Research Article

Cloning and characterization of the goadsporin biosynthetic gene cluster from Streptomyces sp. TP-A0584

Microbiology 2005; 151(12):3923 · https://doi.org/10.1099/mic.0.28420-0

View at publisher PubMed

Abstract

The biosynthetic gene cluster of goadsporin, a polypeptide antibiotic containing thiazole and oxazole rings, was cloned from Streptomyces sp. TP-A0584. The cluster contains a structural gene, godA, and nine god (goadsporin) genes involved in post-translational modification, immunity and transcriptional regulation. Although the gene organization is similar to typical bacteriocin biosynthetic gene clusters, each goadsporin biosynthetic gene shows low homology to these genes. Goadsporin biosynthesis is initiated by the translation of godA, and the subsequent cyclization, dehydration and acetylation are probably catalysed by godD, godE, godF, godG and godH gene products. godI shows high similarity to the 54 kDa subunit of the signal recognition particle and plays an important role in goadsporin immunity. Furthermore, four goadsporin analogues were produced by site-directed mutagenesis of godA, suggesting that this biosynthesis machinery is used for the heterocyclization of peptides.
Abbreviations: GS disc assay, goadsporin paper disc diffusion assay; SRP, signal recognition particle

The GenBank/EMBL/DDBJ accession number for the sequence reported in this paper is AB205012.

Goadsporin, a secondary metabolite of Streptomyces sp. TP-A0584, is a 19 aa polypeptide containing four oxazole and two thiazole rings derived from serine, threonine or cysteine, and two molecules of dehydroalanine derived from serine (Fig. 1).



(28K):

Fig. 1. Chemical structures of goadsporin, its derivatives and microcin B17. The unusual amino acids in goadsporin and its derivatives are abbreviated as follows: Oxa, oxazole; MeOxa, methyloxazole; Thia, thiazole; Deala, dehydroalanine. The replaced residues in the goadsporin derivatives are indicated by outline characters. The amino acid sequence of microcin B17 is indicated as a single letter code.

Goadsporin promotes secondary metabolism and morphogenesis at low concentrations and induces growth inhibition at high concentrations, in actinomycetes. For example, in Streptomyces lividans, goadsporin promotes the formation of red pigments and sporulation at a concentration of 1 µM and inhibits growth at >1 µM. This activity is observed in a wide variety of actinomycetes, whereas no bioactivity is observed in other organisms. Among 42 tested actinomycetes strains, 36 strains showed an induction of sporulation and/or secondary metabolite production at low concentrations of goadsporin (Onaka et al., 2001). Currently, the target of the goadsporin antibiotic activity is unknown.

A similar bioactivity to that of goadsporin is associated with SapB peptide. SapB is a morphogenetic peptide produced by Streptomyces coelicolor A3(2). It functions as a biological surfactant allowing the hyphae to grow upright. Recently Kodani et al. (2004) revealed that it is ribosomally synthesized. However, goadsporin is not a morphogenetic peptide for the strain TP-A0584, because goadsporin did not induce the spore and pigment formation in TP-A0584 when it was added to the medium, and goadsporin is not released by TP-A0584 into the culture medium but accumulates in the cell (Onaka et al., 2001).

Actinomycetes are well known for their production of a wide variety of polypeptide antibiotics. In particular, numerous nonribosomal peptides have been isolated from actinomycetes. Some of these peptides contain thiazole or oxazole rings (Roy et al., 1999); however, structures related to goadsporin have not yet been reported. The chemical structure of goadsporin is related to that of microcin B17 (Yorgey et al., 1994), a bacteriocin produced by Escherichia coli, rather than to those of the nonribosomal peptides isolated from actinomycetes. Microcin B17 is a glycine-rich linear 49 aa long polypeptide containing four oxazoles and four thiazoles with two sets of mixed tandem pairs in the sequence (Fig. 1). The peptide structure of microcin B17 is generated by ribosomes; hence, its peptide sequence is encoded in the structural gene, mcbA. In microcin B17 biosynthesis, the mcbA gene product is a 69 aa precursor polypeptide, and mcbB, mcbC and mcbD gene products form the microcin B17 synthetase complex, and catalyse the heterocyclization. In this case, cysteine and serine residues neighbouring glycine in the Gly-Cys, Gly-Ser, Gly-Ser-Cys, and Gly-Cys-Ser motifs are converted to thiazole, oxazole, oxazolethiazole and thiazoleoxazole tandem structures, respectively (Li et al., 1996). However, in goadsporin biosynthesis, cysteine, serine and threonine residues neighbouring glycine, serine, alanine or leucine are heterocyclized, and it is likely that the sequence specificity for heterocyclization of goadsporin is different from that of microcin B17.

In this paper, we describe the cloning and genetic analysis of the complete goadsporin biosynthetic gene cluster from Streptomyces sp. TP-A0584 and provide a basis for the construction of goadsporin analogue libraries using this biosynthetic machinery.

Bacterial strains and growth conditions.
Streptomyces sp. TP-A0584 was used as the goadsporin production strain. S. lividans TK23 served as a heterologous expression host. Streptomyces scabies JCM 7914 was obtained from the Japan Collection of Microorganisms. E. coli DH5α served as a host for subcloning in plasmid pUC19 and its derivatives. E. coli XL1-Blue MR was used for the pTOYAMAcos cosmid libraries. E. coli S17-1 was used for transconjugation (Mazodier et al., 1989). Growth conditions and manipulations for E. coli were similar to those described by Sambrook & Russell (2001). A-3M was the production medium, and V-22 was the seed medium, for S. lividans and Streptomyces sp. TP-A0584 (Onaka et al., 2001). Bennett's glucose agar, nutrient agar and mannitol soya flour agar (Onaka et al., 2001) were used for transconjugation.

General recombinant DNA techniques.
Restriction endonucleases, T4 DNA ligase and Taq polymerase were purchased from New England Biolabs. PCR was carried out using a PTC-200 DNA Engine (MJ Research). Automatic DNA sequencing was carried out using a BigDye Terminator Cycle Sequencing Ready Reaction Kit and analysed on an ABI PRISM 310 DNA sequencer (Applied Biosystems). DNA manipulations in E. coli were performed as described by Sambrook & Russell (2001), and those in Streptomyces were performed as described by Kieser et al. (2000).

Sample preparation of goadsporin and its derivatives, and HPLC detection conditions.
Detection of goadsporin was performed by HPLC analysis or a paper disc diffusion assay. Each strain was used to inoculate a 500 ml K-1 flask (K-techno) containing 100 ml V-22 medium. After incubation at 30 °C for 2 days on a rotary shaker at 200 r.p.m., 5 ml samples of the seed culture were transferred into 500 ml K-1 flasks containing 100 ml A-3M medium. Fermentation was carried out at 30 °C for 5 days on the same rotary shaker. Cell pellets from the whole culture broth were extracted with 100 ml n-butanol. After evaporation of the n-butanol, the residue was dissolved in methanol. HPLC analysis was performed with an HP1090 (Hewlett Packard) system using a C18 Rainin Microsorb column (3 µ, 4·6 mm i.d.x100 mm length, Rainin Instrument). Acetonitrile, 0·15 % KH2PO4 was used as elution buffer. The temperature was 40 °C, and the flow rate was 1·2 ml min1. Acetonitrile, 0·15 % KH2PO4 (pH 3·5) was used as the solvent, and detection was performed at 254 nm. (Gradient diagrams are shown in Fig. 5a.) Goadsporin was identified based on retention time, UV spectrum and molecular mass. LC-MS spectra were obtained on an API165 machine (Applied Biosystems).



(36K):

Fig. 5. HPLC analysis (a), and biological activity of goadsporin and selected goadsporin analogues (b, c). (a) HPLC conditions and sample preparation are described in Methods. The elution was with a linear gradient as indicated on the right-hand scale in the bottom chart. The elution peaks of each derivative are indicated by black arrow heads, and the values on the arrow heads indicate their retention time. The elution peaks with white arrow heads at 18·5 min in T5S, G10A, S15T, 20K and pGSB14k+pGODI indicate the peak of thiostreptone, which was present in recombinant strain cultures. (b, c) GS disc assays with the goadsporin analogues indicating the response against S. lividans TK23 and S. scabies JCM7914. Growth inhibition is indicated by a clear zone of inhibition of S. lividans TK23 (b) or S. scabies JCM7914 (c) around the paper disc.

Goadsporin paper disc diffusion assay (GS disc assay).
Nutrient broth soft agar (3 ml) containing 108 spores of S. lividans TK23 or S. scabies JCM 7914 was overlaid onto a Bennett's agar plate. n-Butanol extracts, as described above, or purified samples were absorbed onto paper discs (diameter 10 mm), dried, settled on the plates and incubated at 30 °C. Growth inhibition, pigment production and/or cell differentiation around the paper disc was observed for 3 days.

Cloning of goadsporin biosynthetic genes.
The oligonucleotide probe that was used for cloning the goadsporin-structural-gene encoding DNA fragment was designed according to the codon usage table for Streptomyces. The probe had the following sequence: 5'-GC(G/C)AC(G/C)GT(G/C)(A/T)(G/C)(G/C)AC(G/C)ATCCT(G/C)TGC(A/T)(G/C)(G/C)GG(G/C)GG(G/C)AC(G/C)CT(G/C)(A/T)(G/C)(G/C)(A/T)(G/C)(G/C)GC(G/C)GG(G/C)TGCGT-3'. Southern blot hybridization was performed using this oligonucleotide as the probe against Streptomyces sp. TP-A0584 chromosomal DNA, and we chose a 1·3 kb signal in the BamHI digestion and cloned the corresponding DNA fragment into pUC19 to give pGSB1. The DNA sequence of the 1·3 kb BamHI fragment was determined and confirmed to have the goadsporin precursor sequence. Then, the 1·3 kb BamHI fragment was used as a probe for screening the cosmid library, which was constructed with Streptomyces sp. TP-A0584 genomic DNA and a bi-functional cosmid, pTOYAMAcos (Onaka et al., 2003b). Chromosomal DNA was prepared and partially digested with Sau3AI, and DNA fragments greater than 30 kb were purified by agarose gel electrophoresis. The fragments were ligated with BamHI-digested pTOYAMAcos and packaged into λ phage to give a genomic library of Streptomyces sp. TP-A0584. Two positive clones were isolated and renamed pGSBC1 and pGSBC2.

Construction of plasmids for heterologous expression.
(i) pGSB14k. pGSBC1 was digested with HindIII, and the resulting 14 kb fragment was cloned into the HindIII site of pTYM19 to generate pGSB14k. pTYM19 is an actinomycetesE. coli integrating vector (Onaka et al., 2003b). (ii) pGSB16k. pGSBC1 was digested with XhoI, and the resulting 3 kb fragment was cloned into the SalI site of pUC19. The plasmid was digested with PstI and EcoRI, and the resulting 3 kb fragment was cloned into the PstI and EcoRI sites of pTYM19 to give pGSB3k. A 14 kb HindIII fragment was prepared from pGSBC1 and cloned into the HindIII site of pGSB3k to construct pGSB16k. (iii) pGSB20k. A 6 kb HindIIIClaI fragment was prepared from pGSBC1 and subcloned into the HindIII and ClaI sites of pBluescript II KS+. The plasmid was digested with KpnI and HindIII, and the resulting 6 kb fragment was cloned into the KpnI and HindIII sites of pTYM19 to generate pGSB6k. A 14 kb HindIII digested fragment was cloned into the HindIII site of pGSB6k to generate pGSB20k. (iv) pGODI. The godI gene was generated as a 1·2 kb DNA fragment by PCR, using pGSBC1 as the template and two oligonucleotide primers, 5'-GCGACCCATATGTTCGACACTCTCTCCGAT-3' and 5'-ACGGAATTCATCTTGCGAGTGTCGAAGAAC-3'. The underlined bases indicate the NdeI and EcoRI restriction enzyme sites. for PCR. The PCR-generated godI fragment facilitates further subcloning, and was cloned into the NdeI and EcoRI sites of pTYM1ep to generate pGODI. pTYM1ep, as well as pTYM18, is an actinomycetes integrating vector. pTYM1ep contains a TG1 actinophage integration gene instead of the πC31 actinophage integration gene in pTYM18 (Onaka et al., 2003b). In addition, pTYM1ep contains a constitutively active ermE* promoter upstream of the multiple cloning sites (H. Onaka, unpublished work).

Construction of the strains for gene inactivation of godA, godB and godI.
For the in-frame deletion of godA, the upstream and downstream regions of godA were PCR amplified, and the resulting fragments were cloned into the HindIII/XbaI and XbaI/EcoRI sites of pK18mob (Schafer et al., 1994) to give pDgodA. The upstream region of godA was amplified by using pGSBC2 as the template DNA, and the primers godA2937DNEco and godA1065DNXba. The downstream region of godA was amplified by using pGSBC1 as the template DNA, and the primers godA-D5-Xba and godA-D5-78Hind. Both the reactions generated 2 kb PCR products. The primer sequences are as follows: godA2937DNEco, 5'-GAGGAATTCCGAGAGCGATGTTGTCGGCGA-3'; godA1065DNXba, 5'-GCGTCTAGACGGTCGTCGCCTAGGTGACTA-3'; godA-D5-Xba, 5'-CTCTCTAGACATATCGCGATTTACACGGCG-3'; godA-D5-78Hind, 5'-AGCAAGCTTTCTGGCGGAGCCAGGAGCAAG-3'. The underlined bases indicate the EcoRI, HindIII and XbaI restriction enzyme sites.

For the in-frame deletion of godB, a 1·8 kb SphI fragment was prepared from pGSBC1 and cloned into the SphI site of pK18mob to generate pDB1. A 3·4 kb BamHI fragment was prepared from pGSBC1 and cloned into pUC19 to generate pGS3. pGS3 was digested with KpnI, and the resulting 2·3 kb fragment was cloned into the KpnI site of pDB1 to generate pDgodB.

For single crossover deletions of godI, a partial fragment of godI was PCR amplified with primers designed based on the internal regions of godI, and with pGSBC1 as the template. The primer sequences are as follows: godI-DN, 5'-ATCAAGCTTGCCGGTCTGCAGGGTGCGGGC-3' and godI-DC, 5'-ACGGAATTCATCCTGCGAGTGTCGAAGAAC-3'. Underlined bases indicate the EcoRI and HindIII restriction enyyme sites. The 987 bp amplified fragment was inserted into pK18mob to give pDgodI. The gene disruption procedure was as described by Onaka et al. (2003a).

Construction of goadsporin derivative expression vectors.
For godA mutagenesis, site-directed mutagenesis was carried out with QuikChange site-directed mutagenesis kit (Stratagene) with pGSB1. The primers were as follows: T5S sense, 5'- CGCCACCGTCAGCAGCATCCTGTGCAGCG -3'; T5S anti, 5'-CGCTGCACAGGATGCTGCTGACGGTGGCG-3'; G10A sense, 5'-CATCCTGTGCAGCGCCGGCACCCTCAGC-3'; G10A anti, 5'-GCTGAGGGTGCCGGCGCTGCACAGGATG-3'; S15T sense, 5'-GGCGGCACCCTCAGCACGGCCGGCTGCGTC-3'; S15T anti, 5'-GACGCAGCCGGCCGTGCTGAGGGTGCCGCC-3'; 20K sense, 5'-GGCCGGCTGCGTCAAGTGATCGGTCGTCG-3'; 20K anti, 5'-CGACGACCGATCACTTGACGCAGCCGGCC-3'.

The point mutations are underlined. Following mutagenesis, the presence of the desired DNA sequences was confirmed. The mutated godA genes were digested with BamHI, and the resulting fragments were cloned into the BamHI site of pTYM19 to generate pTYM-T5S, pTYM-G10A, pTYM-S15T and pTYM-20K.

Cloning of the goadsporin biosynthetic gene cluster
It was presumed that goadsporin is biosynthesized ribosomally since all its 19 constituent amino acids are common L-amino acids (Igarashi et al., 2001). The dehydroalanine and oxazole rings were considered to be derived from serine, methyloxazole from threonine, and thiazole from cysteine. Thus, we predicted that the amino acid sequence for the goadsporin precursor is ATVSTILCSGGTLSSAGCV and synthesized an oligonucleotide based on this sequence. Southern blot hybridization was carried out using this as a probe with the Streptomyces sp. TP-A0584 chromosomal DNA digested with BamHI, BglII, PstI, SacI and SphI. Among the positive signals (1·3, >23, >23, 4 and 1·6 kb, respectively), the 1·3 kb signal in the BamHI digest was selected, and the corresponding DNA fragment was cloned into pUC19 to generate pGSB1 (Fig. 2a). The nucleotide sequence of the 1·3 kb DNA fragment in pGSB1 contained a 49 aa long ORF that contained the above-described amino acid sequence (Fig. 2b). We assumed that this ORF was the structural gene for goadsporin and named it godA, one of the genes present in the god (goadsporin) cluster. To clone the entire set of genes in the goadsporin biosynthetic cluster, a cosmid library of genomic DNA from Streptomyces sp.TP-A0584 was screened by colony hybridization using pGSB1 as a probe. Two positive clones were obtained and designated pGSBC1and pGSBC2 (Fig. 3a).



(29K):

Fig. 2. Detection of the goadsporin structural gene. (a) Southern blot hybridization using 32P-labelled oligonucleotide DNA as the probe, and BamHI-, BglII-, PstI-, SacI- and SphI-digested chromosomal DNA of strain TP-A0584. (b) Nucleotide sequence of the godA region cloned in pGSB1, and the deduced amino acid sequence in single letter code. A putative ribosome-binding sequence is underlined. The precursor sequence of goadsporin is indicated by a broken line, and the site-directed mutation sites are indicated by arrows and replaced nucleotides. The post-translational modification residues are indicated as outline characters.


(51K):

Fig. 3. Restriction map and subcloning of the cloned DNA fragment (a), and goadsporin production of each transformant (b). (a) Plasmid pGSBC1 contained the originally cloned 40 kb Sau3AI fragment at the BamHI site of pTOYAMAcos. The other plasmids were constructed as described in Methods. The thick arrows indicate the extent and directions of the ORFs. Plasmid pGODI contains godI under the control of the ermE* promoter (ermE* pro) in the vector. GS pro., goadsporin production, which was detected using the GS disc assay. GS res., goadsporin resistance, which was determined on the basis of growth inhibition on Bennett's agar containing 30 µg goadsporin ml1. (b) A GS disc assay indicated that the culture extracts prepared from S.lividans harbouring pGSB20k, and co-harbouring pGSB14k and pGODI, produced goadsporin, whereas S.lividans harbouring pGSB16k did not. Goadsporin (5 µg) was absorbed onto the paper disc on the positive control plate (the panel at the right end of the figure). Goadsporin production is indicated by a zone of inhibition of S. lividans TK23 around the paper disc.

Heterologous production of goadsporin in S. lividans
S. lividans TK23, a surrogate host for heterologous expression, was transformed with both pGSBC1 and pGSBC2 clones. pTOYAMAcos cosmid vector was integrated into the specific chromosomal attC site in actinomycetes (Onaka et al., 2003). Only the strain integrated with pGSBC1 produced goadsporin. Nucleotide sequencing of the pGSBC1 fragment revealed that godA was located at the end of the fragment, and 14 ORFs, spanning 20 kb, were located downstream of godA. pGSBC2 contains only the part of the cluster corresponding to the 5' end of godE and the genes upstream of it, as shown in Fig. 3(a). Next, three clones pGSB14k, pGSB16k and pGSB20k were constructed from pGSBC1 (Fig. 3a), and cells transformed with each construct were cultured in goadsporin production medium. After 5 days, the n-butanol extract of the mycelium was subjected to the GS disc assay (Fig. 3b). Only the extract from S. lividans harbouring pGSB20k was positive; thus, it was proved that the 20 kb region between godA and orf5 was essential for goadsporin biosynthesis. Further analysis revealed that goadsporin production was detected in a pGSB14k and pGODI co-transformed strain (Fig. 3b and 5a). It was thus concluded that 10 genes godA, godB, godC, godD, godE, godF, godG, godH, godI and godR were responsible for goadsporin biosynthesis.

Characterization of the goadsporin biosynthetic gene cluster
Computer-aided BLAST analysis of the DNA sequence of the cloning region led to a tentative identification of the genes listed in Table 1.


Table 1. Deduced genes and their proposed functions in the god cluster.


The structural gene for goadsporin, godA, encodes a 49 aa propeptide of goadsporin. GodA contains a 30 aa long leader sequence at the N-terminal region, which has no homology to any known sequences.

godB encodes a protein composed of 550 aa. A BLAST search suggested that GodB is similar to LktB (22 % identity), a leukotoxin secretion ATP-binding protein, in Actinobacillus actinomycetemcomitans (Lally et al., 1991). LktB is required for the translocation and insertion of A. actinomycetemcomitans leukotoxin (AaLtA) into the cell membrane (Lally et al., 1991). A hydropathy plot predicts the formation of six membrane-spanning helices within the membrane domain (amino acid residues 1300). The ATP-binding motif (GSSGSGKS) is conserved in amino acid residues 375382. The LktB N-terminal residues spanning from 1 to 125 contain the peptidase C39 domain, but the GodB N-terminal residues spanning from 1 to 96 show no homology to LktB.

GodC is a 577 aa protein that shows sequence similarity to members of the ABC transporter family, as well as to GodB. The ATP-binding motif, GPSGAGKT, is conserved at the N-terminus, amino acid positions 362369. GodC shows sequence similarity to GodB over the entire sequence (20·0 % identity). Both these proteins may be responsible for the translocation of goadsporin to the cell membrane.

GodD is a 735 aa protein that shows sequence similarity to gra-orf12, which is involved in granaticin biosynthesis (44·4 % identity, 60 % similarity). Granaticin is a benzoisochromaquinone-type antibiotic produced by Streptomyces violaceoruber. The function of gra-orf12 in granaticin biosynthesis is unknown (Ichinose et al., 1998).

godE encodes a protein composed of 522 aa, which shows 25 % identity to McbC between amino acids 280 and 454 (Genilloud et al., 1989). McbC forms a multimeric microcin B17 synthetase complex with McbB and McbD proteins, and it cyclizes four cysteine residues and four serine residues to thiazoles and oxazoles, respectively, in the microcin B17 propeptide.

godF and godG encode proteins composed of 867 and 229 aa, respectively. A BLAST search shows no significant similarities to known proteins.

godH encodes a putative 222 aa protein that shows sequence similarity to Rv0802c, a putative acetyltransferase (40·9 % identity). In goadsporin biosynthesis, GodH protein is believed to catalyse the acetylation of the N-terminal alanine.

godR encodes a 238 aa protein with sequence similarity to brpA (22·7 % identity) from the bialaphos biosynthetic gene cluster in Streptomyces hygroscopicus (Raibaud et al., 1991). In particular, the helixturnhelix DNA-binding motif is strongly conserved between amino acids 208227 at the N-terminus (75 % similarity).

godI shows sequence similarity to ffh, the signal recognition particle (SRP) in E. coli (44·6 % identity; 74·9 % similarity). SRP is a ribosomal protein that catalyses targeting of nascent secretory and membrane proteins to the protein translocation apparatus of the cell (Luirink et al., 1992). SRP homologues have been identified in all living cells; all these homologues have been analysed thus far. Hypothetical ffh homologues in Streptomyces avermitilis and S. coelicolor A3(2) are also highly conserved with godI (76·6 % and 75·9 % identity, respectively).

The DNA sequences of orf1, orf2, orf3, orf4 and orf5 show high similarity to putative transposase genes, assigned by the genome project for S. coelicolor A3(2) and S. avermitilis. These five orf gene products are not involved in goadsporin biosynthesis.

Inactivation of godA, godB and godI
For disruption of the chromosomal genes, insertional inactivation via a double crossover was used with the derivatives of pK18mob and non-replicating E. coli plasmids (pDgodA and pDgodB), and via a single crossover (pDgodI). godA and godB were disrupted by in-frame deletion because insertional inactivation of godA or godB would be expected to have a polar effect on the transcription of genes downstream from godA or godB (Fig. 3). Finally, three mutants were independently isolated for godA and godB, and were further characterized. However, a godI disruptant could not be isolated, suggesting that godI either is essential for cell growth, or is a goadsporin self-resistance gene. We then constructed the godA and godI double-disruption mutants, which were isolated and further characterized. HPLC analysis of the fermentation extracts revealed that goadsporin was not produced in either disruptant and their mutations did not affect cell differentiation in TP-A0584 on Bennett's media (data not shown).

The SRP homologue, godI, is the goadsporin self-resistance gene
pGSBC1- or pGSB20k-transformed S. lividans exhibits resistance to goadsporin in the GS disc assay (Fig. 3a), suggesting that these plasmids contain a goadsporin immunity gene. On the other hand, pGSB14k- and pGSB16k-transformed S. lividans, both of which lack godI, were sensitive to goadsporin. godI was then cloned downstream of the constitutive ermE* promoter and was used to transform S. lividans using an integrating vector. The resulting transformant, which has godI integrated into the chromosomal DNA and expresses it constitutively, grew on a plate containing 30 µg goadsporin ml1, whereas a S. lividans TK23 and pGSB14k-transformed strain could not (Fig. 4a). Furthermore, the godI/godA disruptant could not grow on the plate containing 7 µg goadsporin ml1, whereas the godA disruptant, godB disruptant and the wild-type strain grew on the same plate (Fig. 4b).



(74K):

Fig. 4. Effects of godI on goadsporin self-resistance. (a) S. lividans harbouring pGODI grow on a plate containing 30 µg goadsporin ml1, whereas the wild-type strain (S. lividans) and S. lividans harbouring pGSB14k did not grow. (b) Strain TP-A0584 and its gene disruption mutants were inoculated onto a solid medium containing 7 µg goadsporin ml1. TP-A0584, ΔgodA and ΔgodB grow on the goadsporin-containing plate, whereas ΔgodIgodA did not grow. Both photographs were taken after 5 days growth on Bennett's agar media.

Biosynthesis of goadsporin analogues by godA mutants
Goadsporin analogues were produced using the goadsporin biosynthetic machinery. The amino acid sequence of godA was changed by site-directed mutagenesis (Fig. 2b), and four analogues were isolated from the recombinant gene strains. The mutated godA genes were cloned into the pTYM19 integration vector to generate pTYM-T5S, pTYM-G10A, pTYM-S15T and pTYM-20K. These plasmids were introduced into the godA disruptant and integrated into the TP-A0584 chromosomal DNA. The transformants were cultured at 30 °C for 5 days, and n-butanol extracts of the fermentation broth were analysed by LC-MS. In each extract, the production of new derivatives was detected as a peak at 13·7, 15·8, 19·9 and 12·1 min (Fig. 5a). These peaks showed UV-visible spectra identical to those of goadsporin and the molecular ion [M+H]+ at m/z 1597·6, 1625·7, 1625·7 and 1739·8, respectively. These values were in accordance with those calculated for the structures shown in Fig. 1. In the GS disc assay, derivatives T5S and S15T retained the activity of the parent compound, namely the production of pigments and sporulation in S. lividans, whereas G10A and 20K lost the activity (Fig. 5b). Interestingly, G10A retained the antibiotic activity against S. scabies, a potato scab pathogen strain (Fig. 5c). Proposed overall biosynthetic pathway of goadsporin
A proposed biosynthetic pathway for goadsporin is shown in Fig. 6. The 49 aa long godA polypeptide is ribosomally produced, and it is processed by putative goadsporin synthetases, GodD, GodE, GodF and GodG. These enzymes transform the amino acids at positions 2, 5, 8, 12, 15 and 18, from the N-terminus, into heterocycles, and the serine residues at positions 4 and 14 into dehydroalanines, to generate progoadsporin. Proteolysis of progoadsporin is then catalysed by a peptidase, GodB or GodC. Finally, GodH catalyses the N-acetylation of the N-terminus to produce goadsporin.



(20K):

Fig. 6. The proposed overall organization of the goadsporin biosynthesis gene cluster in Streptomyces sp. TP-A0584. (1)GodB and GodC deliver GodA to the cell membrane. (2) GodD, GodE, GodF and GodG catalyse post-translational modification of GodA (cyclization, dehydration). (3) GodB, GodC or some peptidase digests the leader peptide of GodA, andthe N-terminus of goadsporin is acetylated by GodH. (4) GodI binds to the goadsporin and anchors it to the cell membrane.

It is uncertain whether these gene products catalyse post-translational modification; however, subcloning experiments revealed that these gene products are necessary for goadsporin production (Fig. 3a); furthermore, the amino acid sequences of these genes products are similar to those of some secondary metabolite biosynthetic enzymes. godD is similar to gra-orf34, which is responsible for granaticin biosynthesis in S. violaceoruber Tu22. GodE is similar to McbC, a microcin B17 biosynthetic enzyme. GodF and GodG also show a slight similarity to a putative lanthionine biosynthesis protein (YP_055572) and a putative lantibiotic biosynthesis protein (ZP_00237845) (<25 % partial identity).

GodB or GodC is believed to be involved in the processing of the N-terminal leader since some ABC transporters involved in bacteriocin biosynthesis digest the leader sequence at the double glycine residue (Havarstein et al., 1995). In goadsporin biosynthesis, the processing site is predicted to be at the double alanine residues at positions 1 and 1. The processing site is different from typical signal peptidase cleavage sites. Therefore, godB and godC could not be characterized as encoding peptidases based on the deduced amino acid sequence homology in comparison with typical bacteriocin peptidases.

Goadsporin is structurally related to microcin B17 produced by E. coli. Genetic analysis has shown that microcin B17 is produced ribosomally, and its subsequent post-translational modification generates the thiazole and oxazole rings. Although the biosynthetic pathway of goadsporin and microcin B17 appear similar, the genes involved in their biosynthesis have no similarity except for godE. These findings suggest that the enzymes responsible for heterocyclization in goadsporin and microcin B17 have evolved independently. Recently, Widdick et al. (2003) reported on the bacteriocin cinnamycin biosynthetic gene cluster from Streptomyces cinnamoneus cinnamoneus DSM40005. Cinnamycin is a lantibiotic that contains lanthionine bridges derived by the post-translational modification of amino acid residues. The biosynthetic genes are not similar to god genes. This means that goadsporin and cinnamycin have also evolved independently. The G+C content of the Streptomyces genus is generally high. For example, the G+C content of S. avermitilis is 70·7 mol% and that of S. coelicolor A3(2) is 72·1 mol%. However, the G+C content of the goadsporin biosynthetic gene cluster is 65·7 mol%. In addition, the location of the goadsporin biosynthetic gene cluster in the genome is between some transposase-encoding genes. It is likely that the horizontal transfer of the cluster occurred from another genus that does not have a high G+C content.

Immunity to goadsporin in Streptomyces sp. TP-A0584
S. lividans harbouring godI is resistant to goadsporin, and the godI disruptant is sensitive to goadsporin. These results suggest that godI is involved in the goadsporin immunity system of the producing strain. godI has some similarity to ffh, a component of the SRP. The SRP recognizes the signal peptide of secretory or membrane proteins, and promotes their delivery to the cytoplasmic membrane. Generally, in bacteria, SRP forms a complex with Ffh and 4·5S RNA. Interestingly, a sequence that shows 91·6 % identity to 4·5S RNA in S. lividans (Palacin et al., 2003) is present 235 bp upstream from godI in the genome of strain TP-A0584 (Fig. 3a). Although pGODI plasmids did not contain the 4·5S RNA, it therefore seems reasonable that GodI forms a complex with S. lividans 4·5S RNA. One speculative mechanism for goadsporin resistance is shown in Fig. 6. GodI may bind to mature goadsporin, and the SRP receptor, which is located in the membrane, binds to GodI, and anchors goadsporin to the membrane.

In most bacteriocin biosynthesis, ABC transporters are responsible for the immunity. In goadsporin biosynthesis, godB and godC, ABC transporter homologues, are not responsible for the immunity because S. lividans transformed with pGSB14k exhibits no immunity for goadsporin. pGSB14k contains godB and godC, but not godI. Also the godB disruptant maintains goadsporin immunity. These results suggest that godI is the gene responsible for immunity. GodB and GodC are probably responsible for goadsporin delivery to the cell membrane. In addition to the ABC transporter system, other immunity systems are recognized in bacteriocin producers. They consist of self-resistant proteins that encode 50250 amino acids. These self-resistant proteins are of a wide variety and show no significant homology to known proteins. The functions of most immunity proteins are not yet clear (Sonomoto & Sashihara, 2001). Recently Tran & Jacoby (2002) revealed that the microcin B17 immunity gene, mcbG, is similar to the gene encoding the quinolone resistance protein, qnr, which was isolated from a multiresistance plasmid. They tested the ability of Qnr to reverse the inhibition of gyrase activity by quinolones in vitro. However, mcbG is not similar to godI or ffh.

SRP is a ubiquitous ribonucleoprotein particle, and one of its components, Ffh, is the only protein component present in all SRPs; hence, it plays an essential role in signal peptide and SRP receptor binding (Nagai et al., 2003). In strain TP-A0584, godI, an ffh homologue, is responsible for goadsporin immunity. To the best of our knowledge, this is the first report finding that an ffh homologue possesses another function besides translocation of secretory or membrane proteins.

Production of goadsporin analogues by site-directed mutagenesis of godA
The versatility of the goadsporin biosynthesis machinery has been indicated by the production of goadsporin analogues. For example, G10A is an analogue in which the 10th glycine is replaced with alanine. In the S15T analogue, the oxazole at the 15th position is changed to methyloxazole. In the T5S analogue, the methyl group of the 5th methyloxazole is substituted with hydrogen. 20K is an analogue having an additional lysine residue at the carboxyl end (Fig. 1). In microcin B17 biosynthesis, the N-terminal leader sequence of pre-microcin B17 is essential for its in vivo post-translational modification to pro-microcin B17 (Madison et al., 1997). It has been suggested that the leader is recognized as a binding site by post-translational modification enzymes, McbB, McbC and McbD. godA also contains a 30 aa leader peptide at the N-terminus, the sequence of which is not similar to the secretion signal sequence; therefore, the post-translational modification enzymes might recognize it as a binding site. A wide variety of goadsporin analogues could be produced by this method, and the goadsporin biosynthesis machinery can also be used for the heterocyclization of oligopeptides. Although G10A lost its activity against S. lividans, its activity for S. scabies was retained. S. scabies is known to cause potato scab worldwide. We have demonstrated that the goadsporin antibiotic spectrum could be changed by amino acid replacement. This approach will enable the application of the analogues as agricultural chemicals against potato scab.

We are grateful to Dr Haruo Ikeda, Kitasato University, Kanagawa, Japan for providing the plasmids and E. coli strains, and to Dr M. J. Bibb, John Innes Centre, Norwich, UK for providing the ermE* promoter. We also thank Mr Yoshitaka Ikeda of Toyama Prefectural University for collecting the MS spectra and Ms Yoko Kanamori for her technical assistance. This work was partly supported by Grants-in-Aid for Scientific Research awarded to H. O. by the Waksman Foundation of Japan Inc. and Noda Institute for Scientific Research.

References

Genilloud, O., Moreno, F. & Kolter, R. (1989). DNA sequence, products, and transcriptional pattern of the genes involved in production of the DNA replication inhibitor microcin B17. J Bacteriol 171, 11261135.[Abstract/Free Full Text]

Havarstein, L. S., Diep, D. B. & Nes, I. F. (1995). A family of bacteriocin ABC transporters carry out proteolytic processing of their substrates concomitant with export. Mol Microbiol 16, 229240.[Medline]

Ichinose, K., Bedford, D. J., Tornus, D., Bechthold, A., Bibb, M. J., Revill, W. P., Floss, H. G. & Hopwood, D. A. (1998). The granaticin biosynthetic gene cluster of Streptomyces violaceoruber Tu22: sequence analysis and expression in a heterologous host. Chem Biol 5, 647659.[CrossRef][Medline]

Igarashi, Y., Kan, Y., Fujii, K., Fujita, T., Harada, K., Naoki, H., Tabata, H., Onaka, H. & Furumai, T. (2001). Goadsporin, chemical substance which promotes secondary metabolism and morphogenesis in streptomycetes II. structure determination. J Antibiot 54, 10451053.[Medline]

Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F. & Hopwood, D. A. (2000). Practical Streptomyces Genetics. Norwich, UK: The John Innes Foundation.

Kodani, S., Hudson, M. E., Durrant, M. C., Buttner, M. J., Nodwell, J. R. & Willey, J. M. (2004). The SapB morphogen is a lantibiotic-like peptide derived from the product of the developmental gene ramS in Streptomyces coelicolor. Proc Natl Acad Sci U S A 101, 1144811453.[Abstract/Free Full Text]

Lally, E. T., Golub, E. E., Kieba, I. R., Taichman, N. S., Decker, S., Berthold, P., Gibson, C. W., Demuth, D. R. & Rosenbloom, J. (1991). Structure and function of the B and D genes of the Actinobacillus actinomycetemcomitans leukotoxin complex. Microb Pathog 11, 111121.[CrossRef][Medline]

Li, Y. M., Milne, J. C., Madison, L. L., Kolter, R. & Walsh, C. T. (1996). From peptide precursors to oxazole and thiazole-containing peptide antibiotics: microcin B17 synthase. Science 274, 11881193.[Abstract/Free Full Text]

Luirink, J., High, S., Wood, H., Giner, A., Tollervey, D. & Dobberstein, B. (1992). Signal-sequence recognition by an Escherichia coli ribonucleoprotein complex. Nature 359, 741743.[CrossRef][Medline]

Madison, L. L., Vivas, E. I., Li, Y.-M., Walsh, C. T. & Kolter, R. (1997). The leader peptide is essential for the post-translational modification of the DNA-gyrase inhibitor microcin B17. Mol Microbiol 23, 161168.[CrossRef][Medline]

Mazodier, P., Petter, R. & Thompson, C. (1989). Intergeneric conjugation between Escherichia coli and Streptomyces species. J Bacteriol 171, 35833585.[Abstract/Free Full Text]

Nagai, K., Oubridge, C., Kuglstatter, A., Menichelli, E., Isel, C. & Jovine, L. (2003). Structure, function and evolution of the signal recognition particle. EMBO J 22, 34793485.[CrossRef][Medline]

Onaka, H., Tabata, H., Igarashi, Y., Sato, Y. & Furumai, T. (2001). Goadsporin, a chemical substance which promotes secondary metabolism and morphogenesis in streptomycetes. I. Purification and characterization. J Antibiot 54, 10361044.[Medline]

Onaka, H., Taniguchi, S., Igarashi, Y. & Furumai, T. (2003a). Characterization of the biosynthetic gene cluster of rebeccamycin from Lechevalieria aerocolonigenes ATCC 39243. Biosci Biotechnol Biochem 67, 127138.[CrossRef][Medline]

Onaka, H., Taniguchi, S., Ikeda, H., Igarashi, Y. & Furumai, T. (2003b). pTOYAMAcos, pTYM18, and pTYM19, actinomycete-Escherichia coli integrating vectors for heterologous gene expression. J Antibiot. 56, 950956.[Medline]

Palacin, A., de la Fuente, R., Valle, I., Rivas, L. A. & Mellado, R. P. (2003). Streptomyces lividans contains a minimal functional signal recognition particle that is involved in protein secretion. Microbiology 149, 24352442.[Abstract/Free Full Text]

Raibaud, A., Zalacain, M., Holt, T. G., Tizard, R. & Thompson, C. J. (1991). Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus. J Bacteriol 173, 44544463.[Abstract/Free Full Text]

Roy, R. S., Gehring, A. M., Milne, J. C., Belshaw, P. J. & Walsh, C. T. (1999). Thiazole and oxazoles peptides: biosynthesis and molecular machinery. Nat Prod Rep 16, 249263.[CrossRef][Medline]

Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G. & Puhler, A. (1994). Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 6973.[CrossRef][Medline]

Sonomoto, K. & Sashihara, T. (2001). Structure and mode of action of bacteriocins produced by lactic acid bacteria. Tanpakushitsu Kakusan Koso 46, 323332.[Medline]

Tran, J. H. & Jacoby, G. A. (2002). Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci U S A 99, 56385642.[Abstract/Free Full Text]

Widdick, D. A., Dodd, H. M., Barraille, P., White, J., Stein, T. H., Chater, K. F., Gasson, M. J. & Bibb, M. J. (2003). Cinnamycin biosynthetic gene cluster from Streptomyces cinnamoneus cinnamoneus DSM 40005. Proc Natl Acad Sci U S A 100, 4316432.[Abstract/Free Full Text]

Yorgey, P., Lee, J., Kördel, J., Vivas, E., Warner, P., Jebaratnam, D. & Kolter, R. (1994). Posttranslational modifications in microcin B17 define an additional class of DNA gyrase inhibitor. Proc Natl Acad Sci U S A 91, 45194523.[Abstract/Free Full Text]

Received 9 August 2005; revised 22 September 2005; accepted 27 September 2005.