limitations of the approach described here are that it relies upon DNA sequence similarity with the consensus primers and compatibility of protein three-dimensional structures between donor and recipient. An in silico analysis indicated that more than 80 % of the cores of sequenced genes encoding α-subunits of ARHDOs that are known or likely to belong to class II or to accept benzene or benzene derivatives as substrates should be amplified with the described primers. The genes of the entire ARHDO family are too diverse to permit amplification by a single pair of oligonucleotides. However, different sets of primers may be designed for different ARHDO subclasses. A model of the three-dimensional structure of the class II biphenyl dioxygenase of strain LB400 (M. Zielinski, S. Kahl, H.-J. Hecht & B. Hofer, unpublished data), based on the known class III naphthalene dioxygenase structure (Carredano et al., 2000), suggests that the structural similarity between these two classes of ARHDOs is high enough to make it likely that the fusion approach outlined here may also be applied to class III dioxygenases. The formation of a functional ARHDO hybrid will depend upon the structural compatibility of donor and recipient regions. This is not strictly correlated with the amino acid sequence similarity between the fusion components, since rather dissimilar sequences can result in quite similar structures. The class III dioxygenase structure and the class II dioxygenase model show that in the (αβ)3 hexamer the exchanged core segment has contacts with both terminal parts of its subunit, with the neighbouring β-subunit and with one of the two other α-subunits. It is located at the periphery of the hexamer and forms a fairly compact subdomain in itself. Thus, it is less likely that core replacements will severely disturb the overall structure of the hydroxylase complex.
In summary, our results suggest that the system outlined here will, in many cases, result in catalytically active ARHDOs. These hybrid enzymes possess distinct properties, depending on the donor segment. Therefore, the system could be used to rapidly screen a large number of bacterial isolates for ARHDO activity. It requires no strain selection or any knowledge of the induction of ARDHO activity. Moreover, the system may be applied directly to complex mixtures of organisms or their nucleic acids, respectively, such as present in environmental samples. This application may be particularly useful as only a minority of all microbes can currently be cultivated in the laboratory (Amann et al., 1995). Thus, the approach described here may be helpful in a functional characterization of the natural ARHDO diversity and may also allow access to a so-far-unattainable biocatalytic potential.
We wish to thank Irene Wagner-Döbler and Petra Blumenroth for the gifts of bacterial strains, Christine Standfuß-Gabisch for help with protein gel electrophoresis, Hans-Jürgen Hecht for helpful discussions and Robert Brownlie, University of Saskatchewan, for linguistic advice.References
Asturias, J. A., Moore, E., Yakimov, M. M., Klatte, S. & Timmis, K. N. (1994). Reclassification of the polychlorinated biphenyl-degraders Acinetobacter sp. strain P6 and Corynebacterium sp. strain MB1 as Rhodococcus globerulus. Syst Appl Microbiol 17, 226231.
Asturias, J. A., Diaz, E. & Timmis, K. N. (1995). The evolutionary relationship of biphenyl dioxygenase from Gram-positive Rhodococcus globerulus P6 to multicomponent dioxygenases from Gram-negative bacteria. Gene 156, 1118.[CrossRef][Medline]
Bartels, F., Backhaus, S., Moore, E. R. B., Timmis, K. N. & Hofer, B. (1999). Occurrence and expression of glutathione-S-transferase-encoding bphK genes in Burkholderia sp. strain LB400 and other biphenyl-utilizing bacteria. Microbiology 145, 28212834.
Bedard, D. L., Haberl, M. L., May, R. J. & Brennan, M. J. (1987). Evidence for novel mechanisms of polychlorinated biphenyl metabolism in Alcaligenes eutrophus H850. Appl Environ Microbiol 53, 11031112.
Beil, S., Mason, J. R., Timmis, K. N. & Pieper, D. H. (1998). Identification of chlorobenzene dioxygenase sequence elements involved in dechlorination of 1,2,4,5-tetrachlorobenzene. J Bacteriol 180, 55205528.
Bopp, L. H. (1986). Degradation of highly chlorinated PCBs by Pseudomonas strain LB400. J Ind Microbiol 1, 2329.
Bopp, L. H., Chakrabarty, A. M. & Ehrlich, H. L. (1983). Chromate resistance plasmid in Pseudomonas fluorescens. J Bacteriol 155, 11051109.
Boyd, D. R. & Sheldrake, G. N. (1998). The dioxygenase-catalyzed formation of vicinal cis-diols. Nat Prod Rep 15, 309325.
Butler, C. S. & Mason, J. R. (1997). Structurefunction analysis of the bacterial aromatic ring-hydroxylating dioxygenases. Adv Microb Physiol 38, 4784.[Medline]
Carredano, E., Karlsson, A., Kauppi, B. & 7 other authors (2000). Substrate binding site of naphthalene 1,2-dioxygenase: functional implications of indole binding. J Mol Biol 296, 701712.[CrossRef][Medline]
Erickson, B. D. & Mondello, F. J. (1993). Enhanced biodegradation of polychlorinated biphenyls after site-directed mutagenesis of a biphenyl dioxygenase gene. Appl Environ Microbiol 59, 38583862.
Fain, M. G. & Haddock, J. D. (2001). Phenotypic and phylogenetic characterization of Burkholderia (Pseudomonas) sp. strain LB400. Curr Microbiol 42, 26975.[Medline]
Furukawa, K., Matsumura, F. & Tonomura, K. (1978). Alcaligenes and Acinetobacter strains capable of degrading polychlorinated biphenyls. Agric Biol Chem 42, 543548.
Furukawa, K., Simon, J. R. & Chakrabarty, A. M. (1983). Common induction and regulation of biphenyl, xylene/toluene and salicylate catabolism in Pseudomonas paucimobilis Q1. J Bacteriol 154, 13561362.
Furukawa, K., Hirose, J., Hayashida, S. & Nakamura, K. (1994). Efficient degradation of trichloroethylene by a hybrid aromatic ring dioxygenase. J Bacteriol 176, 21212123.
Grant, S. G. N., Jessee, J., Bloom, F. R. & Hanahan, D. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc Natl Acad Sci U S A 87, 46454649.
Higuchi, R., Krummel, B. & Saiki, R. K. (1988). A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16, 73517367.
Hofer, B., Eltis, L. D., Dowling, D. N. & Timmis, K. N. (1993). Genetic analysis of a Pseudomonas locus encoding a pathway for biphenyl/ polychlorinated biphenyl (PCB) degradation. Gene 130, 4755.[CrossRef][Medline]
Hurtubise, Y., Barriault, D. & Sylvestre, M. (1998). Involvement of the terminal oxygenase beta subunit in the biphenyl dioxygenase reactivity pattern toward chlorobiphenyls. J Bacteriol 180, 58285835.
Kim, E. & Zylstra, G. J. (1999). Functional analysis of genes involved in biphenyl, naphthalene, phenanthrene, and m-xylene degradation by Sphingomonas yanoikuyae B1. J Ind Microbiol Biotechnol 23, 294302.[CrossRef][Medline]
Kimura, N., Nishi, A., Goto, M. & Furukawa K. (1997). Functional analyses of a variety of chimeric dioxygenases constructed from two biphenyl dioxygenases that are similar structurally but different functionally. J Bacteriol 179, 39363943.
Kitagawa, W., Suzuki, A., Hoaki, T., Masai, E. & Fukuda, M. (2001). Multiplicity of aromatic ring hydroxylation dioxygenase genes in a strong PCB degrader, Rhodococcus sp. strain RHA1 demonstrated by denaturing gradient gel electrophoresis. Biosci Biotechnol Biochem 65, 19071911.[CrossRef][Medline]
Mondello, F. J., Turcich, M. P., Lobos, J. H. & Erickson, B. D. (1997). Identification and modification of biphenyl dioxygenase sequences that determine the specificity of polychlorinated biphenyl degradation. Appl Environ Microbiol 63, 30963103.
Mullis, K. B. & Faloona, F. (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155, 335350.[Medline]
Resnick, S. M., Lee, K. & Gibson, D. T. (1996). Diverse reactions catalyzed by naphthalene dioxygenase from Pseudomonas sp. strain NCIB 9816. J Ind Microbiol 17, 438457.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Seeger, M., Timmis, K. N. & Hofer, B. (1997). Bacterial pathways for degradation of polychlorinated biphenyls. Mar Chem 58, 327333.[CrossRef]
Studier, F. W. (1991). Use of bacteriophage T7 lyzozyme to improve an inducible T7 expression system. J Mol Biol 219, 3744.[CrossRef][Medline]
Tabor, S. & Richardson, C. C. (1985). A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc Natl Acad Sci U S A 82, 10741078.
Taira, K., Hayase, N., Arimura, N., Yamashita, S., Miyazaki, T. & Furukawa, K. (1988). Cloning and nucleotide sequence of the 2,3-dihydroxybiphenyl dioxygenase gene from the PCB-degrading strain of Pseudomonas paucimobilis Q1. Biochemistry 27, 39903996.[CrossRef][Medline]
Wackett, L. P. & Gibson, D. T. (1988). Degradation of trichloroethylene by toluene dioxygenase in whole-cell studies with Pseudomonas putida F1. Appl Environ Microbiol 54, 17031708.
Wagner-Döbler, I., Bennasar, A., Vancanneyt, M., Strömpl, C., Brümmer, I., Eichner, C., Grammel, I. & Moore, E. R. B. (1998). Microcosm enrichment of biphenyl-degrading microbial communities from soils and sediments. Appl Environ Microbiol 64, 30143022.
Wang, Y. & Lau, P. C. (1996). Sequence and expression of an isocitrate dehydrogenase-encoding gene from a polycyclic aromatic hydrocarbon oxidizer, Sphingomonas yanoikuyae B1. Gene 168, 1521.[CrossRef][Medline]
Williams, W. A., Lobos, J. H. & Cheetham, W. E. (1997). A phylogenetic analysis of aerobic polychlorinated biphenyl-degrading bacteria. Int J Syst Bacteriol 47, 207210.
Zielinski, M., Backhaus, S. & Hofer, B. (2002). The principal determinants for the structure of the substrate-binding pocket are located within a central core of a biphenyl dioxygenase α subunit. Microbiology 148, 24392448.
Received 2 September 2002; revised 10 December 2002; accepted 18 February 2003.