Research Article

Two distinct types of rRNA operons in the Bacillus cereus group

Microbiology 2004; 150(3):601 · https://doi.org/10.1099/mic.0.26870-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

The Bacillus cereus group includes insecticidal bacteria (B. thuringiensis), food-borne pathogens (B. cereus and B. weihenstephanensis) and B. anthracis, the causative agent of anthrax. The precise number of rRNA operons in 12 strains of the B. cereus group was determined. Most of the tested strains possess 13 operons and the tested psychrotolerant strains contain 14 operons, the highest number ever found in bacteria. The separate clustering of the tested psychrotolerant strains was confirmed by partial sequencing of several genes distributed over the chromosomes. Analysis of regions downstream of the 23S rRNA genes in the type strain B. cereus ATCC 14579 indicates that the rRNA operons can be divided into two classes, I and II, consisting respectively of eight and five operons. Class II operons exhibit multiple tRNA genes downstream of the 5S rRNA gene and a putative promoter sequence in the 23S5S intergenic region, suggesting that 5S rRNA and the downstream tRNA genes can be transcribed independently of the 16S and 23S genes. Similar observations were made in the recently sequenced genome of B. anthracis strain Ames. The existence of these distinct types of rRNA operons suggests an unknown mechanism for regulation of rRNA and tRNA synthesis potentially related to the pool of amino acids available for protein synthesis.
Abbreviations: LR PCR, long-range polymerase chain reaction

The GenBank accession numbers for the sequences determined in this work are given in the text.

Bacillus cereus is a Gram-positive, spore-forming, soil bacterium widespread in the environment. Strains of this group can be isolated from soil (Helgason et al., 1998; Vilas-Boas et al., 2002), dead animal or insect bodies (Margulis et al., 1998), conserved food products (Lechner et al., 1998), infected humans (Helgason et al., 2000; Kotiranta et al., 2000) and industrial surfaces (Kotiranta et al., 1998; Ronner et al., 1990). The recognized species of the B. cereus group include Bacillus anthracis, Bacillus cereus, Bacillus mycoides, Bacillus thuringiensis and Bacillus weihenstephanensis. Some of these bacteria are of particular importance for human life. B. anthracis is the causative agent of anthrax (Read et al., 2003). B. thuringiensis is widely used against insects threatening crops or carrying diseases (Schnepf et al., 1998). Some B. cereus strains are used as animal probiotics (Jadamus et al., 2001, 2002; Mietke et al., 2000) or as plant symbionts (Stabb et al., 1994). Some strains of B. cereus and B. weihenstephanensis are opportunistic food-borne pathogens. B. weihenstephanensis is known to be psychrotolerant (growth at 8 °C or below) (Lechner et al., 1998). When ingested, pathogenic strains of B. cereus may cause diarrhoeic or emetic syndromes (Granum, 1994; Granum & Lund, 1997; Helgason et al., 2000; Kotiranta et al., 2000; Lechner et al., 1998; Stenfors et al., 2002).

In several previous studies, Southern hybridization and inverse PCR were used for ribotyping the B. cereus group strains (Johansen et al., 1996; Lechner et al., 1998; Patra et al., 2002; Priest et al., 1994). However, these works led only to approximate determination of the rRNA operon number (Patra et al., 2002). Recently the entire genomic sequence of the type strain B. cereus ATCC 14579 was established (Ivanova et al., 2003). In this study we determined the precise number of rRNA operons and compared them in several strains of the B. cereus group distinguished by different phenotypes such as specific insect pathogenicity for B. thuringiensis (Schnepf et al., 1998), psychrotolerance for B. weihenstephanensis (Lechner et al., 1998), or food-related pathogenicity for B. cereus 391-98 (Lund et al., 2000). Thirteen to fourteen rRNA operons were identified, the highest number ever detected in bacteria. To determine the relationships between these strains, we carried out parallel sequencing of several genes distributed over their chromosomes. The accurate analysis of rRNA operon sequences in the type strain revealed sequence variations, which suggest the existence of two distinct classes of rRNA operons. The eleven rRNA operons of the recently sequenced B. anthracis Ames (Ban Ames) (Read et al., 2003) exhibit a similar polymorphism, suggesting that the presence of two distinct classes of rRNA operons is a general feature through the B. cereus group.

Strains and growth conditions.
The strains of the B. cereus group used in this study are listed in Table 1. Bacteria were grown in Luria Broth medium (Sambrook et al., 1989) at 30 °C with agitation at 250 r.p.m. For preparation of DNA the cultures were grown overnight, diluted 1 : 20 and grown to an OD600 of 3.


Table 1. Bacterial strains used in this study


DNA extraction, restriction enzyme digestion and DNA blotting.
Cell walls were hydrolysed by lysozyme (3 mg ml-1) for 30 min at 37 °C. The cells were then lysed by adding SDS to 0·5 % final concentration. Proteins were degraded by proteinase K treatment (0·3 mg ml-1 final concentration) for 2 h at 50 °C, followed by two water-saturated phenol (pH 8·0) extractions at 30 °C (overnight and for 2 h). DNA was precipitated by adding potassium acetate (pH 4·8) up to 0·3 M and 2 vols absolute ethanol. Restriction enzyme digestions were carried out for 2 h according to the manufacturers' instructions, at 37 °C (ClaI and HindIII) or 55 °C (BclI and EcoRV). Electrophoresis was performed in Tris/borate buffer in 0·8 % agarose gel, overnight at 25 mA. The agarose gels were then treated in 0·25 M HCl, 0·5 M NaOH, and vacuum blotted onto Hybond-XL membrane (Amersham).

PCR amplification.
PCR using the Expand Long Template PCR System (Roche Diagnostics) was used to obtain templates for sequencing and for preparing DNA hybridization probes. The cycling program was: 94 °C for 5 min; 12 cycles of 94 °C for 10 s and 68 °C for 12 min; 24 cycles of 94 °C for 10 s and 68 °C starting from 12 min and increasing this time by 15 s each cycle. The final extension was done at 72 °C for 10 min.

Sequencing procedures.
PCR products were treated for 1 h at 37 °C with exonuclease I and shrimp alkaline phosphatase (USB). Sequencing reactions were performed using an ABI PRISM sequencing kit (Applied Biosystems). Products of reactions were ethanol precipitated and analysed with an ABI 3700 sequencer (Applied Biosystems).

Separate amplification of each operon was performed using oligonucleotides listed in Table 2. Sequencing was done on each amplification product separately using a set of 32 oligonucleotides with sequences common to all operons (oligonucleotide sequences can be provided on request). PCR amplification and sequencing of the regions between closely located 5S and 16S rRNA genes of operons rrnC and rrnD respectively were done using the following oligonucleotides: FIAH7 (5'GCCAGCTTATTCAACTAGCACTTG3'), FIAH8 (5'GTTTCCCGGAGTTATCCCAGTCTTA3'), FIBH7 (5'GATCCCTGAAAGATGATCAGGTTG3') and FIBH8 (5'GTTCCCATACCGAACACGGAAGTT3'). Assembly was performed manually using Staden's XBAP version 14.0 software (Dear & Staden, 1991) and consensus sequences of 16S, 23S and 5S rRNA genes as scaffold. The 13 rRNA operon sequences were deposited at NCBI under accession numbers AY224379AY224388.


Table 2. Oligonucleotides used for LR PCR amplification and separate sequencing of each rRNA operon in B. cereus BGSC 6A5


Preparation of 16S rDNA probe and detection of ribotypes.
A 1·4 kb region of 16S rRNA gene was amplified by PCR using total DNA from Bce 6A5 and oligonucleotides corresponding to the 16S rRNA genes: FIBG1 (5'GCAAGTCGAGCGAATGGATTAAGAG3') and FIAH4 (5'TACGGCTACCTTGTTACGACTTCAC3'). PCR product was purified using the QIAquick PCR Purification Kit (QIAgen) and 60 ng of it was labelled using the NEBlot Kit (New England Biolabs) and 50 µCi [α-32P]dCTP (3000 Ci mmol-1; 110 TBq mmol-1). Hybridization of the probe to DNA blotted on membrane was done overnight at 65 °C using the Rapid-hyb buffer (Amersham). Hybridized bands were detected using a STORM Scanner (Molecular Dynamics) and quantified using ImageQuant 5.2 software (Molecular Dynamics).

Determination of the number of rRNA operons.
Total DNA of each strain was digested with BclI, ClaI or HindIII. An internal fragment of the 16S rRNA gene was used as the probe and the enzymes used had no recognition sites within the 16S rRNA gene but had one or more sites within the 23S rRNA gene. In these conditions, each ribosomal operon was expected to produce only one DNA fragment able to hybridize to the probe. Intensity of each hybridization band was measured using the STORM scanner. After background subtraction, an iterative process was applied to determine the number of rRNA operons corresponding to each hybridized DNA band, assuming that each operon contributed equally to the signal intensity. In iteration the signal corresponding to one rRNA operon was estimated by dividing the intensity of each hybridization band by the postulated number of rRNA operons to which the band corresponded. The relative error of the signals of one rRNA operon, measured by using the different hybridized bands, was then calculated by the formula

where d is the relative error, xi is the signal corresponding to one rRNA operon estimated for the ith of total k hybridization bands and is the mean signal corresponding to one operon. The hypothesized number of rRNA operons leading to the minimal relative error was assumed to correspond to the real number of operons. Moreover, the linear regression coefficient R2, based on the classical Pearson correlation function, was calculated to verify the linear proportionality of the hybridization signal with the number of rRNA operons for each hybridization band. The closer this coefficient is to 1 the more likely it is that the assumption about the number of operons is correct. Independent determination of the number of rRNA operons was performed for each of the digestion enzymes used and for two amounts of genomic DNA for each enzyme (see Fig. 1B).



(24K):

Fig. 1. Determination of the number of rRNA operons in B. cereus BGSC 6A5. (A) Representative result of hybridization of 16S rRNA gene specific probe with total DNA digested by BclI (lane 1), ClaI (lane 2) and HindIII (lane 3). Size markers in bp are shown on the left. This experiment was carried out twice with different amounts of genomic DNA for each enzyme. (B) Mean relative statistical error (first column for each enzyme) and mean linear regression coefficients (second column for each enzyme) corresponding to the two distinct amounts of genomic DNA used, calculated for the different hypotheses of the rRNA operon number (shown in bold on the left). The smallest value of statistical error and the highest of linear regression coefficient were considered as corresponding to the correct number of operons. (C) PCR amplification of inter 5S16S areas for closely located rRNA operons. Oligonucleotides used: FIBH7 and FIAH8 (lane 1), FIBH7 and FIAH7 (lane 2), FIBH8 and FIAH8 (lane 3), FIBH8 and FIAH7 (lane 4). The shortest DNA fragments, between 1·1 and 1·5 kb, were assumed to correspond to the newly detected inter-operon region, whereas the upper bands (between 2·3 and 2·7 kb) corresponded to the areas between rrnG and rrnH and between rrnI and rrnJ. Size markers in bp are shown on the left.

Phylogenetic analysis of ribotype patterns.
Hybridization profiles for each strain were divided into 10 sections and the number of rRNA operons, scored as described above, was assigned to each section. To calculate distances between strains we applied the method developed for multilocus enzyme electrophoresis data analyses (Selander et al., 1986), considering each section of the hybridization profiles as a locus' and the number of bands in this section as the allele. This enabled us to take into account the allele frequencies and the genetic diversity. The dendrogram corresponding to the resulting distance matrix was calculated with STATISTICA 5.0 software using the UPGMA method.

Genetic relationships.
To investigate the genetic relationships of the different strains, seven genes distributed over the 5·4 Mb chromosome of the entirely sequenced type strain Bce 6A5 (Ivanova et al., 2003) were partially sequenced in all strains. These were: clpC (position on the chromosome 90 kb) encoding the ClpC regulator; purF (300 kb), encoding glutamine phosphoribosylpyrophosphate amidotransferase; gdpD (574 kb), encoding glycerophosphoryl diester phosphodiesterase; yhfL (1068 kb), encoding long-chain fatty acid CoA ligase; panC (1484 kb), encoding pantoateβ-alanine ligase; dinB (4103 kb), encoding DNA polymerase IV; plcR (5255 kb), encoding transcriptional regulator PlcR. The corresponding oligonucleotides used for PCR amplification and sequencing were: 5'GTACGCGAAGGTGAAGGAATTGC3' and 5'ATGCATCGATTGCACCTTCTGCTC3' for clpC (the nucleotide sequences used for phylogenetic analyses correspond to positions 151650 from the first primer); 5'CGAAGAATGTGGCGTTTTCGGAA3' and 5'GAAATACTAGAGTCTGGTACACCAG3' for purF (positions 101700); 5'GGTGGTTATGCAAATGCGACAAATG3' and 5'CGCCATAATATAAAATGGCGTCACG3' for gdpD (positions 101600); 5'GCGAAACCTCATCAGATTTTAACC3' and 5'CAGGTACTTCTTCCCCAAGTTCAT3' for yhfL (positions 101600); 5'CGATATCCTCGTGATATTGATAGAG3' and 5'TCCGCATAATCTACAGTGCCTTTC3' for panC (positions 101450); 5'GAGGCGAGAGAATACGGAATACG3' and 5'GCCCATTTGACTCGGATCCACT3' for dinB (positions 101500); and 5'CCCAAGTATGGATATATTGCAAGG3' and 5'CCAATTAATGCCATACTATTAATTCGGC3' for plcR (positions 101500). The resulting sequences were deposited at NCBI under GenBank accession numbers AY224696AY224779. Corresponding sequences of the B. anthracis strain Ames were also used in this study (accession no. AE016879) (Read et al., 2003). The same source was used for Ban Ames rRNA operon analysis. Five other genes were also tested, but they were eliminated since we did not succeed in amplifying and sequencing them in all strains. The nucleotide sequences from each strain were compared by the neighbour-joining method using the multiple alignment program CLUSTALX 1.8 (Thompson et al., 1997) and the phylogenetic trees calculated using 1000 bootstrap trials were visualized by the NJplot software (Perriere & Gouy, 1996).

Number of rRNA operons and ribotyping of different strains of the B. cereus group
As reported, the type strain B. cereus ATCC 14579 possesses 13 rRNA operons (Ivanova et al., 2003). Shotgun sequencing of the genome of B. cereus ATCC 14579 with a sixfold coverage allowed us to detect twelve 5' ends of 16S rRNA genes and eight 5S rRNA genes. Subsequent LR PCR experiments enabled us to localize these 12 rRNA operons. Southern hybridization experiments were carried out to verify this number of rRNA operons. The results obtained with total DNA isolated from strain Bce 6A5 (B.cereus BGSC 6A5, the same as ATCC 14579) and digested with BclI, ClaI or HindIII are shown in Fig. 1(A). In the conditions used, each ribosomal operon was expected to produce only one DNA fragment able to hybridize to the probe. The signal intensity was measured to determine the number of DNA fragments in each band, and hence the number of rRNA operons in the chromosome (see Methods for details). For all three restriction enzymes used, the minimal statistical error was obtained if the number of rRNA operons in the chromosome was assumed to be 13, and linear regression coefficient values led to the same conclusion (Fig. 1B). This result indicates that the determination by random sequencing and LR PCR mapping missed one rRNA operon. We mapped this operon using a genomic DNA digestion by EcoRV, which does not cut 16S or 23S rRNA genes (not shown). The additional operon was located close to the operon rrnC. The unique sequence between these two operons was determined by PCR amplifications using oligonucleotides specific to 5S and 16S rRNA genes and subsequent sequencing (Fig. 1C). Finally, we succeeded in precisely locating all 13 rrn operons on the chromosome of Bce 6A5 by LR PCR (the primers used are listed in Table 2).

The quantitative Southern hybridization approach used for strain Bce 6A5 was applied to 11 other strains from the B. cereus group. The selected strains represent the diversity of this group. According to previous studies, strains Bce 6A5, Bce 6A1 and B. thuringiensis subsp. canadensis (Btc) HD224 are closely related (Carlson et al., 1994), B. thuringiensis subsp. israelensis (Bti) and B. thuringiensis subsp. kurstaki (Btk) strains represent the most important insecticidal groups (Hofte & Whiteley, 1989), B. weihenstephanensis (Bwe) strains represent a large cluster of psychrotolerant strains (Lechner et al., 1998) and strain Bce 391-98 was characterized as having a high pathogenic potential (Lund et al., 2000). As in the case of strain Bce 6A5, three enzymes, BclI, ClaI and HindIII, were used. Representative ribotype profiles of these strains, using digestion by HindIII, and the deduced number of rRNA operons are shown in Fig. 2(A, B). Most of the studied strains appeared to possess 13 rRNA operons, like the type strain Bce 6A5; 14 rRNA operons were detected for the other strains. If a correct number was used for calculation, the relative statistical error was 34 %. This error increased up to 920 % if the number used for calculation differed by 1 (Fig. 1B). In all cases, the minimal value of the statistical error correlated with the highest linear regression coefficient. This asserted that the intensity of hybridization signal varies linearly with the number of hybridized fragments, and hence with the number of rRNA operons. Thus, this approach provides an unambiguous estimation of the repeat number of a sequence in a genome even when it is as high as 14.



(35K):

Fig. 2. Determination of the number of rRNA operons in different strains. (A) Representative result of hybridization of 16S rRNA specific probe with total DNA of different strains digested by HindIII. This experiment was carried out twice with different amounts of genomic DNA for enzymes BclI, ClaI and HindIII. Size markers are shown on the left. (B) Relative statistical error and linear regression coefficient calculated for the best hypotheses of the rRNA operon numbers. Strain numbers correspond to the lanes in (A). (C) Phylogenetic relationships between different strains derived from the riboprofile data (see text for the details). Distance scale is shown at the top.

All the Bwe psychrotolerant strains appeared to have a slightly higher number of rRNA operons (14 instead of 13). All other strains used in this study were unable to grow at low temperatures (8 °C) (not shown). Btc HD224, which is close to Bce 6A1 and Bce 6A5 (Carlson et al., 1996), also exhibited 14 rRNA operons. On the other hand, Bce 6A5 and Bce 6A1 gave riboprofiles very similar to that of Btc HD224, but had only 13 operons. These results indicate that the number of rRNA operons does not necessarily reflect species divergence and cannot be used as a reliable phylogenetic feature for the B. cereus group. However, the two independently isolated Bti strains which were characterized as very clonal in previous studies (Ankarloo et al., 2000; Priest et al., 1994) exhibited riboprofiles that were essentially indistinguishable. To obtain a better view of strain diversity, we constructed a phylogenetic tree based on the riboprofiles obtained by HindIII digestion. This digestion was chosen because it generated the highest number of fragments and hence provided the highest resolution (Fig. 2C). The tree showed apparent divergence of the five psychrotolerant strains from the type strain Bce 6A5 and its close relatives. It also indicated the isolation of the Bti strains. The pathogenic strain Bce 391-98 appeared to be isolated from all other strains.

Genetic relationships between strains of the B. cereus group
To verify the relationships between strains presented above, we sequenced seven genes distributed over the chromosome of Bce 6A5 in the 12 studied strains. We also added the corresponding sequences of B. anthracis strain Ames (Ban Ames) (Read et al., 2003) to get a wider view of the B. cereus group. Trees were constructed using the nucleotide sequences obtained for all genes. Examples of representative dendrograms are given in Fig. 3 (gdpD, panC and plcR genes). The resulting trees were almost fully congruent, for all the genes tested, except plcR, and they confirmed the separate clustering of the five Bwe psychrotolerant strains from the type strain Bce 6A5 and its relatives. For all tested genes, no difference was found between the two Bti strains, confirming their high clonality as mentioned above. In most cases, the two pathogenic strains Bce 391-98 and Ban Ames appeared to be relatively isolated but slightly closer to the psychrotolerant strains than to others. The genes dinB (not shown), panC and plcR of strain Bce 391-98 appeared to be very close to those of strain Bwe 10204 (less than 2 bp differences in 500 bp sequenced: Fig. 3B, C), suggesting that those strains belong to the same group. However, the difference was greater for the gdpD gene (Fig. 3A) and strain Bce 391-98 lacked the ability to grow at 8 °C. In comparison, the Ban Ames strain appeared to be much more isolated. On the whole, the trees based on parallel sequencing and on the riboprofiles exhibited similar topologies.



(24K):

Fig. 3. Phylogenetic trees constructed from the partial nucleotide sequences of different genes (gdpD, panC and plcR). Bootstrap values calculated for 1000 trials are indicated for each node. Bars in the top corners indicate the scale of divergence for each gene.

The tree constructed for the pathogenicity-related regulator gene plcR was very particular. It is worth noting that in contrast to all other sequenced genes, the plcR alleles for the four B. thuringiensis strains clustered together, and were separated from strains Bce 6A1 and 6A5. In particular, although Btc HD224 was very close to Bce 6A5 and 6A1 for the other genes and for ribotyping (Figs 2C and 3), its plcR gene was 8 % divergent from that of Bce 6A5 and very similar to those of the other insect pathogens. On the other hand, three of the psychrotolerant strains, isolated from milk powder (Pruss et al., 1999), have exactly the same plcR allele as the human pathogen Bce 391-98, also originating from food products (Lund et al., 2000) (Fig. 3C). The PlcR regulator was shown to be related to the virulence of the B. cereus group (Agaisse et al., 1999; Okstad et al., 1999; Salamitou et al., 2000). It would be interesting to investigate if there is a functional link between plcR allele and pathogenic specificity.

Comparison of the rRNA operons in Bce 6A5
Bce 6A5 appeared to possess 13 rRNA operons. As expected, all are located close to the replication origin. Physical separation of these 13 rRNA operons, amplified using LR PCR, allowed us to sequence them separately by primer walking and to study their variability in the conserved 16S, 23S and 5S regions and in the less conserved regions flanking these genes.

Sequences of the 16S, 23S and 5S genes were different in few single base positions (Fig. 4). We detected seven, seven and two alleles for the 16S, 23S and 5S rRNA genes, respectively. Seven copies of the 16S rRNA gene (A, E, G, H, I, J and M) exactly corresponded to the consensus sequence determined previously (Ticknor et al., 2001). None of the other alleles reported in this paper for different strains were detected during the present study. The 16S gene alleles corresponding to the rRNA operons B, D, F, K and L were all unique and contained one nucleotide difference compared to the consensus. The 16S gene in the rrnC operon contained two differences.



(33K):

Fig. 4. Polymorphic sites in the 16S, 23S and 5S rRNA genes of Bce 6A5 and Ban Ames. Only positions with differences are shown. Asterisks indicate the bases identical to the consensus. Positions of the nucleotide sites are indicated vertically above the sequences. Numbering starts from the 5' end of the corresponding rRNA gene: 5'TTATTGGA... for 16S, 5'TTTGGTTAA... for 23S and 5'T(T/C)TGGT(G/A)A... for 5S. The strains are indicated on the left, and the different rRNA operons are indicated on the right.

In a previous study, the existence of a psychrotolerant signature (5'AACATTTTGAACCGCATGGTTC3') within the 16S rRNA genes of psychrotolerant strains was proposed for the rapid identification of such strains (Pruss et al., 1999). No 16S gene containing this sequence was detected in the Bce 6A5 strain. This result is consistent with the observation that this strain does not grow at low temperature. Mesophilic strains have three different bases in the above sequence, indicating that the psychrotolerant signature may have been acquired by recombination. The availability of the precise map of rRNA operons would make it possible to study the exact locations of such psychrotolerant 16S genes in the genomes of the B. cereus strains.

The intergenic 16S23S area, differing considerably between strains, has often been used to classify strains (Bourque et al., 1995; Daffonchio et al., 1998, 2000; Harrell et al., 1995). Our consensus sequence for this region corresponds exactly to the sequence reported earlier for the strain Bce 6A5 (Bourque et al., 1995; Harrell et al., 1995) (not shown). The alleles presented by operons A, B, C and D are different. We detected an insertion of tRNA-Ile and tRNA-Ala genes in operons A and B. This feature explains the existence of homoduplex and heteroduplex polymorphisms in this region, which have been used for classifying the strains (Daffonchio et al., 2000). Separate amplification of different operons by LR PCR, using the oligonucleotides reported here (Table 2), and subsequent sequencing of the intergenic 16S23S and 23S5S areas, can be suggested as a more precise approach for characterizing and classifying strains.

The consensus sequences of 23S and 5S genes have not been reported yet. From our data they are the same as the alleles corresponding to operons rrnD, G, H, I and J. Concerning the 23S gene, it is remarkable that the operon rrnB contains multiple single-nucleotide differences clustered in two regions, 310335 and 24282485. This might indicate that this allele originated from two recombinational events. Alleles of operons rrnC, E and L have several differences clustered close to position 1560, suggesting their common recombinational origin. Presence of identical 5S alleles that differ from the consensus in these three operons is consistent with this hypothesis. However, the same 5S allele was also found in operons rrnK and M, having the 23S alleles closer to the consensus. It is therefore probable that independent recombination events took place in the 23S and 5S genes. Concerning the 5S genes, only two alleles were detected, differing at four nucleotide sites, indicating that they probably diverged due to a recombination event.

Two distinct types of rRNA operons in Bce 6A5 and Ban Ames
An important difference in the overall organization of rRNA operons in Bce 6A5 is the presence of multiple tRNA genes downstream of operons rrnC, E, K, L and M (Fig. 5A). Operons K, L and M have respectively 15, 20 and 22 tRNA genes downstream, with a partially similar order of codon specificity. The closely related operons C and E both have nine tRNA genes downstream, although the codon specificities are different. All the five operons having multiple tRNA genes downstream also differ from the others by their 5S rRNA allele (Fig. 4) and 23S5S region (Fig. 5B). These observations suggest the existence of two distinct types of rRNA operons in Bce 6A5. A phylogenetic tree constructed using the sequences of the 23S5S region presented in Fig. 5(B) confirms the existence of two types of rRNA operons (Fig. 6). The 13 rRNA operons in Bce 6A5 could therefore be divided into two classes. The first (class I) includes operons rrnA, B, D, F, G, H, I and J, all devoid of multiple tRNA genes downstream, and the second (class II) includes operons rrnC, E, K, L and M, all having many (75 in total) tRNA genes downstream (Fig. 5A), and distinct 5S gene (Fig. 4) and 23S5S intergenic region (Figs 5B and 6). It is worth noting that the 23S5S intergenic region of all class II operons contains sequences (TTGACT as -35 box and TA(C,A or T)AAT as -10 box) which are very similar to the Gram-positive and Gram-negative bacteria σA promoter consensus sequence (TTGACA as -35 box and TATAAT as -10 box). Moreover, class II rRNA operons do not have any obvious transcription terminator structure downstream of the 5S gene (Fig. 5B). Thus, the 5S rRNA gene and the downstream tRNA genes might be transcribed independently from the 16S and 23S genes. In contrast, all class I operons, except rrnF, contain a clearly identifiable stemloop sequence downstream of the 5S gene, which should act as a transcription terminator (Fig. 5B). The operon rrnF appears to be intermediate between the two classes. This operon has two tRNA genes downstream of the 5S rRNA gene and 12 tRNA genes upstream of the 16S gene. Its 5S allele is identical to those of class I rRNA operons and no promoter or terminator close to the 5S rRNA gene was detected for this operon. We assigned rrnF to class I, although it may have a particular significance compared to the two classes.



(95K):

Fig. 5. Divergence in the organization of the rRNA operons in Bce 6A5 and Ban Ames. (A) Genome organization near the rrn operons in Bce 6A5. Black arrows correspond to rRNA genes and grey arrows correspond to tRNA genes. Operon designations are shown above the 16S genes. Downstream of Bc_rrnC (9 tRNA): Val-Thr-Lys-Leu-Gly-Leu-Arg-Pro-Ala; Bc_rrnE (9 tRNA): Asn-Thr-Glu-Val-Tyr-Gln-Lys-Gly-Ala; upstream of Bc_rrnF (12 tRNA): Asn-Ser-Glu-Val-Met-Asp-Gln-Lys-Leu-Arg-Pro-Gly; downstream of Bc_rrnF (2 tRNA): Met-Asp; downstream of Bc_rrnK (15 tRNA): Asn-Ser-Glu-Val-Met-Asp-Phe-Thr-Tyr-Trp-His-Gln-Gly-Cys-Leu; Bc_rrnL (20 tRNA): Val-Tyr-Gln-Lys-Leu-Gly-Leu-Arg-Pro-Ala-Ser-Ser-Met-Asp-Phe-Thr-Trp-Ile-Asn-Glu and Bc_rrnM (22 tRNA): Val-Thr-His-Leu-Gly-Leu-Arg-Pro-Ala-Met-Met-Ser-Met-Asp-Phe-Thr-Lys-Gly-Ile-Asn-Ser-Glu. (B) Sequences of the 23S5S intergenic region in Bce 6A5. Partial 23S and 5S rRNA sequences are shown in italic. Putative transcription promoters in the 23S5S rRNA intergenic regions of operons Bc_rrnC, E, K, L and M are shown in bold and underlined. Putative transcription terminators downstream of the 5S rRNA genes of operons Bc_rrnA, B, D, G, H, I and J are shown in bold. (C) Genome organization near the rrn operons in Ban Ames. The same tRNA genes were found at the same position and in the same order in Ban Ames as in Bce 6A5, except upstream of Ba_rrnE, where the tRNA-Met is missing, and downstream of Ba_rrnJ, where tRNA-Tyr is missing. (D) Sequences of the 23S5S intergenic region in Ban Ames. rRNA-coding sequences, putative promoter and transcription terminators are shown as for Bce 6A5.


(16K):

Fig. 6. Two classes of rRNA operons in Bce 6A5. A phylogenetic tree was constructed using the sequences corresponding to the 23S5S rRNA region presented in Fig. 5(B) in the different rrn operons of Bce 6A5. Bootstrap values calculated for 1000 trials are indicated for each node. The bar in the top left corner indicates the scale of divergence.

We observed a similar feature for the 11 rRNA operons of the recently sequenced B. anthracis Ames (Ban Ames) (Read et al., 2003). As for Bce 6A5, rRNA-coding genes of Ban Ames were divergent in few positions. Similarly, eight, eight and three alleles were detected for 16S, 23S and 5S respectively (Fig. 4). The 16S consensus sequence is exactly the same as reported previously for strains Ban Sterne and Vollum (Ticknor et al., 2001), in accordance with the known clonality of Ban strains. The 16S sequence of Ban strains diverges at position 1015 from that of Bce 6A5 (shown in bold in Fig. 4). The 23S consensus sequence obtained for Ban Ames is also different at two positions (1562 and 2156). The 5S consensus sequence is exactly the same for the two strains. As for Bce 6A5, the presence of a 5S allele diverging from the consensus in operons rrnD, I, J and K of Ban Ames correlates with the presence of multiple tRNA genes downstream of these rrn operons (Fig. 5C) and a 23S5S intergenic region distinct from the consensus (Fig. 5D). Although Ban Ames possesses only 11 rRNA operons, we can establish a correspondence between its operons (Ba_rrn operons) and those of Bce 6A5 (Bc_rrn operons) according to their sequences, the presence of multiple tRNA genes downstream and their positions in the genomes. On this basis, operons Ba_rrnA, B, C, F, G and H correspond to Bc_rrnA, B, D, H, I and J respectively (class I), operons Ba_rrnD, I, J and K correspond to Bc_rrnE, K, L and M respectively (class II) and operon Ba_rrnE corresponds to Bc_rrnF (intermediate considered as belonging to class I). Only operons Bc_rrnC and G of Bce 6A5 did not have counterparts in Ban Ames. These observations suggest that the existence of two distinct types of rRNA operons is a general feature through the B. cereus group.

Evidence for the diversity of rRNA sequences in a single organism has been recently accumulating. Some authors have already evoked the existence of distinct types of rRNA operons based on the heterogeneity of the small-subunit rRNA genes in different domains of life, indicating the wide occurrence of this phenomenon (Carranza et al., 1996; Liefting et al., 1996; Maden et al., 1987; Mylvaganam & Dennis, 1992; Reischl et al., 1998; Yap et al., 1999). Concerning the B. cereus group, a potential psychrotolerant signature has already been found in the 16S sequence (Pruss et al., 1999). Recently the existence of different types of rRNA operons based on the whole organization and sequence of the operons was reported in Escherichia coli (Ohnishi et al., 2000) and Clostridium perfringens (Shimizu et al., 2001). However, none of these studies revealed divergence as significant as the presence of a potential alternative promoter within the 23S5S intergenic region. The putative promoter highlighted in this study within this region in Bce 6A5 as well as in Ban Ames may enable the expression of tRNA genes independently of the global regulation of expression of the whole rRNA operon. The expression of tRNA genes could thus be regulated according to the amount of amino acids available for protein synthesis. Such a mechanism would be useful for B. cereus and B. anthracis for adaptation to the environment and the colonization of new environmental niches.

We thank Drs D. Zeigler, D. Lereclus, A. Lapidus and S. Scherer for kindly providing bacterial strains. Technical help of N. Galleron, B. Quinquis, J.-M. Batto and A. Bolotin (Génétique Microbienne, CRJ INRA) in sequencing and computer programming is highly appreciated.

References

Agaisse, H., Gominet, M., Okstad, O. A., Kolsto, A. B. & Lereclus, D. (1999). PlcR is a pleiotropic regulator of extracellular virulence factor gene expression in Bacillus thuringiensis. Mol Microbiol 32, 10431053.[CrossRef][Medline]

Ankarloo, J., Caugant, D. A., Hansen, B. M., Berg, A., Kolsto, A. B. & Lovgren, A. (2000). Genome stability of Bacillus thuringiensis subsp. israelensis isolates. Curr Microbiol 40, 5156.[CrossRef][Medline]

Boschwitz, H., Gofshtein-Gandman, L., Halvorson, H. O., Keynan, A. & Milner, Y. (1991). The possible involvement of trypsin-like enzymes in germination of spores of Bacillus cereus T and Bacillus subtilis 168. J Gen Microbiol 137, 11451153.[Abstract/Free Full Text]

Bourque, S. N., Valero, J. R., Lavoie, M. C. & Levesque, R. C. (1995). Comparative analysis of the 16S to 23S ribosomal intergenic spacer sequences of Bacillus thuringiensis strains and subspecies and of closely related species. Appl Environ Microbiol 61, 16231626.[Abstract/Free Full Text]

Carlson, C. R., Caugant, D. A. & Kolsto, A. B. (1994). Genotypic diversity among Bacillus cereus and Bacillus thuringiensis strains. Appl Environ Microbiol 60, 17191725.[Abstract/Free Full Text]

Carlson, C. R., Johansen, T. & Kolsto, A. B. (1996). The chromosome map of Bacillus thuringiensis subsp. canadensis HD224 is highly similar to that of the Bacillus cereus type strain ATCC 14579. FEMS Microbiol Lett 141, 163167.[CrossRef][Medline]

Carranza, S., Giribet, G., Ribera, C., Baguna & Riutort, M. (1996). Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida). Mol Biol Evol 13, 824832.[Abstract]

Clark, B. D. (1987). Thesis, Ohio State University.

Daffonchio, D., Borin, S., Frova, G., Manachini, P. L. & Sorlini, C. (1998). PCR fingerprinting of whole genomes: the spacers between the 16S and 23S rRNA genes and of intergenic tRNA gene regions reveal a different intraspecific genomic variability of Bacillus cereus and Bacillus licheniformis [corrected]. Int J Syst Bacteriol 48, 107116.[Abstract/Free Full Text]

Daffonchio, D., Cherif, A. & Borin, S. (2000). Homoduplex and heteroduplex polymorphisms of the amplified ribosomal 16S-23S internal transcribed spacers describe genetic relationships in the "Bacillus cereus group". Appl Environ Microbiol 66, 54605468.[Abstract/Free Full Text]

de Barjac, H. & Bonnefoi, A. (1972). Attempted biochemical classification of 64 Bacillus strains of groups 2 and 3 representing 11 different species. Ann Inst Pasteur 122, 463473.[Medline]

Dear, S. & Staden, R. (1991). A sequence assembly and editing program for efficient management of large projects. Nucleic Acids Res 19, 39073911.[Abstract/Free Full Text]

Dulmage, H. T. (1970). Production of the spore-delta-endotoxin complex by variants of Bacillus thuringiensis in two fermentation media. J Invertebr Pathol 16, 385389.[CrossRef][Medline]

Frankland, G. C. & Frankland, P. F. (1887). Studies on some new micro-organisms from air. Philos Trans R Soc Lond B Biol Sci 173, 257287.

Granum, P. E. (1994). Bacillus cereus and its toxins. Soc Appl Bacteriol Symp Ser 23, 61S66S.[Medline]

Granum, P. E. & Lund, T. (1997). Bacillus cereus and its food poisoning toxins. FEMS Microbiol Lett 157, 223228.[CrossRef][Medline]

Harrell, L. J., Andersen, G. L. & Wilson, K. H. (1995). Genetic variability of Bacillus anthracis and related species. J Clin Microbiol 33, 18471850.[Abstract/Free Full Text]

Helgason, E., Caugant, D. A., Lecadet, M. M., Chen, Y., Mahillon, J., Lovgren, A., Hegna, I., Kvaloy, K. & Kolsto, A. B. (1998). Genetic diversity of Bacillus cereus/B. thuringiensis isolates from natural sources. Curr Microbiol 37, 8087.[CrossRef][Medline]

Helgason, E., Caugant, D. A., Olsen, I. & Kolsto, A. B. (2000). Genetic structure of population of Bacillus cereus and B. thuringiensis isolates associated with periodontitis and other human infections. J Clin Microbiol 38, 16151622.[Abstract/Free Full Text]

Hofte, H. & Whiteley, H. R. (1989). Insecticidal crystal proteins of Bacillus thuringiensis. Microbiol Rev 53, 242255.[Abstract/Free Full Text]

Ivanova, N., Sorokin, A., Anderson, I. & 20 other authors (2003). Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423, 8791.[CrossRef][Medline]

Jadamus, A., Vahjen, W. & Simon, O. (2001). Growth behaviour of a spore forming probiotic strain in the gastrointestinal tract of broiler chicken and piglets. Arch Tierernahr 54, 117.[Medline]

Jadamus, A., Vahjen, W., Schafer, K. & Simon, O. (2002). Influence of the probiotic strain Bacillus cereus var. toyoi on the development of enterobacterial growth and on selected parameters of bacterial metabolism in digesta samples of piglets. J Anim Physiol Anim Nutr 86, 4254.[Medline]

Johansen, T., Carlson, C. R. & Kolsto, A. B. (1996). Variable numbers of rRNA gene operons in Bacillus cereus strains. FEMS Microbiol Lett 136, 325328.[Medline]

Kotiranta, A., Haapasalo, M., Kari, K., Kerosuo, E., Olsen, I., Sorsa, T., Meurman, J. H. & Lounatmaa, K. (1998). Surface structure, hydrophobicity, phagocytosis, and adherence to matrix proteins of Bacillus cereus cells with and without the crystalline surface protein layer. Infect Immun 66, 48954902.[Abstract/Free Full Text]

Kotiranta, A., Lounatmaa, K. & Haapasalo, M. (2000). Epidemiology and pathogenesis of Bacillus cereus infections. Microbes Infect 2, 189198.[CrossRef][Medline]

Lechner, S., Mayr, R., Francis, K. P., Pruss, B. M., Kaplan, T., Wiessner-Gunkel, E., Stewart, G. S. & Scherer, S. (1998). Bacillus weihenstephanensis sp. nov. is a new psychrotolerant species of the Bacillus cereus group. Int J Syst Bacteriol 48, 13731382.[Abstract/Free Full Text]

Liefting, L. W., Andersen, M. T., Beever, R. E., Gardner, R. C. & Forster, R. L. (1996). Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma. Appl Environ Microbiol 62, 31333139.[Abstract/Free Full Text]

Lund, T., De Buyser, M. L. & Granum, P. E. (2000). A new cytotoxin from Bacillus cereus that may cause necrotic enteritis. Mol Microbiol 38, 254261.[CrossRef][Medline]

Maden, B. E., Dent, C. L., Farrell, T. E., Garde, J., McCallum, F. S. & Wakeman, J. A. (1987). Clones of human ribosomal DNA containing the complete 18S-rRNA and 28S-rRNA genes. Characterization, a detailed map of the human ribosomal transcription unit and diversity among clones. Biochem J 246, 519527.[Medline]

Margulis, L., Jorgensen, J. Z., Dolan, S., Kolchinsky, R., Rainey, F. A. & Lo, S. C. (1998). The Arthromitus stage of Bacillus cereus: intestinal symbionts of animals. Proc Natl Acad Sci U S A 95, 12361241.[Abstract/Free Full Text]

Mietke, H., Beer, W., Voigt, W., Zucker, B. & Reissbrodt, R. (2000). Characterization and differentiation of probiotic Bacillus cereus isolates from feeds. In FT-IR Spectroscopy in Microbiological and Medical Diagnostic. Berlin: Robert Koch-Institute.

Mylvaganam, S. & Dennis, P. P. (1992). Sequence heterogeneity between the two genes encoding 16S rRNA from the halophilic archaebacterium Haloarcula marismortui. Genetics 130, 399410.[Abstract/Free Full Text]

Ohnishi, M., Murata, T., Nakayama, K. & 8 other authors (2000). Comparative analysis of the whole set of rRNA operons between an enterohemorrhagic Escherichia coli O157 : H7 Sakai strain and an Escherichia coli K-12 strain MG1655. Syst Appl Microbiol 23, 315324.[Medline]

Okstad, O. A., Gominet, M., Purnelle, B., Rose, M., Lereclus, D. & Kolsto, A. B. (1999). Sequence analysis of three Bacillus cereus loci carrying PIcR-regulated genes encoding degradative enzymes and enterotoxin. Microbiology 145, 31293138.[Abstract/Free Full Text]

Patra, G., Fouet, A., Vaissaire, J., Guesdon, J. L. & Mock, M. (2002). Variation in rRNA operon number as revealed by ribotyping of Bacillus anthracis strains. Res Microbiol 153, 139148.[Medline]

Perriere, G. & Gouy, M. (1996). WWW-query: an on-line retrieval system for biological sequence banks. Biochimie 78, 364369.[Medline]

Priest, F. G., Kaji, D. A., Rosato, Y. B. & Canhos, V. P. (1994). Characterization of Bacillus thuringiensis and related bacteria by ribosomal RNA gene restriction fragment length polymorphisms. Microbiology 140, 10151022.[Abstract/Free Full Text]

Pruss, B. M., Francis, K. P., von Stetten, F. & Scherer, S. (1999). Correlation of 16S ribosomal DNA signature sequences with temperature-dependent growth rates of mesophilic and psychrotolerant strains of the Bacillus cereus group. J Bacteriol 181, 26242630.[Abstract/Free Full Text]

Read, T. D., Peterson, S. N., Tourasse, N. & 49 other authors (2003). The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423, 8186.[CrossRef][Medline]

Reischl, U., Feldmann, K., Naumann, L., Gaugler, B. J., Ninet, B., Hirschel, B. & Emler, S. (1998). 16S rRNA sequence diversity in Mycobacterium celatum strains caused by presence of two different copies of 16S rRNA gene. J Clin Microbiol 36, 17611764.[Abstract/Free Full Text]

Ronner, U., Husmark, U. & Henriksson, A. (1990). Adhesion of Bacillus spores in relation to hydrophobicity. J Appl Bacteriol 69, 550556.[Medline]

Salamitou, S., Ramisse, F., Brehelin, M., Bourguet, D., Gilois, N., Gominet, M., Hernandez, E. & Lereclus, D. (2000). The plcR regulon is involved in the opportunistic properties of Bacillus thuringiensis and Bacillus cereus in mice and insects. Microbiology 146, 28252832.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D. R. & Dean, D. H. (1998). Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62, 775806.[Abstract/Free Full Text]

Selander, R. K., Caugant, D. A., Ochman, H., Musser, J. M., Gilmour, M. N. & Whittam, T. S. (1986). Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics. Appl Environ Microbiol 51, 873884.[Free Full Text]

Shimizu, T., Ohshima, S., Ohtani, K., Hoshino, K., Honjo, K. & Hayashi, H. (2001). Sequence heterogeneity of the ten rRNA operons in Clostridium perfringens. Syst Appl Microbiol 24, 149156.[CrossRef][Medline]

Stabb, E. V., Jacobson, L. M. & Handelsman, J. (1994). Zwittermicin A-producing strains of Bacillus cereus from diverse soils. Appl Environ Microbiol 60, 44044412.[Abstract/Free Full Text]

Stenfors, L. P., Mayr, R., Scherer, S. & Granum, P. E. (2002). Pathogenic potential of fifty Bacillus weihenstephanensis strains. FEMS Microbiol Lett 215, 4751.[CrossRef][Medline]

Temeyer, K. B. (1984). Larvicidal activity of Bacillus thuringiensis subsp. israelensis in the dipteran Haematobia irritans. Appl Environ Microbiol 47, 952955.[Abstract/Free Full Text]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 48764882.[Abstract/Free Full Text]

Ticknor, L. O., Kolsto, A. B., Hill, K. K., Keim, P., Laker, M. T., Tonks, M. & Jackson, P. J. (2001). Fluorescent amplified fragment length polymorphism analysis of Norwegian Bacillus cereus and Bacillus thuringiensis soil isolates. Appl Environ Microbiol 67, 48634873.[Abstract/Free Full Text]

Vilas-Boas, G., Sanchis, V., Lereclus, D., Lemos, M. V. & Bourguet, D. (2002). Genetic differentiation between sympatric populations of Bacillus cereus and Bacillus thuringiensis. Appl Environ Microbiol 68, 14141424.[Abstract/Free Full Text]

Yap, W. H., Zhang, Z. & Wang, Y. (1999). Distinct types of rRNA operons exist in the genome of the actinomycete Thermomonospora chromogena and evidence for horizontal transfer of an entire rRNA operon. J Bacteriol 181, 52015209.[Abstract/Free Full Text]

Received 28 October 2003; revised 28 November 2003; accepted 2 December 2003.