PATHOGENS AND PATHOGENICITY

Effect of enzyme I of the bacterial phosphoenolpyruvate : sugar phosphotransferase system (PTS) on virulence in a murine model

  • 1Département de Génétique et Microbiologie, CMU, 9, Avenue de Champel, CH-1211 Genève, Switzerland
  • 2Departement für Chemie und Biochemie, Freiestrasse 3, Universität Bern, CH-3012, Bern, Switzerland
  • 3Arpida AG, Dammstrasse 36, CH-4142, Münchenstein, Switzerland
  • Correspondence
    Seema Mukhija
    smukhija{at}arpida.ch
  • Microbiology 2003; 149(9):2645–2652 · https://doi.org/10.1099/mic.0.26406-0

    View at publisher PubMed

    With thanks to our partners for supporting this archive.

    Abstract

    The phosphoenolpyruvate : sugar phosphotransferase system (PTS) catalyses translocation with concomitant phosphorylation of sugars and hexitols and it regulates metabolism in response to the availability of carbohydrates. The PTS forms an interface between energy and signal transduction and its inhibition is likely to have pleiotropic effects. It is present in about one-third of bacteria with fully sequenced genomes, including many common pathogens, but does not occur in eukaryotes. Enzyme I (ptsI) is the first component of the divergent protein phosphorylation cascade. ptsI deletions were constructed in Salmonella typhimurium, Staphylococcus aureus and Haemophilus influenzae and virulence of the mutants was characterized in an intraperitoneal mouse model. The log(attenuation) values were 2·3, 1·4 and 0·9 for the Sal. typhimurium, Sta. aureus and H. influenzae ptsI mutants, respectively. The degree of attenuation is correlated with the complexity of the respective PTS, which comprises approximately 40 components in Sal. typhimurium, but only 5 in H. influenzae.

    • Present address: Department of Research Policy, Erasmus University Medical Center Rotterdam, PO Box 1738, 3000 DR Rotterdam, The Netherlands.

    INTRODUCTION

    The bacterial phosphoenolpyruvate : sugar phosphotransferase system (PTS) mediates the uptake and phosphorylation of carbohydrates and controls metabolism in response to carbohydrate availability (Postma et al., 1996). Phosphotransferase systems (Fig. 1) consist of two ‘general’ cytoplasmic proteins, Enzyme I (EI) and HPr, a variable number of sugar-specific transport complexes (Enzymes IIsugar) and proteins involved in signal transduction (Paulsen et al., 1998). The general proteins, EI and HPr, transfer phosphoryl groups from phosphoenolpyruvate to the sugar transporters (EIIsugar). The signalling proteins upon activation by phosphorylation or dephosphorylation interact with DNA, mRNA, a protein target or transfer the phosphate to downstream components of a phosphorelay system. The PTS of Escherichia coli consists of 40 proteins most of which are subunits for about 20 transporters of different carbohydrate specificity. For Staphylococcus aureus eight PTS proteins are listed in the SWISS-PROT database and more can be identified in the genome sequence. The Haemophilus influenzae PTS contains five proteins, the general proteins and one transporter, whereas the genomes of Treponema pallidum and Chlamydia trachomatis contain several genes for PTS proteins, but none for carbohydrate-specific transporters. The one protein which is invariably present in all PTS is EI or the EI paralogue EINtr which functions in transcription regulation of nitrogen-related operons (Powell et al., 1995). EI is the first component at the top of divergent protein phosphorylation cascade. EI from different bacteria are highly homologous, but dissimilar to animal proteins, and most bacteria have only one gene for an EI functioning in carbohydrate uptake (Postma et al., 1996). EI consists of two domains, a stable N-terminal domain containing the phosphorylation site (His-189 in E. coli) and a C-terminal domain catalysing phosphoryltransfer from phosphoenolpyruvate to His-189 (Fomenkov et al., 1998; LiCalsi et al., 1991). A conserved active site structure, dissimilarity to animal proteins and pleiotropic function make EI appear a potential target of anti-infectives. Although EI is not essential for cell growth on a rich medium in the laboratory, a requirement for EI in a less friendly environment, for instance during infection, cannot be excluded. However, little is known about the role of the PTS for bacterial virulence. Shigella flexneri mutants resistant to fosfomycin and carrying a mutation extending from purC into the EI-encoding gene ptsI lost their ability to cause keratoconjunctivitis and to penetrate HeLa cells (Lycheva et al., 1980). PTS-dependent attenuation of virulence also was observed in mice infected with a fruR mutant of Sal. typhimurium. The recovery of bacteria from spleens infected with the fruR mutant was 20-fold less than the recovery from spleens infected with wild-type Sal. typhimurium, and the spleen size (splenomegaly) was not increased after infection with the fruR mutant (Saier & Chin, 1990). More recently, PTS genes have been identified on several occasions in screens for virulence factors (Edelstein et al., 1999; Hava & Camilli, 2002; Jones et al., 2000; Lau et al., 2001).

    Figure image not available in archive
    Fig. 1.

    Modular design of the bacterial PTS. Representative examples from the glucose, mannose and fructose family of PTS transporters of Sal. typhimurium and the complete PTS of H. influenzae are shown. The functional units EI, HPr, IIA, IIB and IIC are vertically aligned. Orthologues are shaded identically. FruA has a duplicated IIB domain. Domains of unknown function are shown as black boxes. Solid circles indicate the phosphorylation sites. Arrows indicate the direction of phosphotransfer between EI, HPr and the sugar-specific IIA and IIB domains. The protein symbols are drawn to scale with the pointed end marking the C terminus. SWISS-PROT accession numbers are indicated. P37178 (EINtr), Q8XGX0 (NPr) and Q8XEZ0 (IIANtr) are involved in linking carbon and nitrogen assimilation, but not in sugar transport (Powell et al., 1995). PEP, phosphoenolpyruvate; Man, mannose; Fru, fructose; Glc, glucose.

    To characterize the influence of the PTS upon virulence, Sal. typhimurium, Sta. aureus and H. influenzae with targeted mutations in ptsI genes were compared in an intraperitoneal mouse model.

    METHODS

    Bacterial strains, plasmids and media.

    Strains and plasmids are listed in Table 1. E. coli and Sal. typhimurium were grown at 37 °C in Luria–Bertani (LB) medium. H. influenzae was grown in Brain-heart infusion broth (BHI; Difco) supplemented with 10 μg haemin ml−1 (Sigma) and 2 μg NAD ml−1 (Sigma) at 37 °C in CO2 incubator with 5 % CO2. H. influenzae was made competent in starvation medium IV (M-IV) (Barcak et al., 1991) and plated on BHI (sBHI) medium freshly prepared immediately before use. Sta. aureus SA70 was grown in Tryptic Soy Broth (TSB; Difco) and on Tryptic Soy Agar (TSA; Difco) at 37 °C. PTS sugar fermentation by E. coli and Sal. typhimurium was assayed on MacConkey base agar (Difco) supplemented with 0·4 % PTS sugars. PTS sugar fermentation by H. influenzae was assayed on Phenol Red Agar (Difco) supplemented with 10 % BHI, 10 mg haemin ml−1, 20 μg NAD ml−1 and 0·5 % sugar. Sugar utilization by Sta. aureus was assayed on dehydrocholic acid/neutral red medium (Morse & Alire, 1958).

    Table 1.

    Bacterial strains and plasmids

    Construction of ptsI mutants.

    Sal. typhimurium ATCC 14028 ΔptsI was constructed as follows. A lysate of bacteriophage P22 was prepared on Sal. typhimurium PP1591 and used to transduce the ptsI421 : : Tn10 allele into the mouse-pathogenic strain ATCC 14028. Transductants were selected on mineral salts agar supplemented with 10 μg tetracycline ml−1 and 1 % glycerol. Sal. typhimurium ATCC 14028 ΔptsI formed yellow colonies on MacConkey indicator plates supplemented with glucose, mannose and N-acetylglucosamine, indicating that it had lost PTS sugar transport activity.

    Sta. aureus SA70 ΔptsI was constructed as follows. A 5′ DNA fragment of ptsI (SWISS-PROT accession no. P51183) was PCR-amplified from genomic DNA with primers AATGGATCCTAGGTGCTATAATAGTTTT and CCTTGTACGAATTCTTTATTTAATTGAG (restriction sites are underlined). A 3′ fragment was similarly amplified with primers GTATCTGCAGATATAGAACTGAGTTTTTAT and GCACAGTCGACTGCACGGTTAGCAAGTT. The two fragments were sequentially inserted into the multiple cloning site of the E. coliStaphylococcus shuttle vector pBT2 (Bruckner, 1997). The erythromycin resistance cassette isolated by digestion of plasmid pEC7 (Bruckner, 1997) with EcoRI and PstI was then inserted between the cloned 5′ and 3′ fragments of ptsI in pBT2 (Fig. 2). Sta. aureus SA70 was electroporated with the recombinant shuttle plasmid (Gibco-BRL Cell Porator capacitance; 60 μF and voltage booster at 2 kΩ) and transformants were selected on LB agar plates supplemented with 20 μg chloramphenicol ml−1. Cells from a single colony were grown at 30 °C to late-stationary phase in TSB containing 10 μg erythromycin ml−1. The culture was then diluted 1 : 100 into 500 ml fresh TSB containing 2·5 μg erythromycin ml−1 and incubated at 40 °C until stationary phase. This enrichment culture was repeated once more in the presence of erythromycin and then one time in the absence of erythromycin always at 40 °C. Cells from the stationary-phase culture were plated on TSA plates supplemented with 2·5 μg erythromycin ml−1 and incubated at 37 °C. Colonies were gridded on plates supplemented with 2·5 μg erythromycin ml−1 and 20 μg chloramphenicol ml−1, respectively. Of the erythromycin-resistant colonies, 5 % were chloramphenicol-sensitive and scored as ptsI knockouts. Sugar utilization ability of the wild-type and ptsI mutant was checked by acid production on dehydrocholic acid/neutral red medium as described by Morse et al. (1958). The interruption of the ptsI by the erythromycin cassette was confirmed by PCR.

    Figure image not available in archive
    Fig. 2.

    Construction of gene interruptions in ptsI. Arrows indicate ptsI genes and operons with their transcriptional orientation. Filled boxes indicate location and length of the PCR fragments which were used for interruption of ptsI by homologous recombination. Open boxes indicate the antibiotic resistance genes. SWISS-PROT accession numbers are indicated.

    H. influenzae ATCC 10211 ΔptsI was constructed as follows. A 1·6 kb 5′ DNA fragment of the ptsHIcrr operon (SWISS-PROT P43921, P43922) was PCR-amplified from genomic DNA with primers GGGGGGGAATTCAATCAAATAATGCGAAAACAT and GGGGGGGGATCCTGCGTCAATTTGATCATCA (restriction sites are underlined). A 1·2 kb 3′ fragment was similarly amplified with primers GGGGGGGTCGACTGCAGAAATTGATCAATTAAT and GGGGGGCATGCGAAGATTGTTGCTAATGCA. The kanamycin-resistance gene from plasmid pACYC177 was PCR-amplified with primers GGGGGGGATCCTCAACTCAGCAAAAGTTC and GGGGGGGTCGACGTGATCTGATCCTTCAAC. The PCR primers were designed based on the DNA sequence of ptsI (Fleischmann et al., 1995) and pACYC177 (Chang & Cohen, 1978), respectively. The three PCR fragments were cloned into the polylinker of pJF119EH (Furste et al., 1986) to give pJFΔptsI : : kan. H. influenzae ATCC 10211 was made competent in M-IV medium and transformed with pJFΔptsI : : kan by glycerol stimulation (Stuy & Walter, 1986). Transformants were spread on Phenol Red Agar (Difco) supplemented with 10 mg haemin ml−1, 2 μg NAD ml−1, 10 % BHI medium, 0·5 % fructose and 25 μg kanamycin ml−1. Kanamycin-resistant colonies were red, whereas colonies of wild-type cells were yellow on the same medium and did not grow in the presence of kanamycin.

    Mice and infection procedures.

    Wild-type and mutant strains were passaged three times and recovered from the spleens of infected mice, prior to virulence tests. Three-week-old female BALB/c mice (University of Geneva Hospital) were inoculated in quintuplicate intraperitoneally (i.p.) with 0·5 ml of the serially diluted bacterial suspensions. The exact dose (c.f.u. ml−1) was measured by serial dilution and plating of the bacterial suspensions which were used for injection. Mice were inspected regularly for signs of disease and death over 2–14 days (dependent on the model) and were killed thereafter. These experiments were performed in accordance with the institutional guidelines for animal care.

    Sal. typhimurium was grown overnight at 37 °C in 5 ml LB medium, diluted 1 : 100 in 30 ml fresh prewarmed LB medium supplemented with 100 mM NaCl medium and grown to OD600 of 1. Bacteria were collected by centrifugation (4000 g, 5 min at room temperature), resuspended and serially diluted in PBS.

    Sta. aureus was grown overnight at 37 °C on Luria–Bertani (LB) to approximately 3×108 c.f.u. ml−1, collected by centrifugation and resuspended to 8×109 c.f.u. ml−1 in PBS at room temperature. The bacterial suspensions were diluted in PBS and mixed 1 : 1 with 4 % sterile porcine stomach mucin (Sigma) just before injection.

    H. influenzae were grown overnight at 37 °C on BHI plates containing 10 μg haemin ml−1, 2 μg NAD ml−1 and 1 : 100 IsoVitaleX (Becton Dickinson). After 24 h incubation at 37 °C, bacteria were collected by washing of the plates with PBS, serially diluted in PBS and mixed with an equal volume containing 4 % sterile porcine stomach mucin and 4 % haemoglobin (Sigma) just before injection (Brodeur et al., 1986).

    Macrophage infection in vitro.

    Intracellular survival of Sal. typhimurium and Sal. typhimurium ΔptsI were compared in the macrophage-like mouse cell line P388D1 (ATCC). We had previously observed that infection of these, and other cells was enhanced up to fivefold if the bacteria had been grown under microaerobic conditions. Therefore, bacteria were grown in standing cultures at 37 °C to an OD600 of 0·6, collected by centrifugation and diluted in prewarmed RPMI (Gibco-BRL) to approximately 4×106 c.f.u. ml−1; 100 μl bacterial suspension was added to approximately 5×105 macrophages in 900 μl RPMI medium with 10 % fetal calf serum (Gibco-BRL) in 24-well microtitre plates. The plates were centrifuged briefly (100 g, 5 min) to stimulate bacterial adherence to the macrophages. Invasion was allowed to take place for 15 min at 37 °C, after which the extracellular bacteria were killed by the addition of 100 μg gentamicin ml−1. After 3 h at 37 °C internalized bacteria were released by lysis of the macrophages with 0·05 % Triton X-100, diluted in 15 mM MgCl2 and plated. This procedure was repeated after 24 h at 37 °C and the c.f.u. value was calculated. All experiments were performed at least three times in quadruplicate. Survival and growth in macrophages is expressed as the ‘intracellular growth index’ which equals the bacterial counts at 24 h divided by the bacterial counts at 3 h. The intracellular survival of the pts mutant, the virulent wild-type and three avirulent 14028S-derived strains bearing mutations in the phoP, phoQ and thyA genes were compared.

    RESULTS

    Construction and characterization of strains with ptsI mutations

    Sal. typhimurium ATCC 14028 ΔptsI was constructed by P22 transduction of the ptsI allele from Sal. typhimurium PP1591. The Tn10 insertion in ptsI is weakly polar and reduces the expression of downstream encoded IIAGlc (crr) to 20 % of wild-type level (P. Postma, personal communication). This small reduction of IIAGlc activity does not affect glucose metabolism (Van der Vlag et al., 1995) and is unlikely to affect regulation. The ptsI genes of Sta. aureus and H. influenzae were interrupted by the insertion of resistance cassettes via double crossover between flanking sequences (Fig. 2). The interruption of Sta. aureus ptsI is unlikely to be polar since there is no ORF within 650 bp downstream of ptsI, whereas the interruption in H. influenzae is likely to have a polar effect on crr. However, because a ptsI interruption already has a strong effect upon the physiological function of the crr gene product, the exact expression level of this protein is not relevant.

    Sal. typhimurium ptsI : : Tn10 was unable to ferment glucose, mannose and other PTS carbohydrates on MacConkey indicator plates, grew well on mineral medium containing maltose and arabinose, but slowly in the presence of citrate and succinate as carbon source. Exponential growth rates in liquid cultures of the wild-type parent strain and the ptsI mutant were virtually identical in a number of different synthetic and complex media. Interestingly however, the observed lag times to reach the exponential growth rate after overnight starvation were invariably longer (in the order of 1–3 h) for the ptsI mutant, suggesting a regulatory defect in switching from one growth state to the other. The Sal. typhimurium ptsI : : Tn10 strains did not revert (frequency<10−8) after growth to saturation in LB medium and starvation in 15 mM MgCl2 for 24 h.

    Sta. aureus ΔptsI lost the ability to utilize fructose as indicated by the loss of acid production on dehydrocholic acid/neutral red medium. The growth rates on cysteine-supplemented Luria broth were similar. Similar to Sal. typhimurium, the Sta. aureus pts mutant recovered very slowly from nutrient starvation, differences in lag times varying between 2 and 6 h.

    H. influenzae ΔptsI formed red colonies when spread on Phenol Red Agar supplemented with 0·5 % fructose, whereas the wild-type parent formed yellow colonies as expected if H. influenzae has only a single PTS transporter specific for fructose. The exponential growth rate of H. influenzae ΔptsI in liquid cultures was virtually identical to its virulent parent strain; lag times, when recovering from starvation, were 0–2 h longer.

    Virulence of mutant strains in mice

    Virulence of ΔptsI strains and the wild-type parents were compared in mice infected with different numbers of bacteria. Five BALB/c mice per group were injected i.p. with graded doses of bacteria and their condition was followed on a daily basis (Table 2). LD50 was calculated according to Reed & Muench (1938). Virulence of Sal. typhimurium was further characterized in a macrophage infection assay in vitro.

    Table 2.

    Virulence in mouse model of strains carrying ptsI mutations

    Salmonellae are Gram-negative facultative anaerobes which cause gastrointestinal problems in humans. In susceptible individuals bacteraemia may develop and Salmonellae may colonize distant organs like bone marrow, heart, meninges, lungs, kidneys, spleen or gallbladder. In this study, the highly mouse-virulent strain Sal. typhimurium ATCC 14028S was used. The wild-type strain and its ptsI : : Tn10 derivative were passaged three times through mice to stabilize their virulence phenotypes. The wild-type strain was found to have an LD50 by i.p. injection of less than 7 c.f.u. (this study). The inoculum used for the ptsI mutant contained between 20 and 2×105 c.f.u. The LD50 was 3·8×103 for the ptsI mutant. Bacteria were recovered from the spleens of surviving mice (11 days post-infection) and the stability of the PTS phenotype was confirmed by plating on MacConkey agar plates containing glucose, mannose or maltose. Intracellular survival of Sal. typhimurium in the macrophage-like mouse cell line P388D3 was tested by infection of a monolayer of 5×105 cells with 4×105 bacteria. Invasion was allowed to take place for 15 min after which time extracellular bacteria were killed by the addition of gentamicin. Intracellular bacteria were recovered after 3 and 24 h of incubation by lysis of the macrophages with 0·05 % Triton X-100. The number of surviving bacteria was determined by plating. Survival and growth of bacteria in macrophages is expressed as the intracellular growth index (see Methods). The intracellular growth indices are 2·55 for the wild-type and 1·2 for the ptsI mutant (Table 3), indicating that intracellular growth of Sal. typhimurium is compromised by the ptsI mutation. Taken together these results indicate that the Sal. typhimurium ptsI mutant is attenuated, the LD50 being between two and three logs above wild-type. Strains attenuated to a similar extent were obtained by inactivation of (i) RecA, a component of the DNA repair pathway (Buchmeier et al., 1993) which is vital to intracellular survival, (ii) adenylate cyclase (Curtiss & Kelly, 1987) and (iii) the major outer-membrane porins OmpF and OmpC (Chatfield et al., 1991). The LD50 of mutants in the global virulence regulatory system encoded by phoPQ or in the aroA genes essential for synthesis of aromatic compounds are two to three logs higher than ptsI (Miller & Mekalanos, 1990).

    Table 3.

    Summary of virulence and in vitro growth characteristics of strains carrying knockout mutations of ptsI

    Sta. aureus is a Gram-positive bacterium which primarily infects the intestinal mucosa and the associated local lymphoid organs (Peyer's patches). Sta. aureus also colonizes the nasopharynx and skin. After skin rupture and invasive procedures it can gain access to the underlying tissue via lymph nodes and blood to vital organs. Mice were infected i.p. with between 3×106 and 7×108 c.f.u. of virulent Sta. aureus (isolate from University of Geneva hospital) and of the isogenic ptsI mutant, and observed at least once every 6 h after infection for 2 days (Table 2). The LD50 of the Sta. aureus ptsI mutant was found to be more than tenfold higher than the 50 % lethal dose for the virulent parent strain, indicating that the mutation affects virulence by the i.p. route. In view of the multifactorial virulence of Sta. aureus (Lowy, 1998) we consider the reduction of virulence to be biologically relevant. The attenuation of the ptsI mutant is slightly less than observed for Sta. aureus mutants identified by signature tag mutagenesis (Coulter et al., 1998). In the mouse model used in this study the reduction of LD50 of in vivo attenuation was found to be 1·4 logs.

    H. influenzae is a Gram-negative facultative anaerobe which depends on sources of haem and nicotinamide nucleotides for growth and survival. Surface structures such as fimbriae, polysaccharide capsules and enzymes which neutralize reactive oxygen species are the major components known to be associated with H. influenzae virulence (Bishai et al., 1994; Sharples, 1996). The capsule has been shown to be the dominant virulence factor with a tendency to mask other virulence factors (Moxon & Kroll, 1988). H. influenzae colonizes the nasopharynx from where it spreads into sinuses and the upper and lower respiratory tract. In rare events systemic infections may evolve after invasion of the respiratory epithelium. Bacteraemia may culminate in meningitis and septic arthritis. Mice were infected with between 1×103 and 1×106 c.f.u. of virulent mouse-passaged H. influenzae ATCC 10211 and with the isogenic ptsI mutant and observed regularly for signs of morbidity and mortality for 3 days post-infection. The results (Table 3) indicate that the LD50 of 1·3×104 for wild-type H. influenzae and 1×105 for the ptsI mutant differ substantially. It is noteworthy that not only was the time of death earlier for the mice challenged with the wild-type strain, but these mice also showed signs of severe infection earlier than those infected with the mutant (results not shown).

    DISCUSSION

    Sal. typhimurium, Sta. aureus and H. influenzae are human pathogens with quite different behaviours both in vitro and in vivo. All have PTSs, but of different overall sizes and modular designs (Fig. 1). The three strains were tested in the same intraperitoneal mouse model for virulence. Although a single infection model cannot be optimized for three different pathogens, nor be used as a unique means of determining the effect of different virulence factors (Coulter et al., 1998), we consider the mouse model used here to be a good compromise for a study aimed at comparing the effects of mutations in homologous genes of different bacterial species. We show that bacterial mutants with deletions of EI, the first component of their PTSs, are affected to different extents with respect to virulence. Sal. typhimurium, which has the most complex PTS, was most strongly attenuated. In Salmonellae the ptsI mutation affects both transport of PTS sugars and activation of adenylate cyclase. Indeed, similar attenuation was observed after inactivation of adenylate cyclase (Curtiss et al., 1987). It is noteworthy that the available data do not allow a direct comparison between the ptsI and cya mutations, because of the different genetic background of the strains used in the two studies.

    The log(attenuation) of the Sta. aureus ptsI versus wild-type was 1·4. For comparison, attenuations varied between 1·5 and 4·7 logs in Sta. aureus mutants bearing insertion mutations in in vivo-induced genes in a murine renal abscess model (Coulter et al., 1998; Lowe et al., 1998). Except for one gene with similarity to a maltose permease, no further genes associated with sugar utilization were observed in this screen. ATP-binding cassette (ABC) transporters (for peptides and nickel) formed the largest class in a total of 237 Sta. aureus mutants identified by signature tag mutagenesis (Coulter et al., 1998).

    No systematic screens for H. influenzae virulence factors have been published to date, and the observed attenuation by 0·9 logs of ptsI mutants cannot be compared with the effects of in vivo-induced genes. In the mouse model used in this study, the ptsI mutant showed an effect similar to that of a tonB mutant (unpublished results) which has previously been shown to reduce virulence in the infant rat model (Jarosik et al., 1994), and an arcA mutant, both tested in the same animal model used in this study (De Souza-Hart et al., 2003).

    In spite of extensive in vivo screening for virulence factors, genes associated with sugar utilization have not been found (Mahan et al., 1995). A mutation in a gene encoding a protein similar to the IIC subunit of the mannose transporter of the PTS turned up in a screen aimed at the identification of genes required for the colonization of the chicken alimentary tract. However, the phenotype was lost after transduction of the mutated allele into fresh Sal. typhimurium (Turner et al., 1998), making the initial observation difficult to interpret. The bgl operon encoding the β-glucoside transporter of the PTS was expressed in E. coli infecting the mouse liver, but not when the bacteria were grown in vitro (Khan & Isaacson, 1998), suggesting that sugar utilization may indeed be of importance to bacterial survival and multiplication in vivo. The physiological basis for attenuation by the ptsI deletion remains to be determined, however. The observation that Sal. typhimurium, Sta. aureus and H. influenzae were impaired in recovery from starvation conditions in vitro suggests that a similar physiological problem may impair their ability to multiply in vivo under the rapidly changing conditions typical of a bacterial infection pathway. On the other hand, the limited ability to utilize simple nutrients may be responsible for the observed virulence effects as well. Oral infection might be an alternative to intraperitoneal infection for testing of ptsI mutants because Sal. typhimurium ptsI mutants are severely impaired in the utilization of sugars and carboxylic acids, which are abundant nutrients in the intestine, but may be less relevant in the intracellular state.

    In conclusion, enzyme I of the PTS and/or the more recently detected homologous proteins involved in linking carbon and nitrogen assimilation in bacteria are proteins necessary for the full deployment of pathogenic effects by many bacterial species and should therefore be considered as potential targets of new anti-infective compounds.

    Acknowledgments

    We thank B. Berger-Bächi (University of Zürich), R. Bruckner (University of Tübingen), P.W. Postma (University of Amsterdam), J.J. Mekalanos (Harvard Medical School) and T.J. Foster (University of Dublin) for their invaluable help with technical advice and their gifts of plasmids and strains. This work was supported by Grant 3100-063420 from the Swiss National Science Foundation.

    References