Research Article

The Mycobacterium tuberculosis Rv1099c gene encodes a GlpX-like class II fructose 1,6-bisphosphatase

Microbiology 2004; 150(10):3499 · https://doi.org/10.1099/mic.0.27204-0

View at publisher

Abstract

There are now abundant data indicating that Mycobacterium tuberculosis uses fatty acids as a carbon source in vivo. A key enzyme in gluconeogenesis, missing in the original annotation of the M. tuberculosis genome, is fructose 1,6-bisphosphatase (FBPase; EC 3.1.3.11). The authors have shown that M. tuberculosis Rv1099c, a glpX homologue, can complement Escherichia coli mutants lacking FBPase. The protein encoded by Rv1099c was shown to have FBPase activity. Rv1099c was expressed at significant levels in M. tuberculosis, and may encode the major FBPase of this pathogen.
Abbreviations: COGs, Clusters of Orthologous Groups (database); FBPase, fructose 1,6-bisphosphatase; GST, glutathione S-transferase; RTq-PCR, real-time quantitative PCR
Improving our understanding of the intracellular environment in which the pathogen Mycobacterium tuberculosis lives is one approach to identifying targets for the development of new rational control measures. A number of observations point to the importance of fatty acids as carbon and energy sources in members of the M. tuberculosis complex (Fig. 1). Thus a mutant lacking isocitrate lyase, part of the glyoxylate shunt, has a reduced persistence phenotype in a mouse model (McKinney et al., 2000). In the related Mycobacterium bovis, the pyruvate kinase gene is non-functional (Garnier et al., 2003), so the glycolysis pathway is inactive. In M. bovis BCG, a mutant lacking pckA, the gene for phosphoenolpyruvate carboxykinase (one of the two non-reversible steps in gluconeogenesis), is attenuated in vivo (Liu et al., 2003), and the pckA gene is up-regulated during growth in macrophages (Dubnau et al., 2002). Another study showed that M. tuberculosis cells present in sputum contain lipophilic inclusions (Garton et al., 2002), while Mycobacterium microti uses palmitic acid preferentially over simple carbon sources (Wheeler & Ratledge, 1988). Finally, the TraSH methodology that identifies mutations responsible for poor growth in bacteria following transposon mutagenesis (Sassetti & Rubin, 2003) identified a number of fatty acid degradation genes, the glyoxylate shunt genes, and pckA as being essential in vivo. Taken together, these findings emphasize the importance of the glyoxylate shunt and gluconeogenesis in using the carbon from fatty acids for biosynthesis of the sugars that are abundant in the cell wall and glycolipids of mycobacteria.



(19K):

Fig. 1. Lipid utilization by M. tuberculosis leading to lipoglycan synthesis via gluconeogenesis. The genes glpX and pckA which code for enzymes catalysing irreversible steps are shown, as well as fum, which lies next to glpX in the M. tuberculosis genome. The unidirectional arrows are drawn to emphasize the directions of reactions in gluconeogenesis, and do not indicate whether reactions are inherently uni- or bidirectional. The grey arrows indicate steps in the TCA cycle that would be used with glucose, but not with fatty acids, as a carbon source.

The second irreversible step in gluconeogenesis is fructose 1,6-bisphosphatase (FBPase; EC 3.1.3.11). Although the completion of the M. tuberculosis genome sequence allowed the identification of genes that were predicted to encode enzymes for most central metabolic pathways (Cole et al., 1998), no FBPase was assigned. Four classes of FBPases have been identified based on primary structure (Rittmann et al., 2003). These are Escherichia coli Fbp-like (class I) (Sedivy et al., 1984), E. coli GlpX-like (class II) (Donahue et al., 2000), Bacillus subtilis-like (class III) (Fujita et al., 1998) and dual function FBPase-inositol monophosphate phosphatases (class IV) (Verhees et al., 2002). A fifth class has been identified in the Archaea, which may represent the true FBPase in these organisms (Rashid et al., 2002). In E. coli, the major FBPase is a class I member encoded by the fbp gene, for which there is no detectable homologue in the actinomycetes. It has recently been reported that a minor class II FBPase is encoded in E. coli by the glpX gene, which is part of the glycerol 3-phosphate regulon (Donahue et al., 2000). The protein encoded by the M. tuberculosis Rv1099c gene shows 43 % identity to E. coli GlpX. In this work, the Rv1099c gene was cloned. Results of genetic and biochemical analyses revealed that the Rv1099c gene is likely to encode the missing mycobacterial FBPase. Bacterial strains and plasmids.
E. coli JLD2404 (Δfbp287), JLD2402 (glpX : : SpcR Δfbp287), and JB108 (BL21[λDE3 (lacUV5-T7 gene1)] Δfbp287) have been described before (Donahue et al., 2000). M. tuberculosis H37Rv was used for RNA analysis. Plasmid vectors used were pET15b (pT7-His-tag; Novagen) and pGEX-KG (ptac-GST; AmershamPharmacia). In pGEX-KG, the glutathione S-transferase (GST) fusion protein is induced directly by IPTG, while in pET15-b, the fusion protein is expressed by an IPTG-inducible T7 RNA polymerase encoded by a lysogenic phage. pFM142 and pFM149 carry M. tuberculosis Rv1099c cloned into pET15-b and pGEX-KG, respectively, and are described in this study.

E. coli culture conditions.
Strains were grown in Luria broth (LB) supplemented with antibiotics as needed or in M9 minimal media (Sambrook et al., 1989) containing 0·2 % glucose or 0·4 % glycerol. E. coli DH5α (Life Technologies) was used for all plasmid constructions.

Cloning of Rv1099c.
M. tuberculosis Rv1099c was cloned into expression vectors using the Tuberculist-predicted start codon (position 35 in Fig. 2). The Rv1099c coding sequence was amplified by PCR using primers Rv1099c-NdeI (GGAATTCCATATGGAGCTGGTCCGGGT) and Rv1099c-XhoI (TGACTCGAGGGCAATGGGTACACG). These primers introduced an NdeI site at the 5' end and an XhoI at the 3' end to allow the gene to be cloned in-frame into the expression vector pET-15b. Primers Rv1099c-PvuII (GGATCAGCTGATGGAGCTGGTCCGGGT) and Rv1099c-EcoRI (CGGAATTCGGGCAATGGGTACACG) were used to introduce a PvuII site at the 5' end and an EcoRI at the 3' end to allow the gene to be cloned in-frame into the expression vector pGEX-KG. The primers were each used at 300 nM final concentration. PCR was carried out using the Expand High Fidelity PCR system (Boehringer Mannheim) with M. tuberculosis DNA as the template and DMSO at 2 %. The temperature cycle used was: an initial 3 min at 94 °C to denature high-G+C DNA; 10 cycles of 45 s at 94 °C, 1 min at 63 °C and 1 min at 72 °C; 25 cycles of 45 s at 94 °C, 1 min at 63 °C and 1 min at 72 °C (this last increasing by 20 s per cycle); and finally an extension step of 7 min at 72 °C to complete primer extension. The PCR products were cleaved with the appropriate restriction enzymes and cloned into the vectors pET-15b or pGEX-KG. In this way, plasmids expressing the M. tuberculosis Rv1099c gene were generated, as both His-tag and GST-fusion constructs.



(75K):

Fig. 2. A multiple sequence alignment of actinomycete class II FBPases and E. coli GlpX. The putative class II FBPases for M. tuberculosis (Mtb), M. smegmatis (Msm), M. avium (Mav), M. leprae (Mlp), Streptomyces coelicolor (Sco), Corynebacterium diphtheriae (Cdi), and E. coli (Eco) GlpX and C. glutamicum (Cgl) Fbp were aligned with CLUSTALW (Thompson et al., 1994) using default settings. The CLUSTALW alignment was shaded using the CHROMA program (Goodstadt & Ponting, 2001). Fully conserved residues are in white on a black background; other residues are shaded according to their physicochemical properties. Invariant positions are indicated by asterisks (*) below the alignment, while highly conserved and weakly conserved positions are indicated by colons and periods, respectively. The Eco sequence was obtained from SWISS-PROT (accession no. P28860), the Cgl and Sco sequences were obtained from GenBank (accession nos 19552240 and 21223420 respectively), the Mtb sequence was obtained from the Tuberculist server (; gene name Rv1099c), the Mlp sequence was obtained from the Leproma server (; gene name ML1946), the Msm and Mav sequences were derived from unpublished genomic sequences obtained from The Institute for Genomic Research website (), and the Cdi sequence was obtained from the Sanger Centre (Cerdeno-Tarraga et al., 2003) (also available from GenBank: accession no. 38199795). The exact start residue of the proteins is known only for Synecococcus PCC7942 (Tamoi et al., 1996) (which corresponds to the predicted E. coli start), and for C. glutamicum (Rittmann et al., 2003). For all other proteins, we have predicted the start codon, which may not necessarily be the same as that given when using the aforementioned accession numbers, on the basis of mutual homologies. The (probably incorrect) start position for the Mtb and Mlp sequences (as described in the Tuberculist and Leproma databases) is indicated by an M. The location of IMP1 Prosite motif ( accession no. PS00629), is indicated by a bar above the alignment. The motif is nearly present in the mycobacterial putative class II FBPases, as can be seen from the list of valid motif residues shown under the alignment (x=any residue valid): only one mismatch is found (position 121, underlined). However, there are two mismatches to the Sco sequence, and three mismatches to the Eco GlpX, the Cgl Fbp and the Cdi putative FBPase II.

Enzyme preparation and assay.
Strains of E. coli were grown with aeration at 37 °C in LB medium to the exponential phase, induced with IPTG (0·1 mM), and incubated with shaking at room temperature for 3 h. Bacteria were harvested by centrifugation, washed and the pellets were resuspended in 24 ml 25 mM Tris/HCl (pH 7·3) containing 2 mM dithiothreitol. This suspension was sonicated for 40 s at 50 % amplitude with a 5 mm diameter probe (Sonics & Materials VibraCell), and the sonicate clarified by centrifugation (12 000 g, 5 min). Virtually all enzyme activity was in the supernatant fractions. GST activity was assayed using the AmershamPharmacia GST detection module according to the manufacturer's instructions. FBPase activity was assayed at 37 °C by measuring the fructose 6-phosphate produced in an assay coupled to phosphoglucoisomerase and glucose-6-phosphate dehydrogenase by following the production of NADPH (Rashid et al., 2002). Preliminary attempts to purify fusion proteins using HiTrap Chelating HP or GS Trap FF columns (AmershamPharmacia) according to the manufacturer's instructions resulted in loss of FBPase activity. Therefore, clarified cell extracts were used for the enzyme work described below. All enzyme extracts and preparations were desalted using AmershamPharmacia PM10 columns equilibrated and eluted with 25 mM Tris/HCl (pH 7·3) containing 2 mM dithioerythritol according to the manufacturer's instructions.

To estimate the Km, the concentration of fructose 1,6-bisphosphate was varied from 2 mM (the concentration routinely used elsewhere; see Rashid et al., 2002) down to 3 µM. Fructose 1,6-bisphosphate was used at 20 µM in all experiments designed to test for potential inhibitors, including LiCl, that were included at the concentrations mentioned in Results. The potential inhibitors were mixed with extracts and incubated for 5 min before adding substrate to start the reaction.

Quantitative PCR.
RNA was prepared from an exponential (7-day) rolling culture of M. tuberculosis H37Rv (Betts et al., 2002), and cDNA synthesis was carried out using Superscript II (Invitrogen) according to the manufacturer's protocol. Real-time quantitative PCR (RTq-PCR) reactions were set up using the DyNAmo SYBR Green qPCR kit (MJ Research) and RTq-PCR was performed using the DNA Engine Opticon 2 System (Genetic Research Instrumentation). Reactions containing 1x DNA Master SYBR Green I mix, 1 µl cDNA product and 0·4 µM of each primer in 20 µl were set up on ice. Samples were heated to 95 °C for 10 min before cycling for 35 cycles of 95 °C for 30 s, 60 °C (Rv1099c) or 62 °C (sigA) for 20 s, and 72 °C for 20 s. Fluorescence was captured at the end of each cycle after heating to 80 °C to ensure the denaturation of primer-dimers. The experiment was repeated three times using cDNA from each of two independent RNA preparations.

Comparison of glpX orthologues and their genomic contexts
The Rv1099c gene is homologous to E. coli glpX. An alignment of predicted GlpX proteins from several actinomycetes, as well as E. coli, is shown in Fig. 2. We suggest that Rv1099c is a class II FBPase; it has 43 % identity (62 % similarity) to E. coli GlpX, and low similarity to members of the other FBPase classes. In the Clusters of Orthologous Groups (COGs) database (Tatusov et al., 2001), Rv1099c is clustered with other class II (GlpX-like) FBPases.

Rv1099c is the first gene in a cluster of three genes that we predict is an operon (see Fig. 3). The second gene, fum (30 bp downstream), encodes the only predicted fumarase in the genome, which is presumed to function in the citric acid cycle (Fig. 1). Its location next to Rv1099c is conserved in all the sequenced mycobacterial genomes, and suggests a functional relationship between these two genes. Rv1097c, the start of which overlaps the end of fum in M. tuberculosis, is a putative Gly/Pro-rich membrane protein with unknown function that is not conserved in other species. A conserved hypothetical gene, Rv1100, is transcribed divergently from this putative operon, and its conserved synteny in other genomes is suggestive of a related function.



(21K):

Fig. 3. Comparative genome analysis of actinomycete glpX genes. The genetic structure of regions containing the glpX gene are shown for M. tuberculosis (Mtub), M. smegmatis (Msm), M. avium (Mav), M. leprae (Mlep), Corynebacterium glutamicum (Cglu), C. diphtheriae (Cdip) and S. coelicolor (Sco). Black arrows, glpX gene; white arrows, genes showing homology to those in the M. tuberculosis phoH2-Rv1101c region; grey arrows, genes not showing homology to those in the M. tuberculosis phoH2-Rv1101c region; white hatched arrow (ML1948), as for grey arrows but pseudogene. Gene names/numbers arrows refer to the gene identification for that species except for M. avium, which has not yet been annotated, and M. tuberculosis designations are used. Numbering of genes refers to the relevant species: thus 1100c is short for Rv1100c, 1945 is short for ML1945.

The intergenic region between the divergently transcribed Rv1099c and Rv1100 genes is currently annotated at 100 bp. We suggest, however, that the start of the coding sequence (MELV...) predicted for Mtb Rv1099c in GenBank (accession no. 15608239) and in Tuberculist Release 5 () is misannotated (Fig. 2), because the homology with E. coli GlpX extends several amino acids upstream to a different methionine, and homology to the Corynebacterium glutamicum Fbp (confusingly the homologue of E. coli GlpX, and not of E. coli Fbp, i.e. a class II FBPase) extends further still. Critically, experimental analysis of the C. glutamicum protein confirms that this conserved region is translated (Rittmann et al., 2003), contrary to the assignment in the published sequence. This would mean that the M. tuberculosis protein is likely to start 66 (VSAH...) or 102 (MTAE...) base pairs upstream. Alignment with the Mycobacterium avium sequence, which has a potential start analogous to the 102 but not the 66 start, suggests that the 102 start is correct. Similarly, we predict the Mycobacterium leprae start codon to be 57 bases upstream of that predicted by the Leproma database Release 2 (). Mycobacterium smegmatis has an analogous methionine to the start codon of the C. glutamicum.

This reassignment of the start of M. tuberculosis Rv1099c affects the predicted start for the divergently transcribed Rv1100, as it overlaps the newly assigned start codon for Rv1099c. While it is possible that both promoters lie within coding sequences, it is more likely that there is an intergenic gap. The corynebacterial Rv1100 homologues are located further upstream of glpX (∼200 bp), and have only one potential start site upstream of conserved regions (C. glutamicum: VAEK...). M. tuberculosis Rv1100 has a potential GTG start codon in a similar position in the aligned proteins; this aligns with the likely start in M. smegmatis (MTTQ...), and we propose that this is the genuine start codon. This would leave the intergenic gap between Rv1099c and Rv1100 at 57 bp. We suggest new translational starts for the M. leprae homologues using similar logic: glpX (ML1946) will start 81 bp upstream of the current assignment at base 2332629 (old start, MELV...; new start, MTAE...), and the Rv1100 orthologue ML1945 will start 84 bp of the current assignment at base 2332549 downstream (old start, MVND...; new start, VTFE...).

Complementation of E. coli mutants
It is possible to test for FBPase activity by genetic complementation, as an E. coli fbp mutant is unable to grow on medium with glycerol as sole carbon source (Donahue et al., 2000). We therefore cloned Rv1099c into two expression vectors, so that it would be expressed either with a short N-terminal His-tag (pFM142), or fused to the C-terminal end of GST (pFM149). These constructs were introduced into E. coli strains JLD2402, which lacks both fbp and glpX, and JLD2404, which lacks only fbp. Antibiotic-resistant transformants were selected and then plated onto minimal agar plates containing glucose or glycerol as carbon source, and IPTG to induce expression of Rv1099c. All of these strains grew on glucose agar, whereas the control strains only grew on glycerol agar (results with JLD2402 and pFM149 are shown in Fig. 4). Complementation was not expected from the pET15b-based clone pFM142, because of the lack of a host T7 polymerase gene, but was detected; our experience is that this can occur due to read-through from other promoters. These results confirm that Rv1099c has FBPase activity. For historical reasons, the clones were made using the start site predicted by Tuberculist. The fact we obtained activity indicates that if the protein does have an extended N-terminus as we predict, this region is not critical for function.



(89K):

Fig. 4. Growth pattern of the glucose-requiring E. coli strains. JLD2402 (1), and JLD2402 transformed with the pGEX-KG vector (2) or pFM149 (3) were streaked onto minimal agar containing glucose or glycerol as carbon source.

FBPase activity in complemented E. coli mutants
pFM142 and pFM149 were transformed into E. coli JB108, a BL21(λDE3)-based strain that lacks fbp, and allows both pGEX and pET15-b-based constructs to be expressed. A spectrophotometric coupled-enzyme assay was used to measure the FBPase activity in cell-free extracts (Table 1). The E. coli JB108 (Δfbp) host gave low background levels, and introduction of pFM142 or pFM149 resulted in elevated levels of FBPase. Note that although strain JB108 has a functional chromosomal glpX gene, we showed that FBPase levels in strain JLD2402 (Δfbp ΔglpX) were not significantly different from those in strain JLD2404 (Δfbp) (Table 1), supporting earlier observations that although E. coli GlpX has FBPase activity, the gene is expressed at low levels (Donahue et al., 2000).


Table 1. FBPase activity in E. coli strains expressing mycobacterial GlpX proteins Abbreviations: sp. act, specific activity; n, number of determinations; IU, international enzyme units (1 unit converts 1 µmol substrate min1; therefore 1 mIU converts 1 nmol min1); NA, not applicable.


We determined that the Km of the M. tuberculosis recombinant enzyme for fructose 1,6-bisphosphate was 15 µM (three determinations, range 1217 µM), using E. coli cell-free extracts. The Km values obtained were similar for the two types of fusion protein made in this study, suggesting that the type of fusion construct used did not affect the affinity of the FBPase for its substrate. The effects of phosphoenolpyruvate, AMP, ADP, citrate and Li+ on the FBPase activity of both the GST fusion and the His-tagged proteins were tested. None of the metabolites had any effect up to 1 mM, but 1·1 mM Li+ gave 50 % inhibition and 10 mM Li+ gave over 90 % inhibition (not shown).

Gene expression levels in M. tuberculosis
We carried out RTq-PCR experiments to determine the level of expression of Rv1099c mRNA in exponential cultures of M. tuberculosis in Middlebrook 7H9 medium containing OADC supplement and Tween 80. Expression levels were normalized to those of sigA mRNA, and calculated based on the RNA used for reverse transcription. We showed that in mid-exponential-phase growth in supplemented Middlebrook 7H9 medium (which contains both glucose and Tween 80 as carbon sources), the level of Rv1099c mRNA is 0·49 (95 % confidence interval 0·390·63) that of sigA.

Although no FBPase was annotated in the genomes of any of the actinomycetes when this work started, the ability of these organisms to grow on gluconeogenic substrates such as fatty acids or glycerol requires FBPase to be present in order to provide the hexose needed for synthesis of their abundant cell envelope glycans and mannolipids. In other organisms, particularly the Archaea, where no FBPase was annotated during whole-genome analyses, other members of the carbohydrate phosphatase superfamily (; release 1.65) have been shown to encode active FBPases. In M. tuberculosis, this superfamily comprises the impA, suhB, impC (Rv3137c), cysQ and Rv1099c genes.

We show here that M. tuberculosis Rv1099c has FBPase activity with saturable kinetics, and a Km at 15 µM that is similar to the affinity of bacterial class II FBPases for fructose bisphosphate. For example, the C. glutamicum enzyme has a Km of 14 µM and the E. coli GlpX has a Km of 35 µM. Lithium inhibits by interfering with the Mg2+ binding site of sugar phosphatases (Chen & Roberts, 1998), so its effect on the M. tuberculosis FBPase activity is consistent with this. The lack of effect of any of the intermediates is surprising as it is expected that GlpX needs to be regulated, for instance to avoid futile cycling when phosphofructokinase is active. However, their effects need to be investigated further on purified, possibly cleaved fusion protein before drawing any firm conclusions about regulation.

We suggest that Rv1099c may be the major FBPase of M. tuberculosis; this is supported by the recent report where the GlpX homologue of C. glutamicum was characterized (Rittmann et al., 2003). The authors showed that it contained FBPase activity, and demonstrated that a mutant lacked any detectable FBPase activity. The corynebacterial glpX mutant was incapable of growth on gluconeogenic substrates, which substantiates the observation that no other FBPase is predicted by the genome sequence of this organism. The C. glutamicum gene was accordingly named fbp; we, however, propose that Rv1099c be called glpX in order to avoid the implication that it is orthologous to the E. coli fbp gene; the glpX name is also used in the COGs database.

Interestingly, all the mycobacterial class II FBPases shown in Fig. 2 have a near-perfect Prosite () inositol monophosphate phosphatase IMP1 motif (PS00629), although they have no IMP2 motif (PS00630). This may suggest a closer homology of the mycobacterial class II FBPases to IMPases than other members of the family. No activity with inositol 1-phosphate could be attributed to Rv1099c under the conditions examined (data not shown).

We demonstrated that Rv1099c is expressed in the cell. mRNA levels approximately half of the level of sigA, the major sigma factor of the cell, were detected. The fact that it is expressed is also indicated by the identification of the protein in 2D-PAGE analysis ().

Support for a key biological role for the M. tuberculosis glpX gene comes from independent concurrent research using a genome-wide transposon-based method (TraSH) for identifying genes that are required for growth in different conditions (Sassetti et al., 2001; Sassetti & Rubin, 2003). The data suggest that the fum gene (Figs 1 and 3) is an essential gene for axenic growth in the presence of both glycolytic (glucose) and gluconeogenic (oleic acid) carbon sources together (Middlebrook 7H9+OADC+Tween 80). Mutants deficient in Rv1100 (which is conserved syntenically with Rv1099c in mycobacteria and corynebacteria) grew slowly, but it appeared that mutants deficient in Rv1099c grew normally. However, a comparison between axenic and in vivo growth showed that mutants in Rv1099c were among the most severely attenuated in a mouse model. This was confirmed in separate experiments showing that an Rv1099c transposon mutant is highly attenuated in vivo (Sassetti & Rubin, 2003). The extreme attenuation of the glpX mutant is consistent with the essential role of gluconeogenesis for conversion of lipid carbon into cell wall glycan (Fig. 1). These data, together with the demonstration that a C. glutamicum fbp mutant has lost all detectable FBPase activity, suggest that glpX encodes the major FBPase in M. tuberculosis.

This work was supported by the European Union TB vaccine consortium QLK2-CT-1999-01093 and GlaxoSmithKline (F. M.), BBSRC project grant 48/P18545 (S. L. K.), Wellcome Trust grants 073237 (F. M.) and 062508 (S. R.) and DEFRA (P. R. W.). The RTq-PCR equipment was funded by Wellcome Trust grant 068969. We thank Lisa Keating for helpful discussions. Preliminary sequence data (M. avium and M. smegmatis) were obtained from The Institute for Genomic Research through the website at . Preliminary Corynebacterium diphtheriae sequence data, gene predictions and comparison files were obtained from Ana Cerdeño-Tarraga and Julian Parkhill at the Sanger Centre.

References

Betts, J. C., Lukey, P. T., Robb, L. C., McAdam, R. A. & Duncan, K. (2002). Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Mol Microbiol 43, 717731.[CrossRef][Medline]

Cerdeno-Tarraga, A. M., Efstratiou, A., Dover, L. G. & 23 other authors (2003). The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129. Nucleic Acids Res 31, 65166523.[Abstract/Free Full Text]

Chen, L. & Roberts, M. F. (1998). Cloning and expression of the inositol monophosphatase gene from Methanococcus jannaschii and characterization of the enzyme. Appl Environ Microbiol 64, 26092615.[Abstract/Free Full Text]

Cole, S. T., Brosch, R., Parkhill, J. & 39 other authors (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537544.[CrossRef][Medline]

Donahue, J. L., Bownas, J. L., Niehaus, W. G. & Larson, T. J. (2000). Purification and characterization of glpX-encoded fructose 1,6-bisphosphatase, a new enzyme of the glycerol 3-phosphate regulon of Escherichia coli. J Bacteriol 182, 56245627.[Abstract/Free Full Text]

Dubnau, E., Fontan, P., Manganelli, R., Soares-Appel, S. & Smith, I. (2002). Mycobacterium tuberculosis genes induced during infection of human macrophages. Infect Immun 70, 27872795.[Abstract/Free Full Text]

Fujita, Y., Yoshida, K., Miwa, Y., Yanai, N., Nagakawa, E. & Kasahara, Y. (1998). Identification and expression of the Bacillus subtilis fructose-1,6-bisphosphatase gene (fbp). J Bacteriol 180, 43094313.[Abstract/Free Full Text]

Garnier, T., Eiglmeier, K., Camus, J. C. & 19 other authors (2003). The complete genome sequence of Mycobacterium bovis. Proc Natl Acad Sci U S A 100, 78777882.[Abstract/Free Full Text]

Garton, N. J., Christensen, H., Minnikin, D. E., Adegbola, R. A. & Barer, M. R. (2002). Intracellular lipophilic inclusions of mycobacteria in vitro and in sputum. Microbiology 148, 29512958.[Medline]

Goodstadt, L. & Ponting, C. P. (2001). CHROMA: consensus-based colouring of multiple alignments for publication. Bioinformatics 17, 845846.[Abstract/Free Full Text]

Liu, K., Yu, J. & Russell, D. G. (2003). pckA-deficient Mycobacterium bovis BCG shows attenuated virulence in mice and in macrophages. Microbiology 149, 18291835.[CrossRef][Medline]

McKinney, J. D., Honer zu Bentrup, K., Munoz-Elias, E. J. & 7 other authors (2000). Persistence of Mycobacterium tuberculosis in macrophages and mice requires the glyoxylate shunt enzyme isocitrate lyase. Nature 406, 735738.[CrossRef][Medline]

Rashid, N., Imanaka, H., Kanai, T., Fukui, T., Atomi, H. & Imanaka, T. (2002). A novel candidate for the true fructose-1,6-bisphosphatase in archaea. J Biol Chem 277, 3064930655.[Abstract/Free Full Text]

Rittmann, D., Schaffer, S., Wendisch, V. F. & Sahm, H. (2003). Fructose-1,6-bisphosphatase from Corynebacterium glutamicum: expression and deletion of the fbp gene and biochemical characterization of the enzyme. Arch Microbiol 180, 285292.[CrossRef][Medline]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Sassetti, C. M. & Rubin, E. J. (2003). Genetic requirements for mycobacterial survival during infection. Proc Natl Acad Sci U S A 100, 1298912994.[Abstract/Free Full Text]

Sassetti, C. M., Boyd, D. H. & Rubin, E. J. (2001). Comprehensive identification of conditionally essential genes in mycobacteria. Proc Natl Acad Sci U S A 98, 1271212717.[Abstract/Free Full Text]

Sedivy, J. M., Daldal, F. & Fraenkel, D. G. (1984). Fructose bisphosphatase of Escherichia coli: cloning of the structural gene (fbp) and preparation of a chromosomal deletion. J Bacteriol 158, 10481053.[Medline]

Tamoi, M., Ishikawa, T., Takeda, T. & Shigeoka, S. (1996). Molecular characterization and resistance to hydrogen peroxide of two fructose-1,6-bisphosphatases from Synechococcus PCC 7942. Arch Biochem Biophys 334, 2736.[CrossRef][Medline]

Tatusov, R. L., Natale, D. A., Garkavtsev, I. V. & 7 other authors (2001). The COG database: new developments in phylogenetic classification of proteins from complete genomes. Nucleic Acids Res 29, 2228.[Abstract/Free Full Text]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, 46734680.[Abstract]

Verhees, C. H., Akerboom, J., Schiltz, E., de Vos, W. M. & van der Oost, J. (2002). Molecular and biochemical characterization of a distinct type of fructose-1,6-bisphosphatase from Pyrococcus furiosus. J Bacteriol 184, 34013405.[Abstract/Free Full Text]

Wheeler, P. R. & Ratledge, C. (1988). Use of carbon sources for lipid biosynthesis in Mycobacterium leprae: a comparison with other pathogenic mycobacteria. J Gen Microbiol 134, 21112121.[Medline]

Received 1 April 2004; revised 17 June 2004; accepted 12 July 2004.



HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS
Copyright © 2004 Society for General Microbiology.