Abstract
Both NADH dehydrogenases are controlled at the transcriptional level by complex regulatory networks. Expression of the nuoA-N operon responds to oxygen and nitrate availability via the two-component sensorregulators ArcB-A (anaerobic repression) and NarX-L (nitrate activation) and to C4-dicarboxylates via an uncharacterized regulator acting at a far upstream site between -277 and -899 (Bongaerts et al., 1995). The ndh gene is subject to anaerobic repression (Spiro et al., 1989) by the direct interaction of the oxygen-responsive transcription factor FNR with two sites in the ndh promoter, FNR I and FNR II (Fig. 1; Green & Guest, 1994; Meng et al., 1997). Both FNR sites are required for full repression of ndh expression (Meng et al., 1997). As well as being subject to FNR-mediated repression, the ndh promoter responds to growth phase and it has been suggested that this response is regulated by the growth-phase-responsive transcription factor Fis (Green et al., 1996). The ndh promoter region has three Fis-binding sites (Fig. 1; Green et al., 1996) and because of the relative affinities of Fis for each site it was suggested that binding to the high-affinity Fis I site might mediate activation, whereas progressive occupation of the lower affinity sites might lead to repression (Fig. 1; Green et al., 1996). Here we show that Fis bound at the high-affinity Fis I site has a small positive effect on ndh expression, but that a greater contribution is made by Fis occupying the lower affinity Fis II site. The location of the Fis II site (centred 72 bp upstream of the transcript start) and the observation that Fis-mediated activation of ndh expression is dependent on the C-terminal domain of the RNA polymerase α-subunit, indicates that the ndh promoter is a Class I Fis-activated promoter. Furthermore, it is confirmed that both FNR sites contribute to FNR-mediated repression under anaerobic conditions.
|
The bacterial strains and plasmids used along with their relevant characteristics are listed in Table 1. Escherichia coli RK4353 (lac) and the isogenic fnr derivative RK5279 were used as the recipients for P1-mediated transduction of the fis : : kan mutation to create JRG4656 and JRG4203, respectively, using standard techniques. The low-copy-number vector pRW50 (Lodge et al., 1992), which contains a promoterless lacZ gene, was used to create a series of ndh : : lacZ fusions with specific deletions (pGS1756pGS1762) and replacements (pGS1529, pGS1530, pGS1541) in the ndh promoter region. The rpoA expression plasmid, pGS1209, and the corresponding plasmid containing a subgene encoding RpoA lacking the C-terminal domain were derivatives of ptac85 (Marshall et al., 2001).
Table 1. Bacterial strains and plasmids
Growth conditions and assay of β-galactosidase.
The rich growth medium was tryptone (10 g l-1), yeast extract (5 g l-1), NaCl (5 g l-1) containing 0·2 % (w/v) glucose and antibiotics when required: tetracycline (35 mg l-1); kanamycin (25 mg l-1); ampicillin (200 mg l-1). The minimal glucose medium was M9 (Sambrook & Russell, 2001) supplemented with arginine (30 mg l-1). Cultures were grown from colonies on agar plates at 37 °C, either aerobically in conical flasks (5 ml in a 250 ml flask, shaking at 250 r.p.m.) or anaerobically in sealed bottles (7 ml without shaking). Except where indicated, cultures were grown for 16 h before measuring β-galactosidase activities according to Miller (1972) using at least three independent cultures. To determine whether the different genetic backgrounds altered the copy number of the lacZ reporter plasmids the method of Taylor & Brose (1988) was used. It was shown that plasmid copy number was not significantly affected.
Plasmid construction and mutagenesis.
The ndh promoter fragments used were amplified by PCR from pGS418 (Sharrocks et al., 1991) using the EXPAND Hi-fidelity system (Roche). After restriction digestion at unique EcoRI and BamHI sites introduced into the PCR primers, the products were ligated into EcoRI/BamHI-digested pRW50 (Lodge et al., 1992). Overlap PCR using specific mutagenic primers was used to replace the Fis sites with unrelated DNA sequences (see below). The authenticity of the constructs was confirmed by DNA sequencing.
The starting point for this work was the observation that Fis specifically interacts with three regions of the ndh promoter (Fig. 1; Green et al., 1996). Moreover, from the patterns of Fis and ndh expression during the E. coli growth cycle it was suggested that ndh expression is activated when the intracellular concentration of Fis is low (late exponential/stationary phase) and repressed when the intracellular concentration of Fis is high (early exponential phase) (Green et al., 1996). Based on relative binding affinities, it was suggested that occupation of the high-affinity Fis site centred at -123 (Fis I; Fig. 1) might enhance ndh expression, whereas occupation of the lower affinity sites (Fis II and III; Fig. 1) might reduce ndh expression (Green et al., 1996). To test this hypothesis a series of ndh : : lacZ gene fusions (N1N7) were created in which ever larger sections of the ndh promoter were deleted such that the upstream Fis I, FNR I, Fis II and FNR II sites were sequentially removed (Fig. 2a). Cultures of E. coli RK4353 (lac) carrying the indicated ndh : : lacZ fusions on the low-copy-number plasmid pRW50 (Lodge et al., 1992) were grown in L-broth under anaerobic conditions and promoter activity was estimated by measuring β-galactosidase activities.
|
Previous site-directed mutagenesis of the FNR sites within the ndh promoter indicated that both were required for maximal repression (Meng et al., 1997). Accordingly, removal of the section of the ndh promoter containing the upstream FNR I site (fusion N5) partially relieved anaerobic repression in RK4353 and repression was further relieved by the removal of the FNR II site (fusion N7; Fig. 2b). Thus, the promoter deletion analysis supports the conclusion that both FNR sites contribute to the anaerobic repression of ndh expression.
To investigate the role of Fis in the absence of FNR-mediated repression, β-galactosidase activities from the ndh : : lacZ fusions in anaerobic cultures of RK5279 (fnr lac) were measured. The data revealed that deletion of the far upstream Fis I site (fusion N4) reduced ndh expression, suggesting that Fis bound at this site enhances ndh expression (Fig. 2c). Deletion of the Fis II site (fusion N6) reduced ndh transcription still further, suggesting that Fis also acts positively at this site (Fig. 2c).
To show that Fis was responsible for the effects observed, β-galactosidase activities were measured in a fis lac mutant strain (JRG4656) and in an fnr fis lac mutant strain (JRG4203). These investigations confirmed that under anaerobic conditions both FNR sites contribute to FNR-mediated repression (Fig. 2d). Moreover, in the absence of Fis and FNR, deletion of the Fis and FNR sites did not significantly alter ndh expression, showing that, as expected, deletion of the upstream Fis-binding sites has no effect on ndh expression in a fis background (Fig. 2e).
The experiments described above suggested that Fis bound at two upstream sites within the ndh promoter activates ndh expression under anaerobic conditions. The ndh gene is normally expressed under aerobic conditions when FNR is inactive. Therefore, the effects of the ndh promoter deletions were tested under aerobic conditions. To ensure that the bacteria contained no residual active FNR protein, aerobic cultures of RK5279 (fnr lac) and JRG4203 (fnr fis lac) were used. For RK5279 the data show that deletion of the far upstream Fis I site (fusion N4) reduced ndh expression, which was further reduced by deletion of the Fis II site (Fig. 3a). In the absence of Fis, deletion of the Fis sites did not effect ndh expression, which was ∼5-fold lower than the levels observed in the presence of Fis (Fig. 3b). Comparison of expression in the fis fnr double mutant in the absence (Fig. 2e) and presence (Fig. 3b) of oxygen suggests that at least one other regulatory protein modulates ndh expression. Previous work indicated that IHF, HU and an uncharacterized protein, Arr, interact with ndh promoter DNA (Green et al., 1997). Thus, one or more of these transcription factors could be responsible for the threefold-lower levels of ndh expression observed under aerobic conditions in the absence of Fis. In conclusion, the experiments under aerobic conditions confirmed that Fis acts as a positive regulator of ndh expression by interaction with two sites located upstream of the basic promoter elements.
|
Site-directed mutagenesis of Fis sites in the ndh promoter
The experiments using stationary-phase cultures described above established that Fis affects ndh expression and that these effects correlate with the presence of the previously identified upstream Fis sites. Because Fis is more abundant in growing bacteria (Ishihama, 1999), any effect of Fis is likely to be more apparent in exponential-phase cultures. Therefore, exponential-phase cultures were used to assign specific roles to the Fis sites in the ndh promoter (Fig. 1). Site-directed mutagenesis was used to generate three ndh promoter variants: Pndh-++ retained the Fis II and Fis III sites, but the Fis I site was altered by replacing 26 bp (-137 to -112, AATTCGCTCAAATAATAAACAATAA) with an unrelated sequence (GTCGGCGGCGGTGCTGGTGGGCTGGA); Pndh+-+ retained the Fis I and Fis III sites, but the Fis II site was altered by replacing 16 bp (-76 to -62, TATCTTTTCAGCAACA) by an unrelated sequence (GGCGGTGCTGGTGGGC); Pndh++- retained the Fis I and Fis II sites but the Fis III site was altered by replacing 25 bp (+39 to +63, AGCTATGTTAATAACCATTAATTAA) by an unrelated sequence (TCGGCGGCGGTGCTGGTGGGCTGGC). Initial experiments indicated that mutation of the low-affinity Fis III site (Fig. 1) appeared to slightly enhance ndh expression in aerobic cultures of RK4353 (2138±183 Miller units) compared to the unaltered ndh : : lacZ fusion (1790±115 Miller units). Thus, as expected from the low affinity of this site for Fis and its location relative to the transcript start, the Fis III site had only a small negative effect on ndh transcription in vivo and attention was therefore focused on the two upstream Fis sites. Exponential-phase cultures of strains carrying the unaltered ndh promoter (Fig. 4) exhibited higher levels of expression than the equivalent stationary-phase cultures (Figs 2 and 3), consistent with the known enhanced levels of Fis in growing cultures. The altered ndh : : lacZ fusions in the parental strain grown under anaerobic conditions in rich medium showed that impairment of the Fis I site caused a small reduction in expression, whereas impairment of the Fis II site caused a greater reduction (Fig. 4). As expected, in the absence of FNR, expression from all the promoters was derepressed, but the pattern of relative expression was similar to that of the parental strain, with impairment of Fis II yielding the greatest reduction in expression (Fig. 4). In the absence of Fis, the transcriptional activities for all the promoter fusions tested were similar, indicating that the mutagenesis of the Fis sites had not altered the basal activity of the promoter. Moreover, the activities of Pndh+-+ in both fis and fnr fis strains were similar to the corresponding parental strains, indicating that impairment of Fis II affected ndh expression to the same extent as a fis lesion. Similar patterns of expression were observed for equivalent cultures grown in minimal medium (not shown). Thus, it was concluded that Fis acts as a positive regulator of ndh expression mainly by interacting with the Fis II site. It is unlikely that Fis acts as an antirepressor by preventing FNR from fulfilling its role as a repressor of ndh expression, because altering the Fis II site lowers ndh expression even in an fnr mutant.
|
In accord with the observations made under anaerobic conditions, replacement of the Fis I site in aerobic cultures had only a small effect on ndh expression, but replacement of Fis II had a marked effect on transcription of ndh (Fig. 4). In the absence of Fis, expression from the unaltered ndh promoter was reduced and the differences in activities between the unaltered and the variant promoters were once again largely abolished (Fig. 4). Thus, it was concluded that under both anaerobic and aerobic conditions Fis bound at the Fis II site acts as a major activator of ndh expression.
It is well established that the intracellular concentration of Fis in E. coli is growth-rate-responsive (Ishihama, 1999). During early exponential growth Fis is the major nucleoid-associated protein, but during stationary phase it is amongst the least abundant (Ishihama, 1999). Thus, β-galactosidase activities from the unaltered ndh promoter (Pndh) and the variant with a lesion in Fis II (Pndh+-+) were monitored during aerobic growth to determine the point of the growth cycle at which Fis-mediated activation of ndh expression was most effective. The results are shown in Fig. 5. For Pndh, expression was greatest during exponential growth, when the intracellular Fis levels are high. As growth proceeded a steady decline in ndh expression was observed (Fig. 5). In contrast, expression from Pndh+-+, or from Pndh in a fis mutant strain, was more uniform and lower throughout the growth cycle (Fig. 5). These experiments suggest that Fis activates ndh expression during exponential growth by binding at the Fis II site in the ndh promoter.
|
Fis is a Class I activator of ndh expression
Many transcription factors act by forming direct contacts with RNA polymerase to assist in transcription initiation. Regulated promoters have been classified according to the location of their activator-binding sites (Busby & Ebright, 1994, 1999). At Class II promoters the activator-binding site overlaps, or is close to the σ-binding site, whereas at Class I promoters the activator-binding site is located further upstream. The Fis II site is located 72 bp upstream of the ndh transcript start (Fig. 1) and is therefore at a Class I position. The Class I promoter architecture allows RNA polymerase to establish only one protein : protein contact, and this is between the activator and the C-terminal domain of the α-subunit of RNA polymerase. Therefore, expression of a gene encoding an α-subunit lacking the C terminus should diminish ndh expression to the levels observed in a fis mutant because the activating contact cannot be made. To maintain bacterial viability, unaltered RNA polymerase has to be available in the cell. Thus, a chromosomal copy of wild-type rpoA is retained in the strains used in these experiments and the altered rpoA gene is introduced on a multicopy plasmid. This causes a proportion of the RNA polymerase to be assembled with the altered α-subunit in place of the wild-type. Therefore, fnr and fnr fis mutants carrying ndh : : lacZ fusion N1 (pGS1756) were transformed with either pGS1209 (carrying a wild-type rpoA gene) or pGS1374 (carrying an rpoA gene lacking the coding region for the C-terminal domain). Expression of ndh : : lacZ was then measured in three independent anaerobic cultures grown in rich medium plus glucose. Expression of ndh : : lacZ expression in the fnr mutant transformed with pGS1374 was ∼2-fold lower (318±17 Miller units) than that observed with the same strain containing pGS1209 (601±24 Miller units). Expression of ndh : : lacZ expression in the fnr fis double mutant transformed with pGS1374 was similar (265±27 Miller units) to that observed with the same strain containing pGS1209 (269±9 Miller units). Thus, in the presence of the mutant rpoA gene, or in the absence of fis, ndh expression was lowered by a similar amount, supporting the conclusion that Fis acts as a Class I activator of ndh expression. The experiments described here lead to three conclusions. First, Fis stimulates ndh expression under both aerobic and anaerobic growth conditions. Second, this activation is dependent upon Fis acting as a Class I activator by binding at a site (Fis II) located between the two FNR sites. Third, under anaerobic conditions both FNR sites within the ndh promoter contribute to FNR-mediated repression.
Fis is a multifunctional nucleoid-associated protein and is the most abundant transcriptional activator in exponential-phase cells (Ishihama, 1999). Fis is a homodimeric protein that binds to DNA through a C-terminal helixturnhelix motif (Osuna et al., 1991). Because the DNA recognition helices of the Fis dimer are unusually close, a severe bend is induced in the DNA upon Fis binding (Pan et al., 1996). The bending of target DNA is thought to be important for the function of Fis. To our knowledge this is only the second report showing that Fis can act as a Class I transcription activator, the other example being at rrn P1 promoters (Aiyar et al., 2002). Class I activators bind to promoter DNA upstream of the -10 and -35 elements. The binding sites are located on the same face of the helix as RNA polymerase. Thus, Class I regulators may be located at, or close to -61, -71, -82 bp, etc., relative to the transcript start (Busby & Ebright, 1994). At the ndh promoter the major Fis effect is mediated from a site 72 bp upstream of the transcript start. At the rrnB promoter Fis stimulates transcription from a site centred at -71·5 (Aiyar et al., 2002). Specific protein : protein contacts are established between the C-terminal domain of the α-subunit of RNA polymerase and a small surface-exposed patch of Fis consisting of residues Q68, R71, G72 and Q74 (Aiyar et al., 2002). These interactions involve only one of the α-C-terminal domains and the downstream subunit of the Fis dimer (Aiyar et al., 2002). The location of the Fis II-binding site, and the observation that introduction of an RNA polymerase α-subunit lacking the C-terminal domain abolishes Fis-mediated activation, suggests that stimulation of ndh expression by Fis is mediated by identical protein : protein contacts to those established at the rrn promoters.
Investigation of the roles of the Fis I and Fis III sites revealed that the Fis I site has a small positive effect on ndh expression, whereas Fis III site had a small negative effect. Therefore, we are now able to suggest the effects of Fis acting at each of the three binding sites within the ndh promoter. Thus, the question marks in Fig. 1 can be replaced to indicate positive regulation from Fis sites I and II and negative regulation from site III.
Expression of nuoA-N, encoding the proton-translocating NADH dehydrogenase, is also positively regulated by Fis (Wackwitz et al., 1999). It has been suggested that this ensures high ATP yields at the outset of growth (Wackwitz et al., 1999). This suggestion is consistent with the presence of a low-affinity repressing Fis site (Fis III) at the ndh promoter, which should ensure that Ndh I is used in preference to Ndh II when intracellular Fis levels are highest. As growth proceeds into exponential phase, Fis levels begin to fall. This will release the brake applied to ndh expression by Fis bound at Fis III, allowing Fis-mediated activation of ndh, and also lower Fis-mediated activation of nuoA-N expression. Such a scheme would be consistent with the relative affinities of Fis (estimated from DNase I footprinting reactions) for the nuo promoter (Fis 1, ∼20 nM; Fis 2, ∼40 nM; Fis 3, ∼100 nM; Wackwitz et al., 1999), which are lower than those for the ndh promoter (Fis I, ∼0·1 nM; Fis II, ∼1 nM; Fis III, ∼10 nM; Green et al., 1996), and provides a possible explanation for the presence of Fis III in the ndh promoter.
Previous work used site-directed mutagenesis to show that both FNR sites within the ndh promoter are necessary for full anaerobic repression of ndh expression (Meng et al., 1997). The data obtained here from deletion analysis confirms that this is the case. Recent work to investigate regulation of yfiD gene expression, and studies with a series of model promoters with tandem FNR sites, suggested that appropriately spaced tandem FNR dimers act together to repress transcription (Marshall et al., 2001; Barnard et al., 2003). Thus, although an FNR dimer located at -50·5 would be expected to interfere with the docking of the α-subunit of RNA polymerase with DNA and thus partially occlude the ndh promoter, the binding of a second upstream FNR dimer would appear to enhance repression, perhaps by stabilizing the FNR : DNA complex, allowing it to effectively compete with the RNA polymerase α-C-terminal domains for this region of the promoter. An α-C-terminal domain that is not bound to either DNA or to a transcriptional activator is thought to inhibit transcription. Moreover, it has been shown here that Fis bound at the Fis II site is a positive regulator of ndh expression. Therefore, by occupying sites located immediately upstream and downstream of the Fis II site, FNR acts as a physical barrier, preventing the formation of the Fis : RNA polymerase contacts necessary for Fis-mediated transcription activation. Thus, it is likely that interactions between the tandem FNR dimers conspire to inhibit ndh transcription at several levels, i.e. by preventing interaction between the α-C-terminal domains of polymerase with DNA and with Fis. This promoter architecture must also prevent the formation of contacts between FNR and RNA polymerase that result in activation of transcription.
In conclusion, it is shown that ndh expression is driven from a Class I Fis-activated promoter and that Fis-mediated activation is inhibited under anaerobic conditions by FNR binding to two sites immediately flanking the region occupied by Fis. Activation of ndh transcription by Fis could account for the enhanced level of ndh expression during periods of rapid growth. This could be necessary to recycle NADH and achieve redox balance independently of energy generation during periods of rapid growth.
We thank Professor Steve Busby for many useful discussions and the BBSRC (UK) and the University of Sheffield for supporting this work.References
Barnard, A., Green, J. & Busby, S. J. W. (2003). Transcription regulation by tandem-bound FNR at Escherichia coli promoters. J Bacteriol 185, 59936004.
Bongaerts, J., Zoske, S., Weidner, U. & Unden, G. (1995). Transcriptional regulation of the proton translocating NADH dehydrogenase genes (nuoA-N) of Escherichia coli by electron acceptors, electron donors and gene regulators. Mol Microbiol 16, 521534.[CrossRef][Medline]
Busby, S. & Ebright, R. (1994). Promoter structure, promoter recognition and transcription activation in prokaryotes. Cell 79, 743746.[Medline]
Busby, S. & Ebright, R. (1999). Transcription activation by catabolite activator protein (CAP). J Mol Biol 293, 199213.[CrossRef][Medline]
Calhoun, M. W. & Gennis, R. B. (1993). Demonstration of separate genetic loci encoding distinct membrane bound respiratory NADH dehydrogenases in Escherichia coli. J Bacteriol 175, 30133019.
Calhoun, M. W., Oden, K. L., Gennis, R. B., Teixeira de Mattos, M. J. & Neijssel, O. M. (1993). Energetic efficiency of Escherichia coli: effects of mutations in components of the aerobic respiratory chain. J Bacteriol 175, 30203025.
Green, J. & Guest, J. R. (1994). Regulation of transcription at the ndh promoter of Escherichia coli by FNR and novel factors. Mol Microbiol 12, 433444.[Medline]
Green, J., Anjum, M. F. & Guest, J. R. (1996). The ndh binding protein (Nbp) regulates the ndh gene of Escherichia coli in response to growth phase and is identical to Fis. Mol Microbiol 20, 10431055.[Medline]
Green, J., Anjum, M. F. & Guest, J. R. (1997). Regulation of the ndh gene of Escherichia coli by integration host factor and a novel regulator, Arr. Microbiology 143, 28652875.
Hayashi, M., Miyoshi, T., Takashina, S. & Unemoto, T. (1989). Purification of NADH-ferricyanide dehydrogenase and NADH-quinone reductase from Escherichia coli membranes and their roles in the respiratory chain. Biochim Biophys Acta 977, 6269.[Medline]
Ishihama, A. (1999). Modulation of the nucleoid, the transcription apparatus, and the translational machinery in bacteria for stationary phase survival. Genes Cells 4, 135143.[Abstract]
Johnson, R. C., Ball, C. A., Pfeffer, D. & Simon, M. I. (1988). Isolation of the gene encoding the Hin recombinatorial enhancer protein. Proc Natl Acad Sci U S A 85, 34843488.
Lodge, J., Fear, J., Busby, S., Gunasekaran, P. & Kamini, N. R. (1992). Broad host range plasmids carrying the Escherichia coli lactose and galactose operons. FEMS Microbiol Lett 95, 271276.[CrossRef]
Marshall, F. A., Messenger, S. L., Wyborn, N. R., Guest, J. R., Wing, H., Busby, S. J. W. & Green, J. (2001). A novel promoter architecture for microaerobic activation by the anaerobic transcription factor FNR. Mol Microbiol 39, 747753.[CrossRef][Medline]
Matsushita, K., Ohnishi, T. & Kaback, H. R. (1987). NADH-ubiquinone oxidoreductases of the Escherichia coli aerobic respiratory chain. Biochemistry 26, 77327737.[CrossRef][Medline]
Meng, W., Green, J. & Guest, J. R. (1997). FNR-dependent repression of ndh gene expression requires two upstream FNR-biding sites. Microbiology 143, 15211532.
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Neijssel, O. M. & Teixeira de Mattos, M. J. (1994). The energetics of bacterial growth: a reassessment. Mol Microbiol 13, 179182.
Osuna, R., Finkel, S. E. & Johnson, R. C. (1991). Identification of two functional regions in Fis: the N terminus is required to promote Hin-mediated DNA inversion but not lambda excision. EMBO J 10, 15931603.[Medline]
Pan, C. Q., Finkel, S. E., Cramton, S. E., Feng, J. A., Sigman, D. S. & Johnson, R. C. (1996). Variable structures of Fis-DNA complexes determined by flanking DNA-protein contacts. J Mol Biol 264, 675695.[CrossRef][Medline]
Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a Laboratory Manual. 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sharrocks, A. D., Green, J. & Guest, J. R. (1991). FNR activates and represses transcription in vitro. Proc R Soc B 245, 219226.[Medline]
Spiro, S., Roberts, R. E. & Guest, J. R. (1989). FNR-dependent repression of the ndh gene of Escherichia coli and metal ion requirement for FNR regulated gene expression. Mol Microbiol 3, 601608.[CrossRef][Medline]
Taylor, D. E. & Brose, E. C. (1988). Modified BirnboimDoly method for rapid detection of plasmid copy number. Nucleic Acids Res 16, 9056.
Tran, Q. H., Bongaerts, J., Vlad, D. & Unden, G. (1997). Requirement for the proton-pumping NADH dehydrogenase I of Escherichia coli in respiration of NADH to fumarate and its bioenergetic implications. Eur J Biochem 244, 155160.[Medline]
Wackwitz, B., Bongaerts, J., Goodman, S. D. & Unden, G. (1999). Growth phase-dependent regulation of nuoA-N expression in Escherichia coli K-12 by the Fis protein: upstream binding sites and bioenergetic significance. Mol Gen Genet 262, 876883.[CrossRef][Medline]
Weidner, U., Nehls, U., Schneider, R. & 8 other authors (1992). Molecular genetic studies of complex I of Neurospora crassa, Aspergillus niger and Escherichia coli. Biochim Biophys Acta 1101, 177180.[Medline]
Young, I. G., Rogers, B. L., Campbell, H. D., Jaworowski, A. & Shaw, D. D. (1981). Nucleotide sequence for the respiratory NADH dehydrogenase of Escherichia coli. Eur J Biochem 116, 165170.[Medline]
Received 28 October 2003; revised 19 November 2003; accepted 19 November 2003.