Research Article

Alteration of DNA adenine methylase (Dam) activity in Pasteurella multocida causes increased spontaneous mutation frequency and attenuation in mice

,, Daniel W. Scruggs2, Michelle M. Banes1, Brenda Y. Reeks1 and Mark L. Lawrence1

1 Department of Basic Sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State, MS 39762-6100, USA
2 Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi State, MS 39762-6100, USA

Correspondence
Mark L. Lawrence
lawrence{at}cvm.msstate.edu

Microbiology 2003; 149(8):2283 · https://doi.org/10.1099/mic.0.26251-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

Pasteurella multocida is one of the primary bacterial pathogens associated with bovine respiratory disease (BRD) complex. Relatively few virulence factors of P. multocida have been characterized, and there is a need for improved vaccines for prevention of BRD. In other Gram-negative species, DNA adenine methylase (Dam) regulates the expression of virulence genes, and appropriate expression of Dam is required for virulence. In this study, the authors cloned and sequenced the P. multocida A1 dam gene and demonstrated that it is able to restore Dam function in an Escherichia coli dam mutant. When P. multocida dam was placed under the control of a constitutively expressed promoter on a plasmid, it caused an increased spontaneous mutation rate in P. multocida. In addition, the plasmid-mediated alteration of Dam production in P. multocida caused it to be highly attenuated in mice. These findings indicate that appropriate expression of Dam is required for virulence of P. multocida, which is believed to be the first report that Dam is required for virulence of a species in the Pasteurellaceae. Therefore, Dam may function as a virulence gene regulator in the Pasteurellaceae, similar to previously reported findings from other Gram-negative species.
Abbreviations: BRD, bovine respiratory disease; Dam, DNA adenine methylase

The GenBank accession number for the sequence reported in this paper is AF411317.

The association of Pasteurella multocida with bovine respiratory disease (BRD) has been well known since the early 1950s (Carter, 1954). In most survey studies of feedlot BRD, Mannheimia haemolytica has been the most commonly isolated species, followed closely by Pasteurella multocida, with fewer cases of Haemophilus somnus (Collier, 1969; Purdy et al., 1997; Scheifer et al., 1978). However, in some studies, P. multocida is the most common isolate (Allen et al., 1991; Singer et al., 1998), and many BRD investigators have become convinced that P. multocida is an important primary pathogen in BRD (Gourlay et al., 1989; Purdy et al., 1997). In young dairy calves, P. multocida is the most frequently isolated species from cases of pneumonia (Bryson et al., 1978; Virtala et al., 1996). P. multocida is also an important pathogen of poultry, swine, rabbits, and occasionally humans.

P. multocida is a commensal of the bovine upper respiratory tract (Allen et al., 1991). Induction of disease is often associated with stress, especially from transportation. Proposed virulence factors include polysaccharide capsule (Boyce & Adler, 2000), lipopolysaccharide (Brogden et al., 1986; Rimler & Rhoades, 1989), iron-regulated outer-membrane proteins (Confer et al., 2001; Geschwend et al., 1997), proteases (Negrete-Abascal et al., 1999; Straus et al., 1998), neuraminidase (Straus et al., 1998; White et al., 1995), and porins (Galdiero et al., 1998; White et al., 1995). Using signature-tagged mutagenesis, 25 genes were identified that, when inactivated, reduce virulence using a mouse intraperitoneal model (Fuller et al., 2000). These genes were classified into four general categories: regulatory, biosynthetic, known virulence factors, and unknown/novel. The whole genome sequence of an avian P. multocida isolate was published in 2001 (May et al., 2001), which allowed identification of 104 potential virulence-related genes by homology searches. However, the mechanisms that control expression of these potential virulence factors have not been determined.

DNA adenine methylase (Dam) is an important virulence gene regulator in the Enterobacteriaceae. In Escherichia coli, Dam regulates transcription of several pili operons, including the pap (pyelonephritis-associated pili) (Blyn et al., 1990; Braaten et al., 1994), sfa (S pili), fae (K88 pili) and daa (F1845 pili) operons (van der Woude & Low, 1994), and it regulates expression of a major outer-membrane protein (Ag43) (Henderson & Owen, 1999). A Salmonella enterica serovar Typhimurium dam mutant strain had altered expression of more than 20 in vivo-induced (ivi) genes (elevated by 2- to 18-fold in a Dam-inactivated mutant compared to a wild-type Dam-positive strain) (Heithoff et al., 1999).

In several bacterial species that possess a dam gene, alteration of dam expression causes substantial attenuation, as well as enhanced protective immunogenicity (Heithoff et al., 1999). A S. enterica serovar Typhimurium dam mutant had an LD50 that was >104 higher than the wild-type parent strain, and it was effective as a live attenuated vaccine after a single oral dose (Heithoff et al., 1999). A dam-overexpressing strain was also highly attenuated in mice (Heithoff et al., 1999). In Yersinia pseudotuberculosis and Vibrio cholerae, inactivation of the dam gene was shown to be a lethal mutation (Julio et al., 2001). However, plasmid-mediated overexpression of the dam gene in Y. pseudotuberculosis resulted in a >6000-fold increase in LD50 in mice compared to wild-type and a fivefold defect in colonization of V. cholerae in a suckling mouse model compared to wild-type (Julio et al., 2001).

Although dam genes have been identified in the Pasteurellaceae as a result of genome sequencing projects (Fleischmann et al., 1995; May et al., 2001), there have been no reports of functional characterization of Dam in any of these species. In this study, we demonstrate the presence of Dam function in P. multocida, and show that alteration of Dam function in a serotype A1 fowl cholera strain causes increased spontaneous mutation rate and attenuation in a mouse model.

Bacterial strains and plasmids.
A list of the bacterial strains and plasmids used in this study is shown in Table 1. Pasteurella multocida ATCC 11039, which is a fowl cholera strain, was selected for this study because it has a well-characterized mouse model that can be used to assess virulence (Chung et al., 2001; Homchampa et al., 1992). Escherichia coli strains were grown at 37 °C on LuriaBertani (LB) agar or broth. P. multocida strains were grown at 37 °C on brain-heart infusion (BHI) agar or broth. For plasmid maintenance, antibiotics were used at the following final concentrations: ampicillin, 200 µg ml-1; kanamycin, 50 µg ml-1; and streptomycin, 80 µg ml-1. IPTG and X-Gal were used at final concentrations of 80 µM and 70 µg ml-1, respectively, for blue/white screening on LB agar.


Table 1. Bacterial strains and plasmids


Detection of Dam function in P. multocida.
To determine whether P. multocida contains a functional dam gene, we used differential digestion with restriction endonucleases Sau3AI, MboI and DpnI (New England BioLabs) (Palmer & Marinus, 1994). First, genomic DNA was isolated from a 100 ml culture of P. multocida 11039 by phenol/chloroform extraction followed by precipitation with 2-propanol (Ausubel et al., 1994). Genomic DNA (1 µg) was then digested for 1 h with 2 units of Sau3AI, which cleaves GATC sites regardless of methylation state, 10 units of DpnI, which only cleaves GATC sites whose adenine residue has been methylated, and 2·5 units of MboI, which only cleaves unmethylated GATC sites. Digested DNA was visualized by agarose gel electrophoresis.

Cloning and sequencing the P. multocida A1 dam gene.
The P. multocida A3 chromosomal sequence (May et al., 2001) flanking the dam gene was analysed for PCR primer suitability, and two oligonucleotide primers, Pm1219DamM (TGAGGCAACGGTCTGGTTCTC) and Pm1223DamP (GCTGGAAAATTGCGTCTCGTC) were selected. Using P. multocida ATCC 11039 genomic DNA as the template, a 3 kb amplicon containing the P. multocida dam gene and flanking sequences was produced under the following cycling conditions: 95 °C, 2 min; 35x(95 °C, 30 s; 64 °C, 1 min; 72 °C, 2 min); 72 °C, 10 min.

The 3 kb P. multocida PCR fragment containing the dam gene and flanking sequences was ligated into pT7Blue (Novagen) by blunt-end ligation using the Perfectly Blunt Cloning Kit (Novagen) according to the manufacturer's protocol, followed by transformation into NovaBlue Singles Competent Cells (Novagen). Plasmid DNA was isolated from white colonies using the QIAprep spin miniprep kit (Qiagen), and one clone with the predicted insert size was selected and designated pCLPm2 (Fig. 1a).



(13K):

Fig. 1. (a) Map of pCLPm2. Locations of T7 and U19 primers used to amplify the pCLPm2 insert are indicated by black triangles. (b) Map of pCLPm3. Locations of T7P1 and CLDamM20 primers used to amplify a portion of pCLPm3 for construction of pLSdam are indicated by black triangles. AflIII and HindIII sites were used in construction of pLSdam2.

To determine the complete sequence of the P. multocida A1 dam gene, a portion of the pCLPm2 insert was sequenced on both strands using the Applied Biosystems Dye Terminator Cycle Sequencing Ready Reaction Kit protocol for sequencing double-stranded plasmid DNA. Sequencing reactions were resolved on an Applied Biosystems Prism 310 Genetic Analyser. Percentage identities with previously published dam sequences were determined using the CLUSTAL W method (Thompson et al., 1994) with MegAlign v5.0 (DNAStar). Prokaryotic promoters were predicted with the assistance of Neural Network Promoter Prediction (Reese et al., 1996). The final sequence of the P. multocida A1 dam gene was deposited in GenBank (accession AF411317).

Expression of the P. multocida A1 dam gene from a lacZ promoter.
To orient the P. multocida dam gene downstream of a lacZ promoter, the insert from pCLPm2 was subcloned into pBluescript. Using pCLPm2 DNA as template, a 3 kb fragment containing the P. multocida dam gene was amplified by PCR with primers T7 and U19 using cycle conditions 95 °C, 2 min; 35x(95 °C, 30 s; 57 °C, 1 min; 72 °C, 2 min); 72 °C, 10 min. The 3 kb band was excised from a 0·7 % agarose gel, and DNA was eluted using the Qiaquick gel extraction kit. The ends of the 3 kb fragment were digested with BamHI and SalI and ligated into pBluescript. One clone with the predicted insert size was selected and designated pCLPm3 (Fig. 1b). One end of the insert was sequenced to confirm correct orientation of the dam gene in relation to the lacZ promoter using the T3 primer.

Complementation of an E. coli dam mutant.
Plasmids pCLPm2 and pCLPm3 were transferred into E. coli dam mutant strain DG105 by electroporation (Ausubel et al., 1994). To assess Dam function in the resulting strains, genomic DNA was isolated from DG105, DG105/pCLPm2, DG105/pCLPm3 and E. coli parent strain DG98; 0·20·3 µg genomic DNA was digested for 1 h with 2 units of Sau3AI, 10 units of DpnI and 2·5 units of MboI, and analysed by 0·5 % agarose gel electrophoresis.

Effect of Dam alteration in P. multocida.
To alter Dam production in P. multocida strain 11039, the insert from pCLPm3 was transferred into pLS88, a shuttle vector that replicates both in E. coli and in the Pasteurellaceae (Willson et al., 1989). Two pLS88 derivatives were constructed from pCLPm3: pLSdam, which has the P. multocida dam gene with no exogenous promoter, and pLSdam2, which has the P. multocida dam gene expressed from the lacZ promoter.

To construct pLSdam, a 1·7 kb fragment was amplified from pCLPm3 (Fig. 1b) by PCR using primers T7P1 (GGATCCTGCGTTATCCCCTGATT) and CLDamM20 (TCTAGATGTTGCCAATGCCAGTGTA) using cycle conditions 95 °C, 2 min; 35x(95 °C, 30 s; 67·5 °C, 1 min; 72 °C, 30 s); 72 °C, 10 min. The 1·7 kb amplicon was digested with BamHI, which removed the lacZ promoter from pBluescript, and XbaI, which digested within the CLDamM20 primer, and ligated into BamHI- and XbaI-digested pLS88 that had been modified by insertion of a pUC19 polylinker (pLS88/poly; J. Sanders, personal communication).

To construct pLSdam2, pCLPm3 was digested with AflIII and HindIII (Fig. 1b), followed by treatment with the Klenow fragment of DNA polymerase I to create blunt ends. The resulting 1·6 kb fragment from pCLPm3 retained the P. multocida dam gene downstream of the lacZ promoter. The 1·6 kb fragment was excised from a 0·7 % agarose gel, eluted using the Qiaquick gel extraction kit, and ligated into EcoRV-digested pLS88.

Both pLSdam and pLSdam2 were transferred into P. multocida 11039 by electroporation using described conditions (Jablonski et al., 1992) with a Bio-Rad Gene Pulser II.

Effect of altered Dam production on P. multocida spontaneous mutation frequency.
Overproduction of Dam in E. coli causes an increased spontaneous mutation frequency (Herman & Modrich, 1981; Marinus et al., 1984). To determine whether altered Dam production in P. multocida has the same effect, we compared the spontaneous mutation frequencies of wild-type strain 11039, 11039/pLSdam, and 11039/pLSdam2 by measuring the spontaneous development of rifampicin resistance (Ostendorf et al., 1999). Briefly, 5 ml cultures of each strain were started from single colonies, incubated for 18 h, and aliquots (0·1 ml) of the diluted suspensions were spread in triplicate on BHI plates with 100 µg rifampicin ml-1. The cultures were also serially diluted in PBS, and viable bacterial counts were determined by spreading diluted bacterial suspensions on BHI plates without antibiotics.

Mutation rates for each strain were determined by dividing the number of rifampicin-resistant mutants by the total viable bacterial counts. Five independent replicates of the experiment were run from separate bacterial cultures, and the mean mutation rates of the strains were compared by analysis of variance (ANOVA) for a randomized complete block design with run as the blocking factor. If significant differences among strains were found at the 5 % level of significance, means were separated using the least significant difference test, and 95 % confidence intervals were calculated to characterize the biological importance of those differences. The homogeneity of variances and normality assumptions necessary for valid application of ANOVA were examined by Levene's test and by stem-and-leaf and normal probability plots, respectively. Statistical computations were performed using the SAS System for Windows, Version 8 (SAS Institute).

Mouse virulence assay.
The virulence of 11039/pLSdam2 was compared to 11039 and 11039/pLSdam using a mouse model with five mice per treatment. Female 68-week-old BALB/cJ mice were obtained from the Jackson Laboratory, randomly divided into nine cages, and allowed to acclimate for 1 week. Bacterial broth cultures (11039, 11039/pLSdam and 11039/pLSdam2) were incubated for 18 h and serially diluted in normal saline solution. Mice were injected intraperitoneally with 0·1 ml of either 11039, 11039/pLSdam or 11039/pLSdam2. Three treatments were challenged with different doses of 11039 (3·4, 34 and 340 c.f.u. per mouse), three were challenged with 11039/pLSdam (2·0, 20 and 200 c.f.u. per mouse), and four were challenged with 11039/pLSdam2 (33, 330, 3·3x103 and 3·3x104 c.f.u. per mouse), and one treatment was sham-exposed to PBS. Mice were monitored for 7 days, and each mortality was necropsied and cultured from the spleen to confirm cause of death.

Phenotypic detection of Dam function in P. multocida
Sau3AI, DpnI and MboI all recognize and cleave GATC sequences. However, DpnI only cleaves GATC sites whose adenine residue has been methylated, while MboI only cleaves unmethylated GATC sites. Sau3AI cleaves GATC sites regardless of methylation state. Therefore, differential digestion of bacterial genomic DNA with Sau3AI, DpnI and MboI can be used to detect Dam activity. Because MboI failed to cleave P. multocida 11039 DNA and DpnI cleaved the same DNA (Fig. 2, lanes 3 and 4), our results indicated that P. multocida has functional Dam activity.



(74K):

Fig. 2. Differential digests of genomic DNA from P. multocida 11039. Lanes: 1, 1 Kb Plus DNA Ladder (Life Technologies); 2, undigested P. multocida genomic DNA; 3, P. multocida genomic DNA digested with MboI; 4, P. multocida DNA digested with DpnI; 5, P. multocida DNA digested with Sau3AI.

P. multocida A1 dam gene sequence results
The P. multocida A1 dam sequence was found to be 99·4 % identical to the published P. multocida A3 dam sequence. The deduced amino acid sequences of the P. multocida A1 and A3 Dam proteins were 100 % identical.

As expected, the P. multocida dam gene had higher sequence identity with the Haemophilus influenzae dam gene than with the other reported bacterial dam gene sequences. Among Gram-negative species, the dam gene is well conserved across four families, with identities ranging between 50 and 60 %. The P. multocida dam ORF was the largest of the currently identified dam genes. By CLUSTAL W alignment, the additional coding sequence for the P. multocida dam ORF was located at the 5' end of the gene, with an extra 39 bp at the 5' end of the gene compared to H. influenzae dam and an extra 72 bp at the 5' end compared to dam sequences from other species.

aroB in P. multocida is located immediately upstream of dam with only a 4 bp gap between the genes, which is similar to the arrangement in H. influenzae. Our promoter analysis detected a potential promoter upstream of P. multocida dam within the aroB coding sequence. The 5' end of this promoter was located 115 bp upstream of the P. multocida dam start codon and had the sequence TGGAAA17 bpTAGCGT5 bpG.

Complementation of an E. coli dam mutant
As described in Methods, pCLPm2 contains the P. multocida dam gene cloned in the opposite orientation to the lacZ promoter in pT7Blue, while pCLPm3 contains the P. multocida dam gene oriented downstream of the lacZ promoter in pBluescript. When these plasmids were transferred into E. coli dam mutant strain DG105, both restored Dam function (Fig. 3). MboI-digested genomic DNA from DG105/pCLPm3 was indistinguishable from undigested DNA (Fig. 3, lanes 6 and 7), similar to parent strain DG98 (Fig. 3, lanes 10 and 11). However, it appeared that MboI did cause some partial digestion of DG105/pCLPm2 (Fig. 3, lane 3), suggesting that GATC methylation may not have been as efficient in this strain as in DG105/pCLPm3. The pCLPm2 insert contained only 117 bp of native P. multocida chromosomal sequence upstream of the dam start codon, suggesting that the sequence we identified as a potential promoter within the 115 bp upstream of the P. multocida dam gene is functional.



(63K):

Fig. 3. Differential digests of genomic DNA from E. coli dam mutant DG105, E. coli parent strain DG98, and DG105 carrying P. multocida dam under the control of its native promoter (pCLPm2) or a lacZ promoter (pCLPm3). Lanes: 1, 1 Kb Plus DNA ladder; 2, undigested genomic DNA from DG105/pCLPm2; 3, DG105/pCLPm2 genomic DNA digested with MboI; 4, DG105/pCLPm2 digested with DpnI; 5, DG105/pCLPm2 digested with Sau3AI; 6, undigested DG105/pCLPm3; 7, DG105/pCLPm3 digested with MboI; 8, DG105/pCLPm3 digested with DpnI; 9, DG105/pCLPm3 digested with Sau3AI; 10, undigested DG98; 11, DG98 digested with MboI; 12, DG98 digested with DpnI; 13, DG98 digested with Sau3AI; 14, undigested DG105; 15, DG105 digested with MboI; 16, DG105 digested with DpnI; 17, DG98 digested with Sau3AI; 18, 1 Kb Plus DNA ladder.

Effect of Dam production on spontaneous mutation rate in P. multocida
Plasmid pLSdam is similar to pCLPm2 in that the insert contains the P. multocida dam gene under the control of its native promoter, while pLSdam2 is similar to pCLPm3 in that dam is expressed from a lac promoter. Both plasmids were transferred into P. multocida 11039 to compare the abilities of the lac promoter and the putative native dam promoter to cause altered Dam phenotypes in P. multocida.

Transfer of pLSdam into strain 11039 caused no statistically significant effect on the spontaneous mutation rate compared to the wild-type strain (0·3 spontaneous mutants per 107 c.f.u. for wild-type 11039 compared to 0·14 mutants per 107 c.f.u. for 11039/pLSdam). However, the spontaneous mutation rate for 11039/pLSdam2 was 7·9 times higher (2·4 mutants per 107 c.f.u.) than the rate for 11039, which was a statistically significant increase (P<0·05). This indicates that the lac promoter was effective in altering dam expression in P. multocida and that altered Dam activity affects the mutability of P. multocida.

Mouse virulence assay
Our virulence assay demonstrated that 11039/pLSdam2 was clearly attenuated in mice compared to 11039 and 11039/pLSdam. Mice injected with 11039 at all three doses (down to 3·4 c.f.u. per mouse) had 100 % mortality, and mice injected with 11039/pLSdam (down to 2·0 c.f.u. per mouse) also had 100 % mortality. In contrast, mice injected with 11039/pLSdam2 at all four doses (up to 3·3x104 c.f.u. per mouse) had 0 % mortality. Sham control mice also had 0 % mortality. P. multocida was recovered from the spleens of all mice that died during the trial.

In this study, we demonstrated the presence of Dam activity in P. multocida, which is an important aetiological agent of BRD in cattle, and we examined the function of Dam from P. multocida. In other bacterial species, Dam is important in regulating and coordinating several cell functions, including initiation of chromosome replication, DNA repair, and gene transcription. As a result of the role of Dam in DNA repair, bacteria with altered Dam activity have increased mutability. Its role in regulation of gene transcription, particularly of genes involved in pathogenicity, causes strains with altered Dam activity to be attenuated. Therefore, in the current study we measured the effects of altered P. multocida Dam activity on these two phenotypes: spontaneous mutation frequency and virulence in a mouse model.

The E. coli dam gene is part of a superoperon that includes several genes under complex regulatory control (Jonczyk et al., 1989). Immediately upstream of E. coli dam is urf, which is preceded by aroB and aroK. A 92 bp gap is between aroB and urf, and a 107 bp gap is between dam and urf. The aroK and aroB products function in aromatic amino acid biosynthesis, while urf and dam are involved in cell cycle regulation. No promoter activity is located immediately upstream of E. coli dam, but a weak promoter is located upstream of urf within the aroB sequence (Jonczyk et al., 1989). Another strong promoter is located upstream of aroB.

P. multocida Dam has 55 % identity with E. coli Dam, and our results demonstrated that it complements an E. coli dam mutant. The putative native dam promoter sequence we identified on pCLPm2 (located within the aroB coding sequence) appeared relatively weak, having 5/12 mismatches compared to the E. coli consensus promoter. Similarly, in E. coli, the promoter upstream of dam and urf located within the aroB coding sequence is also relatively weak, having three to four times less activity than another promoter located upstream of aroB (Jonczyk et al., 1989). Our result from digestion of DG105/pCLPm2 with MboI also suggested that the P. multocida native promoter contained within the aroB coding sequence on the pCLPm2 insert is relatively weak. Partial digestion of chromosomal DNA was evident in DG105/pCLPm2 (Fig. 2), suggesting that GATC methylation of chromosomal DNA was incomplete. Perhaps P. multocida is similar to E. coli in that a promoter upstream of aroB is more important in expressing the P. multocida dam gene than the promoter immediately upstream of dam.

E. coli dam mutants have an increased rate of spontaneous mutations, increased sensitivity to ultraviolet radiation and to base analogues such as 2-aminopurine, and unviability when combined with a recA, recB or recC mutation (Bale et al., 1979; Glickman et al., 1978; Marinus & Morris, 1974). Dam methylates DNA at the N6 position of adenine within GATC recognition sequences (Geier & Modrich, 1979), which allows the methyl-directed mismatch repair system to distinguish between the template and nascent strands to correct misincorporated bases during DNA replication (Glickman et al., 1978; Modrich, 1989). Interestingly, overproduction of Dam also increases mutability because methylation of the daughter strand occurs too quickly, which also prevents the mismatch repair system from distinguishing between the template and daughter strands (Herman & Modrich, 1981; Marinus et al., 1984).

When the P. multocida dam gene was expressed from its native promoter in strain 11039 using shuttle vector pLS88 (pLSdam), there was no significant increase in spontaneous mutation frequency. On the other hand, expression of P. multocida dam from a lacZ promoter in 11039/pLSdam2 did cause increased spontaneous mutation frequency, which is probably a result of unregulated Dam production. Because pLSdam and pLSdam2 are derived from the same parent plasmid, the increased mutation frequency caused by pLSdam2 is not likely to be the result of increased copy number. Rather, it is probably the result of either a stronger promoter sequence (the lacZ promoter more closely matches the consensus E. coli promoter than the native dam promoter does) or the absence of transcriptional regulation that may affect the native P. multocida dam promoter.

Dam-overproducing strains of S. enterica, Y. pseudotuberculosis and V. cholerae are all attenuated (Heithoff et al., 1999; Julio et al., 2001). Similarly, our Dam-overproducing P. multocida strain was attenuated using a mouse model. The attenuation of strains with altered dam expression is apparently due to inappropriate expression of virulence factors that results from the failure of Dam to regulate their transcription (Heithoff et al., 1999). In Salmonella, a similar attenuating effect occurs in dam deletion mutants (Heithoff et al., 1999); mutation of the dam gene is lethal in Y. pseudotuberculosis and V. cholerae (Julio et al., 2001).

Interestingly, the inappropriate expression of virulence factors in Dam-altered S. enterica, Y. pseudotuberculosis and V. cholerae not only causes attenuation, but it also renders them highly effective as live attenuated vaccines (Heithoff et al., 1999, 2001; Julio et al., 2001). Although P. multocida antigens have been identified that have potential as vaccines (Adler et al., 1999; Confer et al., 1996), an effective P. multocida BRD vaccine is still lacking. Killed bacterins have little effect in preventing BRD (Cardella et al., 1987); however, live vaccines have improved efficacy (Cardella et al., 1987; Chengappa et al., 1989; Panciera et al., 1984). Therefore, alteration of dam expression in P. multocida may be a viable strategy for development of a live attenuated vaccine.

This project was funded by the Mississippi State University College of Veterinary Medicine and by the Mississippi Agricultural and Forestry Experiment Station (MAFES). We are grateful to Dr Michele Wilkinson for her technical assistance during the mouse virulence trials and to Dr Carolyn Boyle for her assistance in statistical analysis. We thank Drs Larry Hanson, Todd Pharr and Shane Burgess for their critical review of this manuscript. This is MAFES publication no. J10343.

Footnotes

,, Daniel B. Paulsen2Present address: Biostatistics Division, University of Minnesota, 420 Delaware St SE, Minneapolis, MN 55455, USA. Present address: Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70808, USA.

References

Adler, B., Bulach, D., Chung, J., Doughty, S., Hunt, M., Rajakumar, K., Serrano, M., van Zanden, A., Zhang, Y. & Ruffolo, C. (1999). Candidate vaccine antigens and genes in Pasteurella multocida. J Biotechnol 73, 8390.[CrossRef][Medline]

Allen, J. W., Viel, L., Bateman, K. G., Rosendal, S., Shewen, P. E. & Physick-Sheard, P. (1991). The microbial flora of the respiratory tract in feedlot calves: associations between nasopharyngeal and bronchoalveolar lavage cultures. Can J Vet Res 55, 341346.[Medline]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1994). Current Protocols in Molecular Biology. New York: Wiley.

Bale, A., d'Alarcao, M. & Marinus, M. G. (1979). Characterization of DNA adenine methylation mutants of Escherichia coli K12. Mutat Res 59, 157165.[CrossRef][Medline]

Blyn, L. B., Braaten, B. A. & Low, D. A. (1990). Regulation of pap pilin phase variation by a mechanism involving differential dam methylation states. EMBO J 9, 40454054.[Medline]

Boyce, J. D. & Adler, B. (2000). The capsule is a virulence determinant in the pathogenesis of Pasteurella multocida M1404 (B : 2). Infect Immun 68, 34633468.[Abstract/Free Full Text]

Braaten, B. A., Nou, X., Kaltenbach, L. S. & Low, D. A. (1994). Methylation patterns in pap regulatory DNA control pyelonephritis-associated pili phase variation in E. coli. Cell 76, 577588.[CrossRef][Medline]

Brogden, K. A., Rimler, R. B., Cutlip, R. C. & Lehmkuhl, H. D. (1986). Incubation of Pasteurella haemolytica and Pasteurella multocida lipopolysaccharide with sheep lung surfactant. Am J Vet Res 47, 727729.[Medline]

Bryson, D. G., McFerran, J. B., Ball, H. J. & Neill, S. D. (1978). Observations on outbreaks of respiratory disease in housed calves. (1) Epidemiological, clinical and microbiological findings. Vet Rec 103, 485489.[Abstract]

Cardella, M. A., Adviento, M. A. & Nervig, R. M. (1987). Vaccination studies against experimental bovine Pasteurella pneumonia. Can J Vet Res 51, 204211.[Medline]

Carter, G. (1954). Observations on the pathology and bacteriology of shipping fever in Canada. Can J Comp Med 18, 359364.

Chengappa, M. M., McLaughlin, B. G., Kadel, W. L., Maddux, R. L. & Greer, S. C. (1989). Efficacy of a live Pasteurella multocida vaccine for the prevention of experimentally induced bovine pneumonic pasteurellosis. Vet Microbiol 21, 147154.[CrossRef][Medline]

Chung, J. Y., Wilkie, I., Boyce, J. D., Townsend, K. M., Frost, A. J., Ghoddusi, M. & Adler, B. (2001). Role of capsule in the pathogenesis of fowl cholera caused by Pasteurella multocida serogroup A. Infect Immun 69, 24872492.[Abstract/Free Full Text]

Collier, J. (1969). Pasteurellae in bovine respiratory disease. J Am Vet Med Assoc 140, 807810.

Confer, A. W., Nutt, S. H., Dabo, S. M., Panciera, R. J. & Murphy, G. L. (1996). Antibody responses of cattle to outer membrane proteins of Pasteurella multocida A : 3. Am J Vet Res 57, 14531457.[Medline]

Confer, A. W., Suckow, M. A., Montelongo, M., Dabo, S. M., Miloscio, L. J., Gillespie, A. J. & Meredith, G. L. (2001). Intranasal vaccination of rabbits with Pasteurella multocida A : 3 outer membranes expressing iron-regulated proteins. Am J Vet Res 62, 697703.[CrossRef][Medline]

Fleischmann, R. D., Adams, M. D., White, O. & 37 other authors (1995). Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269, 496512.[Abstract/Free Full Text]

Fuller, T. E., Kennedy, M. J. & Lowery, D. E. (2000). Identification of Pasteurella multocida virulence genes in a septicemic mouse model using signature-tagged mutagenesis. Microb Pathog 29, 2538.[CrossRef][Medline]

Galdiero, M., Palomba, E., De, L., Vitiello, M. & Pagnini, P. (1998). Effects of the major Pasteurella multocida porin on bovine neutrophils. Am J Vet Res 59, 12701274.[Medline]

Geier, G. E. & Modrich, P. (1979). Recognition sequence of the dam methylase of Escherichia coli K12 and mode of cleavage of DpnI endonuclease. J Biol Chem 254, 14081413.[Abstract/Free Full Text]

Geschwend, G., Feist, H. & Erler, W. (1997). Investigation of outer membrane proteins of Pasteurella. 2. Iron-regulated outer membrane proteins of Pasteurella multocida and Pasteurella haemolytica. Berl Munch Tierarztl Wochenschr 110, 386390.[Medline]

Glickman, B., van den Elsen, P. & Radman, M. (1978). Induced mutagenesis in dam- mutants of Escherichia coli: a role for 6-methyladenine residues in mutation avoidance. Mol Gen Genet 163, 307312.[CrossRef][Medline]

Gourlay, R. N., Thomas, L. H. & Wyld, S. G. (1989). Experimental Pasteurella multocida pneumonia in calves. Res Vet Sci 47, 185189.[Medline]

Heithoff, D. M., Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (1999). An essential role for DNA adenine methylation in bacterial virulence. Science 284, 967970.[Abstract/Free Full Text]

Heithoff, D. M., Enioutina, E. Y., Daynes, R. A., Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (2001). Salmonella DNA adenine methylase mutants confer cross-protective immunity. Infect Immun 69, 67256730.[Abstract/Free Full Text]

Henderson, I. R. & Owen, P. (1999). The major phase-variable outer membrane protein of Escherichia coli structurally resembles the immunoglobulin A1 protease class of exported protein and is regulated by a novel mechanism involving Dam and oxyR. J Bacteriol 181, 21322141.[Abstract/Free Full Text]

Herman, G. E. & Modrich, P. (1981). Escherichia coli K-12 clones that overproduce Dam methylase are hypermutable. J Bacteriol 145, 644646.[Abstract/Free Full Text]

Homchampa, P., Strugnell, R. A. & Adler, B. (1992). Molecular analysis of the aroA gene of Pasteurella multocida and vaccine potential of a constructed aroA mutant. Mol Microbiol 6, 35853593.[CrossRef][Medline]

Jablonski, L., Sriranganathan, N., Boyle, S. M. & Carter, G. R. (1992). Conditions for transformation of Pasteurella multocida by electroporation. Microb Pathog 12, 6368.[CrossRef][Medline]

Jonczyk, P., Hines, R. & Smith, D. W. (1989). The Escherichia coli dam gene is expressed as a distal gene of a new operon. Mol Gen Genet 217, 8596.[CrossRef][Medline]

Julio, S. M., Heithoff, D. M., Provenzano, D., Klose, K. E., Sinsheimer, R. L., Low, D. A. & Mahan, M. J. (2001). DNA adenine methylase is essential for viability and plays a role in the pathogenesis of Yersinia pseudotuberculosis and Vibrio cholerae. Infect Immun 69, 76107615.[Abstract/Free Full Text]

Marinus, M. G. & Morris, N. R. (1974). Biological function for 6-methyladenine residues in the DNA of Escherichia coli K12. J Mol Biol 85, 309322.[CrossRef][Medline]

Marinus, M. G., Poteete, A. & Arraj, J. A. (1984). Correlation of DNA adenine methylase activity with spontaneous mutability in Escherichia coli K-12. Gene 28, 123125.[CrossRef][Medline]

May, B. J., Zhang, Q., Li, L. L., Paustian, M. L., Whittam, T. S. & Kapur, V. (2001). Complete genomic sequence of Pasteurella multocida, Pm70. Proc Natl Acad Sci U S A 98, 34603465.[Abstract/Free Full Text]

Modrich, P. (1989). Methyl-directed DNA mismatch correction. J Biol Chem 264, 65976600.[Abstract/Free Full Text]

Negrete-Abascal, E., Tenorio, V. R. & de la Garza, M. (1999). Secretion of proteases from Pasteurella multocida isolates. Curr Microbiol 38, 6467.[CrossRef][Medline]

Ostendorf, T., Cherepanov, P., de Vries, J. & Wackernagel, W. (1999). Characterization of a dam mutant of Serratia marcescens and nucleotide sequence of the dam region. J Bacteriol 181, 38803885.[Abstract/Free Full Text]

Palmer, B. R. & Marinus, M. G. (1994). The dam and dcm strains of Escherichia coli a review. Gene 143, 112.[CrossRef][Medline]

Panciera, R. J., Corstvet, R. E., Confer, A. W. & Gresham, C. N. (1984). Bovine pneumonic pasteurellosis: effect of vaccination with live Pasteurella species. Am J Vet Res 45, 25382542.[Medline]

Purdy, C. W., Raleigh, R. H., Collins, J. K., Watts, J. L. & Straus, D. C. (1997). Serotyping and enzyme characterization of Pasteurella haemolytica and Pasteurella multocida isolates recovered from pneumonic lungs of stressed feeder calves. Curr Microbiol 34, 244249.[CrossRef][Medline]

Reese, M. G., Harris, N. L. & Eeckman, F. H. (1996). Large scale sequencing specific neural networks for promoter and splice site recognition. In Biocomputing: Proceedings of the 1996 Pacific Symposium. Edited by L. Hunter & T. E. Klein. Singapore: World Scientific Publishing Co.

Rimler, R. B. & Rhoades, K. R. (1989). Pasteurella multocida. San Diego, CA: Academic Press.

Scheifer, B., Ward, G. E. & Moffatt, R. E. (1978). Correlation of microbiological and histological findings in bovine fibrinous pneumonia. Vet Pathol 15, 313321.[Abstract]

Singer, R. S., Case, J. T., Carpenter, T. E., Walker, R. L. & Hirsh, D. C. (1998). Assessment of spatial and temporal clustering of ampicillin- and tetracycline-resistant strains of Pasteurella multocida and P. haemolytica isolated from cattle in California. J Am Vet Med Assoc 212, 10011005.[Medline]

Straus, D. C., Purdy, C. W., Loan, R. W., Briggs, R. F. & Frank, G. H. (1998). In vivo production of neuraminidase by Pasteurella haemolytica in market stressed cattle after natural infection. Curr Microbiol 37, 240244.[CrossRef][Medline]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.[Abstract/Free Full Text]

van der Woude, M. W. & Low, D. A. (1994). Leucine-responsive regulatory protein and deoxyadenosine methylase control the phase variation and expression of the sfa and daa pili operons in Escherichia coli. Mol Microbiol 11, 605618.[Medline]

Virtala, A. M., Mechor, G. D., Grohn, Y. T., Erb, H. N. & Dubovi, E. J. (1996). Epidemiologic and pathologic characteristics of respiratory tract disease in dairy heifers during the first three months of life. J Am Vet Med Assoc 208, 20352042.[Medline]

White, D. J., Jolley, W. L., Purdy, C. W. & Straus, D. C. (1995). Extracellular neuraminidase production by a Pasteurella multocida A : 3 strain associated with bovine pneumonia. Infect Immun 63, 17031709.[Abstract]

Willson, P. J., Albritton, W. L., Slaney, L. & Setlow, J. K. (1989). Characterization of a multiple antibiotic resistance plasmid from Haemophilus ducreyi. Antimicrob Agents Chemother 33, 16271630.[Abstract/Free Full Text]

Received 22 January 2003; revised 3 April 2003; accepted 22 April 2003.