Abstract
Abbreviations: Cm, chloramphenicol; COSY, correlated spectroscopy; PAPA, p-aminophenylalanine; PAPS, p-aminophenylserine
The GenBank accession numbers for sequences described in this paper are AAM01214 (for CmlK), AAK08979 (for CmlS) and AAM01215 (for ORF13).
|
The plasmids, phage and bacteria used are described in Table 1. Strains of S. venezuelae were maintained on MYM agar (Stuttard, 1982). Where needed for selection, either apramycin (Am, 50 µg ml-1) or an Am/thiostrepton (Ts) mixture (25 µg ml-1 each) was added to the growth medium. Escherichia coli strains used in plasmid transformations or for phage propagation were grown as described by Sambrook et al. (1989). The DNA-methylation-deficient E. coli strain ET12567(pUZ8002) used in conjugal transfer of plasmids from E. coli to S. venezuelae was grown on LB agar supplemented as required with ampicillin (Ap; 50 µg ml-1), Cm (25 µg ml-1), Am (50 µg ml-1), Ts (25 µg ml-1) and kanamycin (Km, 50 µg ml-1) for specific selections (Mazodier et al., 1989).
Table 1. Bacterial strains, plasmids and phage
Probing the genomic library for hybridization.
Standard procedures were used (Sambrook et al., 1989; Hopwood et al., 1985). In Southern analyses, DNA fragments bound to nylon membranes were probed at 65 °C for hybridization with [α-32P]dCTP-labelled DNA as described previously (He et al., 2001). Library fragments of S. venezuelae ISP5230 genomic DNA cloned in the λ vector GEM-11 (Facey et al., 1996) were screened for hybridization with probe A a DNA fragment amplified from the S. venezuelae ISP5230 genome by PCR with oligonucleotide primers designed from consensus halogenase sequences (Piraee & Vining, 2002). Restriction digests of phage MP30 DNA were screened with probe B an 850 bp SacISalI fragment of ORF13 excised from the 3' end of DNA cloned in pJV506.
Cloning DNA from the genomic library.
Phage MP30 was isolated from a hybridizing plaque detected in the S. venezuelae ISP5230 genomic library by screening with probe A. Digestion of phage DNA (approx. 22 kb) with SacI and fractionation by agarose gel electrophoresis yielded a 6·2 kb hybridizing fragment that was cloned in pBluescript II (SK+) to give pJV502. Southern analysis of pJV502 located the hybridizing sequence in a 3·8 kb NotISacI fragment. From a NotI digest of pJV502 a DNA fragment that included both the vector and the 3·8 kb NotISacI sequence was retrieved, circularized and propagated as pJV506. The 2·4 kb NotINotI fragment also present in the pJV502 digest was subcloned in pBluescript II (SK+) to give pJV531. To clone DNA from the region of the S. venezuelae ISP5230 genome downstream of ORF13, restriction enzyme digests of phage MP30 DNA were fractionated by gel electrophoresis and screened for hybridization with probe B. A 1·9 kb SacISacI fragment detected by the probe was ligated into the multicloning site of pUC18 to give pJV513. Sequencing showed that the pJV513 insert contained the downstream region of ORF13, followed by an intact ORF14 that began at a GTG codon 481 nt after the ORF13 stop codon. The 600 bp ORF14 sequence was followed after 156 bp by the ATG start codon of ORF15, which extended for 870 bp without termination.
Sequencing and sequence analysis.
Plasmid DNA inserts were sequenced with an ABI 373 automated DNA sequencer; sequences were analysed as described previously (He et al., 2001). To detect ORFs, variations in mol% G+C were monitored with FramePlot software (Ishikawa & Hotta, 1999). Putative termination sequences were detected with the Terminator program in the Genetics Computer Group (GCG) software, and were analysed with Gene Runner version 3.05 (Hastings Software). Binding energies for RBS were also calculated with Gene Runner. Multiple sequence alignments used to construct a phylogenetic tree were assembled with CLUSTALX (ftp://ftp-igbmc.u-strasbg.fr/pub/ClustalX/); relationships were displayed with TREEVIEW (Page, 1996).
Conjugal DNA transfer.
Genes or plasmid constructs were inserted into the conjugal vector pJV326 (He et al., 2001), and the recombinant plasmid was used to transform E. coli DH5α. Where plasmid constructs with insertionally inactivated genes were used, colonies were selected on LB agar containing Ap and Am (50 µg ml-1 each). To avoid methylated-DNA-sensitive restriction (MacNeil et al., 1992), all plasmid DNA isolated from E. coli DH5α was passaged through E. coli ET12567(pUZ8002) before conjugal transfer to S. venezuelae ISP5230 by the procedure of Mazodier et al. (1989).
Gene disruption.
S. venezuelae genes initially cloned in pUC18 or pBluescript II (SK+) were recloned in the conjugal E. coli plasmid pJV326 before insertion of the 1·5 kb apramycin resistance (AmR) cassette from pUC120A (Paradkar & Jensen, 1995) or pJV225 (Chang et al., 2001) at a site near the centre of the cloned fragment. To disrupt cmlK (ORF11), conjugal plasmid pJV526 was linearized with NotI and ligated with AmR from pJV225 to give pJV527. Digests of pJV527 with BglII/XhoI, NcoI/XhoI and StuI/XhoI included 2·95, 3·45 and 2·5 kb DNA fragments, respectively. This pattern indicates that the AmR cassette, after integration of the pJV527 insert and allele exchange with cmlK, will be transcribed in the same direction as cmlK and cmlS. (The opposite orientation of the AmR cassette would have given 2·2, 2·7 and 1·75 kb fragments, respectively.) Conjugal transfer of pJV527 to S. venezuelae ISP5230, and selection for AmR TsS colonies, gave several transconjugants, which were analysed for Cm production. Probing a Southern blot of BglII-digested genomic DNA from one of the transconjugants (VS1111) with the AmR gene or with a 400 bp SalINotI fragment of cmlK from pJV506 detected a hybridizing fragment of about 4 kb; in contrast, genomic DNA from S. venezuelae ISP5230 hybridized only with the pJV506 probe, and gave the expected signal at 2·6 kb. To disrupt cmlS (ORF12) a 3·8 kb SacIXbaI fragment of pJV506, recloned in pJV326 as conjugal plasmid pJV507, was digested with StuI and ligated with the AmR cassette excised from pJV225 with EcoRV. The resulting plasmid (pJV508) was transferred conjugally to S. venezuelae ISP5230; selection of AmR TsS transconjugant colonies gave VS1112. Integration of the disrupted cmlS insert of pJV508 into the chromosome by a double crossover excising vector DNA was confirmed by the hybridization signals at 1·7 and 3·2 kb obtained when SmaI-digested genomic DNA samples from ISP5230 and VS1112, respectively, were probed with a 1·5 kb SalI fragment of pJV506 containing cmlS. Probing with the AmR cassette gave the 3·2 kb signal from VS1112, but no signal from ISP5230. To disrupt ORF13, a 1·75 kb StuINotI fragment was deleted from pJV507; the residual fragment, containing vector DNA and ORF13, was blunt-ended with S1 nuclease and circularized to yield pJV516. Inserting the AmR cassette from pUC120A into the NcoI site of pJV516 gave the ORF13-disrupted conjugal plasmid pJV518. Transfer of pJV518 to S. venezuelae ISP5230, and selection of AmR TsS transconjugants, yielded strain VS1113. Probing SmaI-digested genomic DNA samples from ISP5230 and VS1113 with a 0·75 kb SmaISalI fragment of ORF13 gave hybridization signals at 1·4 and 2·9 kb, respectively. With the AmR cassette as a probe, only the 2·9 kb signal from VS1113 was detected.
Analysis of culture extracts and identification of metabolites.
Production of Cm and corynecins was measured in shaken cultures of wild-type and transconjugant strains grown in GI medium. Ethyl acetate extracts of filtered broth were analysed either by HPLC (He et al., 2001) or by TLC using silica-gel-coated plates developed with 12 % methanol in chloroform (Lewis et al., 2003). In the HPLC procedure, absorbance peaks at 273 nm were identified by co-injecting reference solutions of Cm and corynecins (Cm-analogues with unhalogenated short-chain acyl groups replacing the dichloroacetyl substituent; Vining & Stuttard, 1995). In cultures of transconjugants VS1111 and VS1112, these analyses did not detect an absorbance peak at the retention time (tr) 6·92 min characteristic of Cm, but instead showed peaks at tr 5·49, 6·08, 6·68 and 7·08 min, corresponding to the acetyl, propionyl, isobutyryl and 2-methylbutyryl analogues (corynecins I, II, III and IV, respectively). Co-injecting mutant extracts with reference corynecins enhanced mutant peaks at the tr values anticipated, and indicated that the major compound (tr=6·08 min) was corynecin II; minor peaks corresponded to corynecins I, III and IV. The identity of the major compound, purified by reverse-phase chromatography (Varian MegaBond Elut silica C18 column eluted with a methanol/water gradient) of the product from 1 litre of filtered VS1112 broth, was confirmed by 1H-NMR (400 MHz) in CDCl3: δ 1·05 (3H, t, J=7·6 Hz, CH3), 2·18 (2H, quartet of AB systems, J=7·6 Hz, CH2CH3), 3·93 (3H, br d, J=4 Hz, CH2OH and OH), 4·15 (1H, sextet, 4 Hz splitting, CHNH), 5·24 (1H, br d, J=4 Hz, CHOH), 6·12 (1H, br d, J=7·5 Hz, NH), 7·57 (2H, apparent d, 8·2 Hz splitting, aromatic H) and 8·22 (2H, apparent d, 9·0 Hz splitting, aromatic H). Signal assignments were aided by COSY and decoupling experiments. Data from the 1H-NMR spectroscopic analysis were consistent with the structure of corynecin II reported by Shirahata et al. (1972).
The recombinant λ phage MP30 detected by screening an S. venezuelae genomic library with a DNA fragment amplified by PCR (Piraee & Vining, 2002) contained approximately 22 kb of DNA. Digestion with SacI yielded a 6·2 kb hybridizing fragment, which was cloned in pBluescript II (SK+) to give pJV502 (Fig. 2a). Southern analysis of pJV502 located the hybridizing region in a 3·8 kb NotISacI segment; NotI digestion of pJV502, followed by self-ligation of the vector-containing fragment, gave pJV506 (Fig. 2b). A 2·4 kb NotI fragment (resulting from digestion at vector and insert NotI sites) was cloned in pBluescript II (SK+) to give pJV531 (see Fig. 2b). Sequencing the inserts in pJV506, pJV513 (see Fig. 2b) and pJV531 revealed overlapping DNA segments derived from a continuous 8·1 kb region of chromosomal DNA. Moreover, the sequence of the pJV531 insert and the first 163 nt at the 5'-end of the pJV506 insert showed total identity with the 3'-end of the incomplete ORF11 cloned in pJV357 (He et al., 2001; Fig. 2c). The results implied that the pJV506 insert overlapped a 7·5 kb BamHI fragment of the S. venezuelae chromosome known to include several genes for Cm biosynthesis (He et al., 2001). FramePlot analysis of the overlapping sequence detected three ORFs (11, 12 and 13), all transcribed in the same direction (Fig. 2d). The segment of ORF11 cloned in pJV506 completed the partial cmlK sequence reported by He et al. (2001) (Fig. 3).
|
|
ORF11 (encoding CmlK, an AMP-ligase)
Although the region upstream of ORF11 lacked convincing ShineDalgarno sequences, frame analysis predicted that translation began at a GTG codon 430 bp upstream of the NotI site in the overlapping regions of the pJV357 and pJV506 inserts. It terminated at an in-frame TGA codon within the pJV506 insert, giving an 1107 bp gene with the strong (93·8 mol%) G+C bias expected for codon third-letters in streptomycetes (Wright & Bibb, 1992). Downstream of ORF11, a set of multiple repeat sequences (TGAAGAAGCTGCGGTCCCGGCCGGGCGCCGACGAGGAGTGAA) was identified by the GCG Terminator program. Comparison of the deduced 368 aa sequence of CmlK with proteins in GenBank showed marked similarity to adenylating enzymes typified by salicyl-AMP ligase (PchD; 42 % identity) of Pseudomonas aeruginosa (Quadri et al., 1999).
To assess whether cmlK is required for Cm biosynthesis, the gene was disrupted with an AmR cassette, and the insertionally inactivated allele constructed in an E. coli plasmid was transferred conjugally to S. venezuelae ISP5230. Selection of transconjugants with the AmR gene integrated in chromosomal DNA yielded mutant VS1111. Southern analysis of genomic DNA from mutant and wild-type strains confirmed that cmlK was replaced in VS1111 by the disrupted cmlK allele. Cultures of the cmlK mutant failed to produce Cm, and instead accumulated acyl analogues, identified by HPLC as corynecins IIV. The major component was shown by 1H-NMR analysis to be corynecin II, in which a propionyl group replaces the dichloroacetyl substituent of Cm (Shirahata et al., 1972). Because cmlK is located 55 bp upstream of cmlS, and the two genes are transcribed in the same direction, loss of halogenase activity might be attributed to a polar effect of the cmlK disruption preventing expression of cmlS. However, three observations argue against this: (i) the DNA fragment cloned in pJV506 contains a putative transcriptional terminator, consisting of multiple repeat sequences capable of generating hairpin loops, in the region between cmlK and cmlS; (ii) the AmR cassette used to disrupt cmlK contains a promoter from which the resistance marker and downstream genes with the same transcriptional orientation are expressed; the cassette lacks a terminator and has been shown (Wang et al., 2002) to support transcription of genes downstream of the insertion site when it is introduced in the appropriate orientation into polycistronic operons. The AmR gene in the insertionally inactivated cmlK mutant was shown by restriction analyses to have the same transcriptional orientation as cmlS; (iii) when a 3·57 kb EcoRI fragment of pJV502 containing the complete cmlK sequence as well as 2 kb of DNA upstream of the start codon was cloned in the conjugal vector pJV528, and transferred conjugally into S. venezuelae VS1111 to complement in trans the chromosomal cmlK mutation in that strain, selection of transconjugants (VS1115) with an AmR TsR phenotype yielded cultures in which Cm production was partially restored. Analysis by TLC of metabolites in shaken cultures of VS1115 grown in GI medium showed similar amounts of Cm and corynecin II, whereas cultures of the disrupted strain VS1111 produced only corynecin II, and the wild-type ISP5230 produced only Cm. Each strain produced a comparable overall yield of product. The combined evidence indicates that accumulation of corynecins in place of Cm is not a polar effect of cmlK disruption, and implicates adenylation by CmlK as an essential step in the introduction of chlorine for dichloroacetylation.
ORF12 (encoding CmlS, a halogenase)
ORF12 has two potential start codons: GTG at nt 832834 and ATG at nt 834836. Assignment of ATG is favoured by the presence 6 bp upstream (Strohl, 1992) of a putative ShineDalgarno sequence AAGGAG (ΔG=-7·5 kcal mol-1), and places the translational start codon 55 bp downstream of ORF11. The first in-frame stop codon at nt 25652567 defines a 1734 bp gene encoding a protein with 577 aa. The codon-third-letter bias (97 mol% G+C) of cmlS is predictable for a streptomycete gene. Sequence comparisons show a marked resemblance (2533 % identity) of the deduced amino acid sequence to those of halogenases such as PltA and PltM from Pseudomonas fluorescens Pf-5 (Nowak-Thompson et al., 1999), and PrnC from Myxococcus fulvus and P. fluorescens (Kirner et al., 1998). It is noteworthy that these enzymes halogenate aromatic substrates, and that pyrroles are common targets. As in the halogenases, the amino-terminal region of CmlS (aa4aa18) contains an NAD(P)H-binding motif matching the consensus sequence GxGx2(G/A)x3(G/A)x6G (Fig. 4) of the β-α-β structure in NAD(P)H-binding regions (Scrutton et al., 1990). A second motif, present at aa252aa278 in the central region of CmlS, resembles the FAD-binding site consensus Gx5GDAxHx3Px4Gx6D in such FAD-dependent monooxygenases as the p-hydroxybenzoate hydroxylases of Acinetobacter calcoaceticus and P. fluorescens (DiMarco et al., 1993).
|
Disruption of cmlS by insertion of the AmR gene and selection of transconjugants with an AmR TsS phenotype yielded strain VS1112, which was shown by Southern analysis of genomic DNA samples to have replaced its wild-type cmlS with an insertionally inactivated allele. Cultures of VS1112 produced corynecins in place of Cm, implying that cmlS has a role in biosynthesis of the dichloroacetyl moiety of Cm.
Transformation of mutant cml-2 with cloned cmlK or cmlS
In earlier work (Doull et al., 1985, 1986), a chlorination-defective mutant (cml-2) obtained by mutagenizing S. venezuelae ISP5230 with ethyl methanesulphonate was mapped genetically to the gene cluster for Cm biosynthesis. The similar phenotypes of this mutant and transconjugants VS1111 and VS1112 (accumulation of corynecins in place of Cm) suggested that the cml-2 mutation might be complemented by transforming the mutant with a plasmid containing cmlK and cmlS. This was tested by recloning the insert from pJV502 in pJV326, and transferring the resulting conjugal plasmid pJV526 into S. venezuelae cml-2. Transconjugants (VS1114) selected for their TsR phenotype and grown under conditions supporting Cm production in the wild-type accumulated the same mixture of corynecins as found in the cml-2 mutant. The result implied that cmlK and cmlS are not the only genes needed for biosynthesis and attachment of the dichloroacetyl group.
ORFs13, 14 and 15
ORF13 (879 bp) in the pJV502 insert started with an ATG 230 bp downstream of cmlS, and was preceded (7 bp) by a putative ShineDalgarno sequence (GGAGG; ΔG=-7·8 kcal mol-1). Its codon-third-letter mol% G+C (90 %) was consistent with that of streptomycete genes, and the sequence of its 292 deduced aa was 56 % identical to an aldo/keto reductase in Streptomyces clavuligerus (Mosher et al., 1999). To assess whether ORF13 encoded a protein essential for Cm biosynthesis, the sequence was disrupted and DNA containing the insertionally inactivated gene was transferred into S. venezuelae. Southern analyses of genomic DNA from the transconjugant (VS1113) and wild-type strains confirmed that the disrupted ORF13 allele was present in VS1113. Since cultures of the mutant and the wild-type produced the same amounts of Cm, ORF13 is not essential for biosynthesis of the antibiotic. Screening restriction enzyme digests of S. venezuelae DNA with probe B yielded a hybridizing 1·9 kb SacISacI fragment, shown by sequencing to contain the 3'-extension of ORF13, followed by an intact ORF14 and an incomplete ORF15 (see Fig. 2d). The deduced aa sequences of ORF14 and the 5' region of ORF15 matched those of unidentified proteins SCD11.26 and SCF56.19 (GenBank accession nos. CAB76349 and CAB62764, respectively) in the Streptomyces coelicolor A3(2) genome ().
So far 15 genes have been associated with Cm biosynthesis or resistance in S. venezuelae ISP5230. Twelve of them are clustered on the approximately 18 kb of chromosomal DNA sequenced in this and previous studies (Mosher et al., 1990, 1995; Brown et al., 1996; Chang et al., 2001; He et al., 2001). Functions for nine genes have been confirmed by insertional inactivation, and particular interest has focused on one (cmlP; see Fig. 3) encoding a nonribosomal peptide synthetase (NRPS). The amino acid sequence of CmlP shows strong similarity to sequences of the NRPSs that activate phenylalanine for biosynthesis of gramicidin and tyrocidin (Conti et al., 1997; Mootz & Marahiel, 1997). Analysis of the CmlP sequence (He et al., 2001) detects functional motifs for an adenylation domain with the specificity needed to activate p-aminophenylalanine (PAPA) or p-aminophenylserine (PAPS). In CmlP and each of the NRPS sequences, the phosphopantetheinyl attachment site of a peptidyl carrier domain can be recognized, but motifs characteristic of peptide elongation, readily detected in the NRPSs, are replaced in CmlP with a reductive termination domain containing an NAD(P)H-binding site. We conclude that CmlP is a monomodular NRPS, and suggest that its peptide carrier domain may have a role in sequestering and positioning the amino acid for further biosynthetic reactions (Konz & Marahiel, 1999). In Streptomyces spheroides, NovH-mediated adenylation of tyrosine, and subsequent β-hydroxylation of the tethered amino acid by a cytochrome P450 monooxygenase, generates a coumarin moiety for novobiocin biosynthesis (Chen & Walsh, 2001); similar reactions are used in coumermycin and nikkomycin biosynthesis (Wang et al., 2000; Lauer et al., 2000). Chen & Walsh (2001) have proposed a role for thioesterification of peptidyl carrier proteins in segregating part of an amino acid pool for a dedicated metabolic function. In S. venezuelae PAPA might be sequestered in this way for β-hydroxylation, and the peptidyl PAPS thioester channelled into Cm biosynthesis (He et al., 2001). However, the Cm biosynthesis cluster lacks a cytochrome P450 monooxygenase gene comparable to that associated with β-hydroxylation in S. spheroides, and probably uses an alternative mechanism for generating PAPS. A putative haloperoxidase/perhydrolase gene has recently been implicated in the biosynthesis of β-hydroxytyrosine for incorporation into the glycopeptide balhimycin by Amycolatopsis mediterranei DSM5908 (Puk et al., 2002).
Function of CmlK
The structure of Cm can be regarded as a modified aromatic amino acid. In addition to β-hydroxylation, a noteworthy modification required to convert PAPA to Cm is dichloroacetylation of the α-amino group. The amidation is comparable in certain respects to peptide formation. Adenylation of PAPA (or PAPS) by CmlP and transfer of the activated carboxyl group to the thiol of a peptidyl carrier domain may anchor the amino acid, and position it for the dichloroacylation reaction involving CmlK. A conserved core sequence (SSGSTGAPK) in CmlK matches the adenylation domain signature [STG][STG]-G-[ST][TSE]-[GS]-x-[PALIVM]-K in the adenylating enzyme superfamily (Conti et al., 1996). Similarities in the amino acid sequences of CmlK, PchD and DhbE suggest that these gene products have similar functions. During pyochelin biosynthesis in P. aeruginosa, the pchD product adenylates salicylic acid, and the activated salicylyl group remains bound to the enzyme for transfer to a thiol in the peptide carrier domain of peptide synthetase PchE (Quadri et al., 1999). Likewise in B. subtilis, DhbE adenylates 2,3-dihydroxybenzoic acid for eventual transfer to glycine (Rowland et al., 1996). The close sequence similarity between CmlK, PchD and DhbE implies that the gene product adenylates aromatic carboxylic acids rather than amino acids. The lack of a 4'-phosphopantetheine-binding site in the CmlK sequence suggests that this gene product does not participate in sequestering amino acids. The characteristics of CmlP and CmlK suggest that in S. venezuelae only CmlP is responsible for channelling PAPA into Cm biosynthesis. CmlK probably activates the aromatic precursor of a substrate for the enzyme complex that generates the dichloroacetylating agent transferred to the peptidyl PAPS thioester. Such a role for CmlK in dichloroacetylation would account for accumulation in cmlK-disrupted cultures of corynecins instead of PAPA or its shunt metabolites (Lewis et al., 2003). In the absence of dichloroacetyl-AMP, alternative acyl groups from the pool of activated short-chain fatty acids can be transferred to PAPS.
Function of CmlS
Accumulation of corynecins by mutants disrupted in cmlS or cmlK implicates both genes in biosynthesis of the dichloroacetyl substituent of Cm. Protein sequence comparisons indicate that CmlS is a FADH2-dependent halogenase. Its amino-terminal region contains a conserved NAD(P)H-binding site, and the central region contains a FAD-binding site similar to that in BhaA, a halogenase gene product involved in biosynthesis of the vancomycin-related antibiotic balhimycin (Pelzer et al., 1999; Puk et al., 2002). A conserved aspartic acid (aa304 in BhaA and aa259 in CmlS) required for hydrogen bonding with the flavin cofactor supports involvement of FAD, as do sequences in both the BhaA and CmlS binding sites that match the FAD-binding motif in the well-characterized p-hydroxybenzoate hydroxylases (DiMarco et al., 1993). In FAD-dependent hydroxylations the flavin is reduced by NAD(P)H and reacts with oxygen to form the 4(a)-flavin hydroperoxide; the hydroperoxide oxidizes the substrate to an epoxide, which is then opened by nucleophilic attack from a hydroxyl ion (Entsch et al., 1976; Gatti et al., 1994). A similar mechanism proposed for halogenase-catalysed reactions (Hohaus et al., 1997; Keller et al., 2000) is supported by recent evidence (van Pée, 2001) that the halogenase gene product requires FAD, NADPH, reductase activity and oxygen to function as a halogenating system. The epoxide generated by the flavin hydroperoxide undergoes nucleophilic attack by a halide ion, and specific removal of water gives the halogenated product. In an alternative mechanism, the chloride ion might react with a flavin hydroperoxide to generate electrophilic chlorine that halogenates an oxidizable substrate; such a mechanism would resemble that proposed for chloroperoxidase-catalysed reactions (van Pée, 2001) and could function with oxidizable aliphatic substrates.
A dendrogram showing relationships deduced from a multiple sequence alignment of gene products in the oxygenase and halogenase groups of FADH2-dependent enzymes supports assignment of CmlS to this family (Fig. 5). The S. venezuelae halogenase sequence is most similar to that of PltM, but is closely related to PltD and MfPrnC; all three are associated with chlorination of a pyrrole ring (Nowak-Thompson et al., 1999), an aromatic substrate with potential implications for biosynthesis of the dichloroacetyl component of Cm. Although CmlS, PltM, PltD and MfPrnC form a discrete cluster, many halogenases in the dendrogram are distributed in clusters that include oxygenases e.g. the halogenase XoHal is clustered with the hydroxylases PfPobA and PspPob. As a corollary, few subclusters contain only oxygenases.
|
Formation of the Cm hydroxymethyl group
The amino acid sequence deduced from ORF13 places the protein in the aldo-keto reductase (AKR) family of enzymes (Jez et al., 1997); the relationship is confirmed by sequences at aa 4663 and 130147 matching the consensus AKR family motifs G-[FY]-R-[HSAL]-[LIVMF]-D-[STAGC]-[AS]-x5-E-x2-[LIVM]-G and [LIVMFY]-x9-[KREQ]-x-[LIVM]-G-[LIVM]-[SC]-N-[FY], respectively. A reductase of this type could potentially generate the p-aminophenylserinol moiety of Cm from an aldehyde intermediate. However, persistence of Cm biosynthesis after insertional inactivation of ORF13 demands an alternative route; the most plausible is a two-step reduction of PAPS thioester catalysed by the reductase domain identified in CmlP (He et al., 2001). This reductive mechanism terminating nonribosomal peptide biosynthesis has been described for myxochelin in Stigmatella aurantiaca Sg a15 (Gaitatzis et al., 2001), and for saframycin Mx1 in Myxococcus xanthus (Pospiech et al., 1996).
Footnotes
†Present address: Ecopia Biosciences Inc., 7290 Frederick-Banting, Saint-Laurent, Québec, Canada H4S 2A1.References
Chang, Z., Sun, Y., He, J. & Vining, L. C. (2001). p-Aminobenzoic acid and chloramphenicol biosynthesis in Streptomyces venezuelae: gene sets for a key enzyme, 4-amino-4-deoxychorismate synthase. Microbiology 147, 21132126.
Chen, H. W. & Walsh, C. T. (2001). Coumarin formation in novobiocin biosynthesis: β-hydroxylation of the aminoacyl enzyme tyrosyl-S-NovH by a cytochrome P450 NovI. Chem Biol 8, 112.[CrossRef][Medline]
Conti, E., Franks, N. P. & Brick, P. (1996). Crystal structure of firefly luciferase throws light on a superfamily of adenylate-forming enzymes. Structure 4, 287298.[Medline]
Conti, E., Stachelhaus, T., Marahiel, M. A. & Brick, P. (1997). Structural basis for the activation of phenylalanine in the non-ribosomal biosynthesis of gramicidin S. EMBO J 16, 41744183.[CrossRef][Medline]
Dairi, T., Nakano, T., Aisaka, K., Katsumata, R. & Hasegawa, M. (1995). Cloning and nucleotide sequence of the gene responsible for chlorination of tetracycline. Biosci Biotechnol Biochem 59, 10991106.[Medline]
DiMarco, A. A., Averhoff, B. A., Kim, E. E. & Ornston, L. N. (1993). Evolutionary divergence of pobA, the structural gene encoding p-hydroxybenzoate hydroxylase in an Acinetobacter calcoaceticus strain well suited for genetic analysis. Gene 125, 2533.[CrossRef][Medline]
Doull, J. L., Ahmed, Z., Stuttard, C. & Vining, L. C. (1985). Isolation and characterization of Streptomyces venezuelae mutants blocked in chloramphenicol biosynthesis. J Gen Microbiol 131, 97104.
Doull, J. L., Vats, S., Chaliciopoulos, M., Stuttard, C., Wong, K. & Vining, L. C. (1986). Conjugational fertility and location of chloramphenicol biosynthesis genes on the chromosomal linkage map of Streptomyces venezuelae. J Gen Microbiol 132, 13271338.
Entsch, B., Ballou, D. P. & Massey, V. (1976). Flavin-oxygen derivatives involved in hydroxylation by p-hydroxybenzoate hydroxylase. J Biol Chem 251, 25502563.
Facey, S. J., Groß, F., Vining, L. C., Yang, K. & van Pée, K.-H. (1996). Cloning, sequencing and disruption of a bromoperoxidase-catalase gene in Streptomyces venezuelae: evidence that it is not required for chlorination in chloramphenicol biosynthesis. Microbiology 142, 657665.
Gaitatzis, N., Kunze, B. & Müller, R. (2001). In vitro reconstitution of the myxochelin biosynthetic machinery of Stigmatella aurantiaca Sg a15: biochemical characterization of a reductive release mechanism from nonribosomal peptide synthetases. Proc Natl Acad Sci U S A 98, 1113611141.
Gatti, D. L., Palfey, B. A., Lah, M. S., Entsch, B., Massey, V., Ballou, D. P. & Ludwig, M. L. (1994). The mobile flavin of 4-OH benzoate hydroxylase. Science 266, 110114.
Groß, F., Lewis, E. A., Piraee, M., van Pée, K.-H., Vining, L. C. & White, R. L. (2002). Isolation of 3'-O-acetylchloramphenicol: a possible intermediate in chloramphenicol biosynthesis. Bioorg Med Chem Lett 12, 283286.[CrossRef][Medline]
He, J., Magarvey, N., Piraee, M. & Vining, L. C. (2001). The gene cluster for chloramphenicol biosynthesis in Streptomyces venezuelae ISP5230 includes novel shikimate pathway homologues and a monomodular nonribosomal peptide synthetase gene. Microbiology 147, 28172829.
Hohaus, K., Altmann, A., Burd, W., Fischer, I., Hammer, P. E., Hill, D. S., Ligon, J. M. & van Pée, K.-H. (1997). NADH-dependent halogenases are more likely to be involved in halometabolite biosynthesis than haloperoxidases. Angew Chem Int Ed Engl 36, 20122013.[CrossRef]
Hopwood, D. A., Bibb, M. J., Chater, K. F. & 7 other authors (1985). Genetic Manipulation of Streptomyces, a Laboratory Manual. Norwich: John Innes Foundation.
Ishikawa, J. & Hotta, K. (1999). Frameplot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G+C content. FEMS Microbiol Lett 174, 251253.[CrossRef][Medline]
Jez, J. M., Bennett, M. J., Schlegel, B. P., Lewis, M. & Penning, T. M. (1997). Comparative anatomy of the aldoketo reductase superfamily. Biochem J 326, 625636.
Keller, S., Wage, T., Hohaus, K., Hölzer, M., Eichhorn, E. & van Pée, K.-H. (2000). Purification and partial characterization of tryptophan 7-halogenase (PrnA) from Pseudomonas fluorescens. Angew Chem Int Ed Engl 39, 23002302.[CrossRef][Medline]
Kirner, S., Hammer, P. E., Hill, D. S., Altmann, A., Fischer, I., Weislo, L. J., Lanahan, M., van Pée, K.-H. & Ligon, J. M. (1998). Functions encoded by pyrrolnitrin biosynthetic genes from Pseudomonas fluorescens. J Bacteriol 180, 19391943.
Konz, D. & Marahiel, M. A. (1999). How do peptide synthetases generate structural diversity? Chem Biol 6, R39R48.[CrossRef][Medline]
Lauer, B., Russwurm, R. & Bormann, C. (2000). Molecular characterization of two genes from Streptomyces tendae Tu901 required for the formation of the 4-formyl-4-imidazolin-2-one-containing nucleoside moiety of the peptidyl nucleoside antibiotic nikkomycin. Eur J Biochem 267, 16981706.[Medline]
Lewis, E. A., Adamek, T. L., Vining, L. C. & White, R. L. (2003). Metabolites of a blocked chloramphenicol producer. J Nat Prod 66, 6266.[CrossRef][Medline]
MacNeil, D. J., Gewain, K. M., Rudy, C. L., Dezeny, G., Gibbons, P. H. & MacNeil, T. (1992). Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111, 6168.[CrossRef][Medline]
Mazodier, P., Petter, R. & Thompson, C. (1989). Intergenic conjugation between Escherichia coli and Streptomyces species. J Bacteriol 171, 35833585.
Mootz, H. D. & Marahiel, M. A. (1997). The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide sequence and biochemical characterization of functional internal adenylation domains. J Bacteriol 179, 68436850.
Mosher, R. H., Ranade, N. P., Schrempf, H. & Vining, L. C. (1990). Chloramphenicol resistance in Streptomyces: cloning and characterization of a chloramphenicol hydrolase gene from Streptomyces venezuelae. J Gen Microbiol 136, 293301.
Mosher, R. H., Camp, D. J., Yang, K., Brown, M. P., Shaw, W. V. & Vining, L. C. (1995). Inactivation of chloramphenicol by O-phosphorylation. J Biol Chem 270, 2700027006.
Mosher, R. H., Paradkar, A. S., Anders, C., Barton, B. & Jensen, S. E. (1999). Genes specific for the biosynthesis of clavam metabolites antipodal to clavulanic acid are clustered with the gene for clavaminate synthase 1 in Streptomyces clavuligerus. Antimicrob Agents Chemother 43, 12151224.
Nowak-Thompson, B., Chaney, N., Wing, J. S., Gould, S. J. & Loper, J. E. (1999). Characterization of the pyoluteorin biosynthetic gene cluster of Pseudomonas fluorescens Pf-5. J Bacteriol 181, 21662174.
Page, R. D. M. (1996). TREEVIEW: an application to display phylogenetic trees on personal computers. Comp Appl Biosci 12, 357358.
Paradkar, A. S. & Jensen, S. E. (1995). Functional analysis of the gene encoding the clavaminate synthase 2 isoenzyme involved in clavulanic acid biosynthesis in Streptomyces clavuligerus. J Bacteriol 177, 13071314.
Pelzer, S., Sußmuth, R., Heckmann, D., Recktenwald, J., Huber, P., Jung, G. & Wohlleben, W. (1999). Identification and analysis of the balhimycin biosynthetic gene cluster and its use for manipulating glycopeptide biosynthesis in Amycolatopsis mediterranei DSM5908. Antimicrob Agents Chemother 43, 15651573.
Piraee, M. & Vining, L. C. (2002). Use of degenerate primers and touchdown PCR to amplify a halogenase gene fragment from Streptomyces venezuelae ISP5230. J Ind Microbiol Biotechnol 29, 15.[CrossRef][Medline]
Pospiech, A., Bietenhader, J. & Schupp, T. (1996). Two multifunctional peptide synthetases and an O-methyltransferase are involved in the biosynthesis of the DNA-binding antibiotic and antitumour agent saframycin Mx1 from Myxococcus xanthus. Microbiology 142, 741746.
Puk, O., Huber, P., Bischoff, D., Rechtenwald, J., Jung, G., Süßmuth, R. D., van Pée, K.-H., Wohlleben, W. & Pelzer, S. (2002). Glycopeptide biosynthesis in Amycolatopsis mediterranei DSM5908: function of a halogenase and a haloperoxidase/perhydrolase. Chem Biol 9, 225235.[CrossRef][Medline]
Quadri, L. E. N., Keating, T. A., Patel, H. M. & Walsh, C. T. (1999). Assembly of the Pseudomonas aeruginosa nonribosomal peptide siderophore pyochelin: in vitro reconstitution of aryl-4,2-bisthiazoline synthetase activity from PchD, PchE, and PchF. Biochemistry 38, 1494114954.[CrossRef][Medline]
Rowland, B. M., Grossman, T. H., Osburne, M. S. & Taber, H. W. (1996). Sequence and genetic organization of a Bacillus subtilis operon encoding 2,3-dihydroxybenzoate biosynthetic enzymes. Gene 178, 119123.[CrossRef][Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Scrutton, N. S., Berry, A. & Perham, R. N. (1990). Redesign of the coenzyme specificity of a dehydrogenase by protein engineering. Nature 343, 3843.[CrossRef][Medline]
Shirahata, K., Hayashi, T., Deguchi, T., Suzuki, T. & Matsubara, I. (1972). The structures of corynecins, chloramphenicol analogues produced by an n-paraffin-grown bacterium. Agric Biol Chem 36, 22292232.
Simonsen, J. N., Paramasigamani, K., Vining, L. C., McInnes, A. G., Walter, J. A. & Wright, J. L. C. (1978). Biosynthesis of chloramphenicol. Studies on the origin of the dichloroacetyl moiety. Can J Microbiol 24, 136142.[Medline]
Strohl, W. (1992). Compilation and analysis of DNA sequences associated with apparent Streptomyces promoters. Nucleic Acids Res 20, 961974.
Stuttard, C. (1982). Temperate phages of Streptomyces venezuelae: lysogeny and host specificity shown by phages SV1 and SV2. J Gen Microbiol 128, 115121.
van Pée, K.-H. (2001). Microbial biosynthesis of halometabolites. Arch Microbiol 175, 250258.[CrossRef][Medline]
Vining, L. C. & Stuttard, C. (1995). Chloramphenicol. In Genetics and Biochemistry of Antibiotic Production, pp. 505530. Edited by L. C. Vining & C. Stuttard. Newton, MA: Butterworth-Heinemann.
Wang, Z.-X., Li, S.-M. & Heide, L. (2000). Identification of the coumermycin A1 biosynthetic gene cluster of Streptomyces rishiriensis DSM 40489. Antimicrob Agents Chemother 44, 30403048.
Wang, L., White, R. L. & Vining, L. C. (2002). Biosynthesis of the dideoxysugar component of jadomycin B: genes in the jad cluster of Streptomyces venezuelae ISP5230 for L-digitoxose assembly and transfer to the angucycline aglycone. Microbiology 148, 10911103.
Wright, F. & Bibb, M. J. (1992). Codon usage in the G+C rich Streptomyces genome. Gene 113, 5565.[CrossRef][Medline]
Received 25 September 2003; accepted 13 October 2003.