Research Article

The 120 592 bp IncF plasmid pRSB107 isolated from a sewage-treatment plant encodes nine different antibiotic-resistance determinants, two iron-acquisition systems and other putative virulence-associated functions

Microbiology 2005; 151(4):1095 · https://doi.org/10.1099/mic.0.27773-0

View at publisher PubMed

Abstract

The antibiotic-multiresistance IncF plasmid pRSB107 was isolated by a transformation-based approach from activated-sludge bacteria of a wastewater-treatment plant. It confers resistance to ampicillin, penicillin G, chloramphenicol, erythromycin, kanamycin, neomycin, streptomycin, sulfonamides, tetracycline and trimethoprim and against mercuric ions. Complete sequencing of this plasmid revealed that it is 120 592 bp in size and has a G+C content of 53·1 mol%. The plasmid backbone is composed of three replicons, RepFIA, RepFIB and RepFII, which are almost identical to corresponding regions located on the F-plasmid and on R100. The three replicons encode replication initiation (rep) and replication control, multimer resolution (mrs), post-segregational killing of plasmid-free cells (psk) and active plasmid partitioning (sopABC locus). Part of the F-leading region and remnants of the F-homologous DNA-transfer (tra) module complete the pRSB107 backbone. Plasmid pRSB107 contains a complex, highly mosaic 35 991 bp antibiotic-resistance region consisting of a Tn21- and a Tn10-derivative and a chloramphenicol-resistance module. The Tn21 derivative is composed of a mercury-resistance region (mer), a Tn4352B-like kanamycin/neomycin-resistance transposon, a streptomycin/sulfonamide-resistance module, remnants of the β-lactam-resistance transposon Tn1, a macrolide-resistance module flanked by copies of IS26 and IS6100, remnants of Tn402 integrating a class 1 integron and the Tn21-specific transposition module. A truncated version of the tetracycline-resistance transposon Tn10 and the chloramphenicol acetyltransferase gene catA complete the pRSB107 resistance region. In addition to antibiotic resistance, pRSB107 encodes the following putative virulence-associated functions: (i) an aerobactin iron-acquisition siderophore system (iuc/iut); (ii) a putative high-affinity Fe2+ uptake system which was previously identified on a pathogenicity island of Yersinia pestis and in the genome of the phytopathogen Erwinia carotovora subsp. atroseptica SCRI1043; (iii) an sn-glycerol-3-phosphate transport system (ugp); and (iv) the virulence-associated genes vagCD having a possible function in stable plasmid inheritance. All the accessory modules are framed by insertion sequences, indicating that pRSB107 was gradually assembled by integration of different horizontally acquired DNA segments via transposition or homologous recombination.
Abbreviations: DMP, dimethyl phosphate

The GenBank/EMBL/DDBJ accession number for the sequence reported in this paper is AJ851089.

Plasmids are extra-chromosomal genetic elements, which are normally not essential for their bacterial hosts. However, under certain stress conditions, such as presence of antibiotics or toxic compounds, nutrient limitation or high cell densities, and in the course of pathogenic interactions, plasmids can be advantageous for the host cell. Several naturally occurring plasmids encode resistance to antibiotics, heavy metals and pollutants, additional metabolic pathways enabling utilization of particular carbon and energy sources, or virulence and colonization factors (Burlage et al., 1990; Martinez et al., 2001; Pansegrau et al., 1994; Womble & Rownd, 1988). Plasmids also play an important role in the evolution of bacteria by facilitating vertical and horizontal gene transfer (Davies, 1994; Davison, 1999; Mazel & Davies, 1999).

Plasmids belonging to the incompatibility (Inc) group F are especially versatile in providing advantageous traits to their hosts. The prototype IncF plasmid is the fertility factor F of Escherichia coli (Cavalli et al., 1953; Perez-Casal et al., 1989). It carries genes for its own conjugative transfer, is able to integrate into the host chromosome via recombination and can transfer chromosomal markers during conjugation (Boyd et al., 1996; Lawley et al., 2003). The IncF group is divided into six subgroups: IncFI to IncFVI (Saadi et al., 1987). IncF plasmids mediate resistance to antibiotics [R100 (Womble & Rownd, 1988)], encode virulence functions [pColV-K30 (Herrero et al., 1988); pO157 (Burland et al., 1998; Schmidt et al., 1997); p307 (Spiers et al., 1993)] or produce colicins [pColV plasmids (Gibbs et al., 1993); pColV3-K30 (Spiers et al., 1993)].

Since several IncF antibiotic-resistance and virulence plasmids have been isolated from enteric bacteria of hospitalized patients (Burland et al., 1998; Di Lorenzo et al., 2003; Herrero et al., 1988; Schmidt et al., 1997; Womble & Rownd, 1988) it is very likely that enteric bacteria containing such plasmids reach wastewater-treatment plants with the sewage released from hospitals. It is generally believed that sewage-treatment plants represent hot-spots for horizontal gene transfer (Blàzquez et al., 1996; Dröge et al., 1998, 2000; Smalla & Sobecky, 2002) and contribute to the dissemination of mobile genetic elements carrying antibiotic-resistance determinants. Several different multiresistance plasmids have been isolated from bacteria residing in the activated-sludge compartment and the final effluents of wastewater-treatment plants (Blàzquez et al., 1996; Dröge et al., 2000; Schlüter et al., 2003; Smalla & Sobecky, 2002; Tennstedt et al., 2003). Promiscuous broad-host-range plasmids belonging to the IncP-1 group represent the most abundant fraction of exogenously isolated plasmids from sewage plants (Dröge et al., 2000). Five different IncP-1 resistance plasmids originating from activated-sludge bacteria have so far been completely sequenced. These are the IncP-1β plasmids pB2 and pB3 (Heuer et al., 2004), pB4 (Tauch et al., 2003), and pB10 (Schlüter et al., 2003), which carry different mobile genetic elements with antibiotic-resistance determinants, and the IncP-1α plasmid pTB11, which is closely related to the prototype IncP-1α Birmingham plasmids (Tennstedt et al., 2005).

In another study, 10 antibiotic-resistance plasmids conferring high-level erythromycin resistance were isolated from activated-sludge bacteria by a transformation-based approach (Szczepanowski et al., 2004). One of these plasmids, pRSB101, was completely sequenced. It confers resistance to 12 antibiotics and possesses a replicon related to plasmids residing in phytopathogenic bacteria. In contrast to pRSB101, the replicon of pRSB107, which was isolated in parallel with pRSB101, could be typed as belonging to the IncF group. This plasmid confers resistance to 10 antimicrobial compounds and is about 120 kb in size. Due to the size of pRSB107, we expected that the plasmid, in addition to antibiotic-resistance determinants, would carry other accessory modules. Since many IncF plasmids are known to encode virulence factors we wondered whether pRSB107 also contains virulence-associated genes. To determine the genetic organization of the pRSB107 replicon and its accessory elements the complete nucleotide sequence of the plasmid was established. Detailed analysis of the sequence revealed new insights into conserved features and evolution of IncF plasmids and their accessory modules, including virulence-associated genes.

Bacterial strains, growth conditions and genetic techniques.
E. coli DH5α mcr (Grant et al., 1990), CSH61-HfrC (Miller, 1972), CV60 GFP (K. Smalla, Braunschweig, Germany), and S17-1 (Simon et al., 1983) containing the multiresistance plasmid pRSB107 were grown at 37 °C in Luria Broth (LB) medium supplemented as needed with antibiotics at the following final concentrations: 50 µg kanamycin ml1, 100 µg streptomycin ml1 or 5 µg tetracycline ml1. For solid media, 15 g agar per litre medium was added. Indicator medium for strains expressing an active β-galactosidase was supplemented with 40 µg X-Gal ml1 (final concentration).

To test the transfer properties of pRSB107, this plasmid was transferred into the mobilizer strain E. coli S17-1 and into the Hfr E. coli strain CSH61-HfrC and mated with the recipient E. coli CV60 GFP on cellulose acetate filters. Putative transconjugants were selected on LB medium containing 30 µg rifampicin ml1 and 5 µg tetracycline ml1.

To test whether pRSB107 enables utilization of dimethyl phosphate (DMP) as the sole phosphorus source, E. coli DH5α was transformed with the plasmid. To test the growth abilities of pRSB107-containing and plasmid-free E. coli DH5α cells with DMP as the sole phosphorus source, MOPS minimal medium (Neidhardt et al., 1974) supplemented with 0·4 % glucose, 1 µg thiamine ml1 and 0·1 M DMP (McLoughlin et al., 2004) was used. Prior to the growth test, the E. coli DH5α test strains were inoculated from LB agar plates into MOPS minimal medium (containing glucose and thiamine) without DMP to ensure only a minor contamination with a phosphorus source. After growth for 8 h the cells were inoculated into fresh MOPS minimal medium containing 0·1 M DMP, glucose and thiamine, and again incubated for approximately 12 h at 37 °C.

Standard DNA techniques.
Plasmid DNA from plasmid-containing E. coli strains was isolated with the Nucleobond Kit PC100 on AX 100 columns (Macherey-Nagel) in accordance with the manufacturer's protocol. Plasmid DNA for generation of a pRSB107 shotgun library was isolated with the Qiagen Large-Construct Kit according to the manufacturer's instructions. The plasmid content of E. coli transformants was determined by Eckhardt-gel analysis as described by Hynes et al. (1985). Restriction enzyme digestion, agarose gel electrophoresis and transformation of E. coli DH5α were carried out according to Sambrook et al. (1989).

Construction of shotgun libraries and DNA sequencing of pRSB107.
Isolated pRSB107 DNA was partially digested with the restriction endonuclease Sau3A. Restriction fragments varying in size from 1 to 3 kb were extracted from an agarose gel by using the Sephaglas BandPrep Kit (Amersham Pharmacia Biotech) according to the manufacturer's instructions, and cloned into the BamHI-digested vector pZErO-2 (Invitrogen). A second library was generated by hydro-shearing of pRSB107 plasmid DNA and subsequent cloning of the 1·32 kb fragment fraction into the vector pGEM-T (MWG, Ebersberg, Germany). Plasmid DNA was prepared from E. coli shotgun clones by automated alkaline lysis with the RoboPrep 2500 (MWG) and BioRobot 9600 (Qiagen). Sequencing reactions using dye-terminator chemistry were separated on a MegaBACE 1000 capillary sequencer (Amersham Biosciences) and an ABI 377 (Applera, Applied Biosystems) DNA sequencer.

Sequencing reads were assembled using the Staden (GAP4) software package (Staden, 1996). Gap closure and polishing of the sequence was achieved by primer walking with walking primers designed on contig nucleotide sequences. The final gap was closed by sequencing a PCR product generated with the primers cem_pcr1_for (TTGGAAATTAATGATAACAACGG) and cem_pcr1_rev (CAACGTTAACCGCAACAATTTT). These approaches resulted in a single, circular molecule with a total length of 120 592 bp.

DNA sequence analysis and annotation.
The finished pRSB107 sequence was annotated by using the GenDB (version 2.0) Annotation Tool (Meyer et al., 2003). Repeat regions within the pRSB107 sequence were identified and analysed by using the REPuter software (Kurtz et al., 2001). The annotated sequence of pRSB107 is available under EMBL accession number AJ851089.

pRSB107 possesses F-like replicons and is loaded with resistance transposons and modules encoding other accessory functions
Plasmid pRSB107 was isolated from activated-sludge bacteria by using a transformation-based approach (Szczepanowski et al., 2004). It confers resistance to the antimicrobial compounds ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin, penicillin G, streptomycin, sulfonamides, tetracycline and trimethoprim, and against inorganic mercury compounds. Hybridization analyses revealed that pRSB107 possesses an IncF-like replicon. Because of its broad resistance spectrum, pRSB107 was completely sequenced to determine the nature of the resistance genes and the modular structure of its backbone.

In a shotgun sequencing approach 2982 reads could be assembled into one contig, which was circularized by sequencing of an appropriate amplicon generated on pRSB107 DNA by PCR. The finished pRSB107 sequence is 120 592 bp in length and has a G+C content of 53·1 mol%. Annotation of the sequencing data by using the GenDB (version 2.0) tool (Meyer et al., 2003) revealed 135 coding regions. Twenty-eight genes encode replication, partitioning, multimer resolution, post-segregational killing, DNA-transfer/mobilization and DNA-modification functions. Fifteen genes are predicted to be involved in antibiotic, camphor, mercuric ion and copper resistance. Twenty-six genes have possible functions in transposition, DNA integration and site-specific recombination. Putative regulators are encoded by twelve genes. Seven putative iron-acquisition genes could be identified. Five genes are necessary for sn-glycerol-3-phosphate uptake and metabolism. Further three genes encode putative beneficial functions, and four genes are involved in transport-related functions. Hitherto unknown functions are encoded by thirty-five ORFs. Predicted functions for the pRSB107 genes are summarized in Table 1. The genetic map of the plasmid is shown in Fig. 1.


Table 1. Coding sequences (cds) of the multiresistance plasmid pRSB107 isolated from an unknown activated-sludge bacterium of a wastewater-treatment plant



(32K):

Fig. 1. Genetic map of the multiresistance plasmid pRSB107. Coding regions are indicated by arrows. The modular structure of the plasmid is shown on the outer circle: plasmid replicons RepFIA, RepFIB and RepFII (dark blue); the leading region (light green); a region encoding conjugative functions (magenta); the antibiotic-resistance transposon derivatives related to Tn21 and Tn10 (lilac); a putative high-affinity Fe2+-uptake system (orange); a putative sn-glycerol-3-phosphate uptake operon (dark green); an aerobactin-synthesis and receptor operon (light blue); and putative virulence-associated genes, vagCD (brown). Other genes with predicted functions are shown in grey. White arrows represent putative genes encoding unknown functions. The G+C plot is indicated on the inner circle, where a G+C content of >50 % is shown in red and a G+C content of <50 % is shown in blue. The G+C plot was generated using the GenDB (version 2.0) Tool (Meyer et al., 2003). Coding sequences were numbered clockwise from 1 to 135.

Two pRSB107 replicons are nearly identical to RepFIA and RepFIB of the F-plasmid
Plasmid pRSB107 possesses a replicon that is almost identical to the primary replication region RepFIA of the E. coli F-plasmid.

A 6497 bp pRSB107 segment containing the origins of vegetative replication oriV-1 and oriV-2, the genes ccdAB (post-segregational killing), resD (multimer resolution), repE (replication initiation), sopAB (active partitioning), the incompatibility iterons incC and the sopC-site (incD) is 99·9 % identical to the corresponding region of the F-plasmid (accession no. AP001918); see Fig. 2. The ccdAB operon encodes a post-segregation antitoxin (COG5302) and a protein toxin involved in killing of plasmid-free segregants (Engelberg-Kulka & Glaser, 1999). A second plasmid-stabilization system is specified by resD, located in the ccdABresD operon downstream of ccdB. The resD gene product is a site-specific recombinase (COG4973, XerC) for resolution of plasmid multimers containing the rfsF sequence needed for site-specific recombination (Lane et al., 1986). A third stable maintenance mechanism is established by the products of the sopAB operon. SopA is an ATPase (Pfam00991, ParA) which is believed to provide energy from ATP hydrolysis for active partitioning of plasmid replicates, whereas SopB has a ParB-like nuclease domain (Pfam02195, ParBc) and interacts with a centromere-like site, termed sopC (incD), downstream of sopAB (Gerdes et al., 2000). The sopC site of F is composed of twelve 43 bp direct repeats. The sopC site present on pRSB107 is 86 bp shorter than that on the F-plasmid: repeats 4 and 6 are truncated and repeat 5 is not present. The most important factor for plasmid replication is the replication-initiation protein encoded by repE. This protein binds to four 19 bp iterons (incB) located in oriV-2 upstream of repE and initiates replication in cooperation with host-encoded factors (Zzaman et al., 2004). Apart from the incB iterons, the oriV-2 of pRSB107 and F contains two tandem DnaA-binding motifs, an AT-rich region and a consensus 13-mer sequence which is melted during replication initiation (Kawasaki et al., 1996; Zzaman et al., 2004). A single-strand-initiation-sequence motif (ssiA) which is required for priming of plasmid replication (Nomura et al., 1991) is located in the vicinity of oriV-2. The incC iterons (five directly repeated sequences) which are conserved downstream of repE play a role in incompatibility and copy number control (Uga et al., 1999) (Fig. 2). The second RepFIA-specific origin, designated oriV-1, is completely identical on pRSB107 and F but the corresponding replication-initiation gene, repC, is missing on pRSB107.



(14K):

Fig. 2. The three replicons, RepFIA, RepFIB and RepFII, present on pRSB107. Genes for replication initiation (rep), multimere resolution (mrs), post-segregational killing (psk) and active plasmid partitioning (par) are differentiated by colour. The following regulatory DNA sequence motifs are marked: site-specific resolution site for resolution of plasmid dimers (rfsF site, brown), origins of vegetative replication (oriV, lilac), DnaA-binding boxes (DnaA, yellow), AT-rich region (A/T, dark green), local DNA-melting-site (13mer, grey), single-strand-initiation sequences (ssi, pink), iteron repeats (incB, incC, red; sopC/incD, light green; A-K, black), antisense RNA (inc, dark blue). Triangles indicate insertions of IS elements.

Another replicon which is homologous to RepFIB of the F-plasmid is located downstream of the pRSB107 aerobactin-synthesis operon. A 2261 bp region containing the replication-initiation gene repB flanked by iterons and the int gene for a site-specific recombinase is 99·7 % and 97·7 % identical to RepFIB of the E. coli plasmid p1658/97 (accession no. AF550679) and the F-plasmid, respectively. The repB gene product belongs to the Rep_3 family (Pfam01051) of initiator replication proteins and is predicted to possess topoisomerase I-like activity (Spiers et al., 1993). The repB gene is flanked by two sets of repeats (ABCD and EFGHIJK), which are believed to form part of the origin of replication (repeats BCD) and to sense and to set the plasmid copy number (repeats HIJ), respectively (Spiers et al., 1993). A single-strand-initiation-sequence motif (ssiF) and a DnaA box are present between repeats A and B. RepFIB is completed by the int gene, encoding a possible resolvase of the site-specific recombinase family XerC (COG0582, COG4973), which most probably constitutes a plasmid multimer resolution system and thus could be important for plasmid stability. Remnants of the insertion sequence IS21 terminate RepFIB 644 bp upstream of repB on pRSB107. IS21 is also inserted in the same target site on p1658/97. The RepFIB replicon has also been found on the E. coli IncF plasmids pRK100 (accession no. AY230888), pO157 (accession no. NC_002128) and pO103-3 (accession no. AF246719). Presence of more than one basic replicon has frequently been observed for IncF plasmids which carry the replicons RepFIA, RepFIB and RepFIC in various combinations (Bergquist et al., 1986).

The third pRSB107 replicon is closely related to RepFII
The pRSB107 region from coordinates 20901 to 27621 contains genes for replication initiation, control of replication and post-segregational killing (see Fig. 2), which are homologous to corresponding RepFII genes of different enterobacterial plasmids. RepFII is related to the RepFIC relict of the F-plasmid. The product of the replication-initiation gene repA1 is 97 % identical to RepA1 of the Shigella flexneri resistance plasmid R100 (accession no. NC_002134) whereas the inc RNA (93 bp) encoded upstream of repA1 and transcribed divergently shows the highest degree of similarity (89 %) to the inc RNA of the haemolytic E. coli plasmid pSU316 (accession no. M26937). The small antisense inc RNA functions in controlling RepA1 protein synthesis at the posttranscriptional level by forming a specific RNA duplex structure and it is assumed that differences in its nucleotide sequence give rise to different incompatibility properties (Ohtsubo et al., 1986). RepA2 (CopB) and RepA6, encoded upstream of repA1, are homologous to corresponding products of R100 and most probably play a role in negative and positive regulation, respectively, of repA1 expression (Womble et al., 1985). The origin of vegetative replication oriV and the repA4 locus, discussed to be important for stable maintenance, have been disconnected from repA1 by insertion of IS682 and show the highest degree of identity (97 %) to oriV-repA4 of the E. coli virulence plasmid pC15-1a (accession no. AY458016). A single-strand-initiation-sequence motif (ssiA) is located in the vicinity of repA4. The pRSB107 segment downstream of repA4 containing the tir gene for inhibition of RP4 transfer and the stable inheritance genes pemI and pemK is 100 % identical to the corresponding region of R100 (accession no. NC_002134). Tir possesses the Abi domain (Pfam02517) specific for a protease family. PemI and PemK belong to the growth-regulator family MazE (COG2336) and growth-inhibitor family PemK/MazF (Pfam02452, COG2337), respectively, and are predicted to represent the toxin and antitoxin of a post-segregational killing system (Engelberg-Kulka & Glaser, 1999). The pRSB107 RepFII replicon is terminated by an IS1 insertion downstream of pemK.

RepFII basic replicons were previously found to be present on the virulence plasmids pWR100 (accession no. AL391753), pWR501 (accession no. NC_002698), pINV (accession no. AY206448) and pCP301 (accession no. NC_004851) of Shigella flexneri, pKDSC50 (accession no. NC_002638) of Salmonella enterica serovar Choleraesuis, pO157 (accession no. NC_002128) of the enterohaemorrhagic Escherichia coli strain O157 : H7 and on the adherence-factor plasmid pB171 (accession no. NC_002142) of an enteropathogenic E. coli strain.

Remnants of a conjugative transfer module are located upstream of RepFII on pRSB107
pRSB107 contains a relict of the conjugative-transfer module, composed of a truncated DNA-helicase/nickase gene traI, the F-pilin acetylation gene traX and the fertility inhibition gene finO. The pRSB107 traI gene starts with an ATG start codon preceded by a putative ribosome-binding site and its deduced gene product has a length of 1209 aa as compared to 1756 aa for TraI of the F-plasmid (accession no. BAA97974. Currently it is unknown whether the truncated version of TraI retains residual activity. Attempts to transfer pRSB107 to an E. coli recipient strain via conjugation were not successful, which is consistent with the absence of a complete tra module on pRSB107. Deleted conjugative transfer modules containing traI-specific sequences, traX and finO were also found on the virulence plasmids pWR100, pWR501, pINV, pCP301, pO157 and pKDSC50. For pWR101 it has been shown that it can be mobilized in the presence of conjugative helper plasmids (Sansonetti et al., 1982).

To test transferability of pRSB107, the plasmid was introduced into the E. coli strains S17-1 and CSH61-HfrC. Plasmid-containing derivatives of these strains were subsequently mated with E. coli CV60 GFP as recipient. No transconjugants were obtained in mating experiments with E. coli S17-1, indicating that the RP4 plasmid integrated in the chromosome of strain S17-1 was not able to mobilize pRSB107. Thirty-one green fluorescent putative transconjugants were obtained in mating experiments with E. coli CSH61-HfrC(pRSB107) as donor strain and E. coli CV60 GFP as recipient. Eckhardt-gel analysis revealed that all transconjugants contained a plasmid which was larger than the native pRSB107. Two of these transconjugants were chosen for plasmid isolation and subsequent restriction analyses. These two plasmids displayed very similar restriction patterns to the pRSB107-profile, but contained additional restriction fragments. Most probably, the two investigated plasmids acquired DNA segments from the chromosomally integrated F-plasmid via homologous recombination. This hypothesis is supported by the fact that no nucleotide sequences with homology to the F origin of transfer (oriT) could be identified on pRSB107, which means that pRSB107 should not be mobilizable. Therefore, we speculate that oriT was acquired from the integrated F-plasmid, which would modify pRSB107 to become mobilizable.

The pRSB107 traI gene is preceded by the coding sequences ydcA', ydbA and ydaB, which are also present upstream of yddA on plasmid R100 (accession no. NC_002134). The function of these three genes remains unknown. The intervening segment containing other tra genes obviously was deleted in pRSB107.

The pRSB107 region downstream of RepFIA is closely related to the F-plasmid leading segment
The pRSB107 segment downstream of RepFIA is very similar (94 % identity at the nucleotide sequence level) to the distal part of the F-plasmid leading region, which is defined as the first portion of F-DNA to enter the recipient cell during conjugative transfer. The leading region on pRSB107 contains nine coding sequences, seven of which are homologous to F-plasmid orf227, -73, -144, -248, -141, -140 and -63 (Manwaring et al., 1999). In contrast to the F-plasmid, orf168 and orf145 are fused to orf7 on pRSB107. The deduced product of orf8 downstream of orf7 is 96 % identical to YcdA of the Shigella sonnei plasmid ColIb-P9 (accession no. NC_002122) and does not correspond to orf101, which is present downstream of orf145 on F. Functional predictions can only be made for two coding sequences, namely orf9, which encodes a putative cytosine-specific or N-6 adenine-specific DNA methylase (Pfam01555, COG0863) possibly involved in protection of the transferred DNA from restriction endonucleases (Manwaring et al., 1999; Venkatesan et al., 2001), and orf13 for a putative antirestriction protein (Pfam03230), (Belogurov et al., 1993). The region containing the origin of transfer (oriT) is deleted on pRSB107.

A Tn21 derivative integrating eight resistance determinants represents the core element of the pRSB107 antibiotic-resistance region
Downstream of the pRSB107 RepFII replicon a Tn21 derivative has inserted. Tn21 is followed by a chloramphenicol-resistance module and a derivative of the tetracycline-resistance transposon Tn10.

The 27 212 bp Tn21 transposon is terminated by 38 bp inverted repeats (IR) and has caused a 5 bp target-site duplication (direct repeats: TATTA). The mercury-resistance (mer) and the transposition genes (tnpM-tnpR-tnpA) on pRSB107 Tn21 are identical to corresponding genes on Tn21 of plasmid R100 (accession no. AP000342), but in contrast to the latter, pRSB107 Tn21 integrates the following accessory elements (see Fig. 3): (i) a composite kanamycin/neomycin-resistance transposon flanked by IS26 elements; (ii) a streptomycin/sulfonamide-resistance region with associated replication genes terminated by IS26; (iii) a Tn1 relict carrying a β-lactamase-resistance gene; (iv) a macrolide-resistance operon flanked by IS26 and IS6100; and (v) a Tn402 relict integrating a class 1 integron.



(36K):

Fig. 3. Comparison of the genetic organization of the pRSB107 Tn21-derivative and related transposons present on plasmids R100, pRMH760 and pHCM1 or on the Shigella flexneri chromosome. The Tn21 derivative located on pRSB107 shares homology with modules present either on related plasmid-borne Tn21-derivatives, or on TnSF1 of S. flexneri. Coding sequences are shown as arrows, indicating the direction of transcription. Boxes represent truncated genes. Modules sharing sequence homology are in the same colour. The following modules are differentiated by colour: mercury resistance (mer) and transposition genes (tnpMRA), lilac; Tn402 class 1 integron specific genes, red; IS1353, green; IS1326, yellow; Tn1 transposon, light blue; Tn4352B transposon, dark blue; IS513, brown; repAC-sulII-strAB module present on plasmids pHCM1 and pRSB107 as well as on plasmid RSF1010, blue; IS4321, light yellow; mobilization gene, grey. Inverted repeats (IR, rectangles) have the same colour as the mobile element to which they belong. The target-site duplications (DR, circles) caused by a transposition event are shown in the same colour as the mobile element. The different DNA sequences were taken from the GenBank database: R100-Tn21 (accession no. NC_002134), pRMH760-Tn21 (accession no. AY123253), pHCM1-Tn21 (accession no. AL513383), TnSF1 (accession no. AF188331).

The pRSB107 Tn21 mercury-resistance (mer) region encodes proteins responsible for binding of divalent Hg2+ ions in the periplasm (periplasmic protein MerP), the transfer of Hg2+ into the cytoplasm (inner-membrane proteins MerT and MerC) and reduction of Hg2+ to Hg0, which diffuses from the cell (cytoplasmic flavin disulfide oxidoreductase MerA). MerR and MerD are responsible for transcriptional regulation of the merTPCAD operon. The function of the merE-encoded protein (Pfam05052) is still unknown (Liebert et al., 1999). The urf2 gene product possesses an EAL domain (Pfam00563) that could participate in metal binding.

The composite kanamycin/neomycin-resistance transposon Tn4352B (IS26-aph-IS26) which truncated the Tn402-specific transposase gene tniA on pRSB107 has also been found on the transposon TnSF1 of Shigella flexneri (accession no. AF188331), the multiresistance β-lactamase transposon Tn1412 (accession no. L36547) of Pseudomonas aeruginosa, the resistance plasmid NTP16 (accession no. M20306) and the plasmid pRMH760 (accession no. AY123253) isolated from Klebsiella pneumoniae. Tn4352B on pRMH760 and pRSB107 both inserted into exactly the same target site, thus truncating tniA. Since Tn4352B on pRSB107 only shares its left-hand-side target-site duplication (direct repeat: CGCCGATG) with Tn4352B of pRMH760 (Partridge & Hall, 2003) we assume that the downstream module consisting of strAB, sulII and 'repAC entered pRSB107 by homologous recombination via IS26 copies, thus removing the original right-hand-side direct repeat. It is noteworthy that the latter module is also terminated by an IS26 insertion. The incoming IS26-'repAC-sulII-strAB-IS26 module might originate from a plasmid similar to pHCM1 of Salmonella enterica subsp. enterica serovar Typhi strain CT18 (Wain et al., 2003), since its corresponding module is almost identical (99·9 %) to the one on pRSB107. The genes strA and strB encoding the streptomycin-resistance proteins A and B are preceded by sulII for a dihydropteroate synthetase conferring sulfonamide resistance. The replication gene repC and the 3' part of repA are located upstream of sulII. These genes were originally found on the IncQ plasmid RSF1010 and normally constitute the replication operon repAC (Scherzinger et al., 1991). Since the RSF1010-specific oriV and the 5' part of repA are missing on pRSB107 it is very unlikely that this replication region is functional.

The next module on pRSB107 is a remnant of Tn1 consisting of blaTEM-1b for a class A β-lactamase and part of the Tn1-specific resolvase gene tnpR. This module is also present in an equivalent position on pHCM1.

The Tn1 tnpR gene was truncated and tnpA most probably was deleted by insertion of IS26, which borders the macrolide-resistance operon mph(A)-mrx-mphR(A) at the left-hand-side. A copy of IS6100 is located downstream of mphR(A). The macrolide-resistance operon encodes a macrolide-2'-phosphotransferase I (MphA), a hydrophobic protein of unknown function (Mrx) and a negative transcriptional regulator (MphR), and mediates high-level erythromycin resistance. Nearly identical erythromycin-resistance regions were previously identified on TnSF1 of Shigella flexneri (accession no. AF188331) and on the multiresistance plasmid pRSB101 from a wastewater-treatment plant (Szczepanowski et al., 2004). The macrolide-resistance module is separated from a class 1 integron by an intervening mobC-like sequence that encodes a putative mobilization protein of the relaxase group (Pfam05713).

The class 1 integron upstream of mobC is composed of the integron-specific integrase gene intI1 and the resistance gene cassette dhfR for a dihydrofolate reductase conferring trimethoprim resistance. Tn21 of pRSB107 is terminated by the Tn21-specific transposition module (tnpM-tnpR-tnpA) responsible for transposition of this transposon. Class 1 integrons have frequently been found downstream of Tn21 transposition modules, for example on R100, pRMH760 and on the transposon TnSF1 (see Fig. 3).

A chloramphenicol-resistance module and the tetracycline-resistance transposon Tn10 complete the pRSB107 resistance region
A chloramphenicol-resistance module and a derivative of the tetracycline-resistance transposon Tn10 are located next to the pRSB107 Tn21 insertion.

Tn21 on pRSB107 is followed by ybjA, encoding a putative acetyltransferase (Pfam00583), the chloramphenicol-resistance gene catA for a chloramphenicol acetyltransferase (COG4845, Pfam00302) and a copy of IS1. Identical segments are also present on R100 (Womble & Rownd, 1988), pRMH760 (accession no. AY123253) and pHCM1 (Wain et al., 2003).

Finally, pRSB107 carries a truncated derivative of the tetracycline-resistance transposon Tn10 which inserted next to the chloramphenicol-resistance module. Tn10 normally consists of IS10-L, jemA, jemB, jemC, tetR, tetA, tetC, tetD and IS10-R (Chalmers et al., 2000). IS10-L, jemA and the 5' part of jemB were deleted in the case of pRSB107 Tn10. This deletion most probably occurred during insertion of the chloramphenicol-resistance module which is bordered by IS1 upstream of catA. The persisting Tn10 genes encode JemC, a putative repressor of heavy-metal-resistance operons (Pfam01022, COG0640), the tetracycline repressor protein TetR, the tetracycline antiporter protein TetA, the tetracycline transcriptional regulator TetC of the AcrR family (COG1396), and TetD, a protein with a signature similar to AraC-type DNA-binding-domain-containing proteins (COG2207) which probably plays a role in transcriptional regulation. Another copy of IS1 disrupted the IS10-R transposase gene tnpA. Collinearity between a chloramphenicol-resistance module and a truncated Tn10 derivative has also been observed in a pathogenicity island of Shigella flexneri 2a (Luck et al., 2001). The S. flexneri region is 99·6 % identical to the corresponding region on pRSB107.

In summary, the pRSB107 antibiotic-resistance region shows a highly mosaic structure consisting of resistance determinants carried by functional or nested transposable elements. It is also noticeable that several IS elements (four copies of IS26, IS6100 and three copies of IS1) frame resistance determinants. This observation leads to the assumption that IS elements played an important role in the development and assembly of the pRSB107 resistance region.

pRSB107 encodes an aerobactin-synthesis operon and a second putative iron-acquisition system
An aerobactin-synthesis operon is located downstream of RepFIB on pRSB107. An 8101 bp DNA fragment, containing the genes iucA, iucB, iucC, iucD and iutA, shows 99·6 % identity to a corresponding sequence on plasmid pTJ100 of the avian pathogenic E. coli strain A2363 (accession no. AY553855). The iuc (iron uptake chelate) genes encode enzymes necessary for synthesis of the siderophore aerobactin, whereas the iutA (iron uptake transport) gene product represents the TonB-dependent outer-membrane receptor for ferric aerobactin. The first step in aerobactin synthesis is hydroxylation of L-lysine by IucD, whereas IucB is responsible for acetylation of N-hydroxylysine. Two N-acetyl-N-hydroxylysine molecules are then attached to the carboxylic groups of citric acid by IucC and probably IucA, resulting in aerobactin (de Lorenzo & Neilands, 1986; de Lorenzo et al., 1986). The pRSB107 aerobactin operon most probably is regulated by Fur (ferric uptake regulator), since a putative Fur box (GATAATGAGAATCATTATT) is located upstream of iucA. IS1 elements could have played a role in the integration of the aerobactin synthesis operon into pRSB107, since the iuc/iut region is framed by IS1 copies.

As mentioned above, two lysine molecules are needed for aerobactin synthesis. Lysine synthesis is feedback-controlled by lysine, which inhibits two enzymes involved in this pathway, namely dihydrodipicolinate synthase and aspartokinase (Mirwaldt et al., 1995). Interestingly, orf101 on pRSB107 encodes a putative dihydrodipicolinate synthase (COG0329, Pfam00701) which is, respectively, 32 % (46 % similarity) and 28 % (44 % similarity) identical to corresponding gene products from Salmonella typhimurium LT2 (accession no. NP_462433) and E. coli K-12 (accession no. NP_418718). It might be speculated that higher amounts of dihydrodipicolinate synthase allow for sufficient production of aerobactin for efficient iron acquisition in addition to the demand for lysine itself.

Importance of the iuc/iut region for pathogenesis could be shown for Shigella flexneri 2a strain 2457T, where aerobactin synthesis plays a role in shigellosis (Wei et al., 2003). The iucABCD-iutA cluster has recently been found on the 219 kb virulence plasmid pLVPK harboured in a bacteraemic isolate of Klebsiella pneumoniae (Chen et al., 2004). Curing of pLVPK resulted in a decrease of virulence, but currently it is unknown whether this phenotype is due to the absence of aerobactin synthesis.

The gene shiF upstream of iucA has also been found to be conserved upstream of the aerobactin iron-acquisition siderophore system encoded in the S. flexneri pathogenicity island SHI-2 (Shigella island 2) (Moss et al., 1999). The two genes share 92 % sequence identity. ShiF is a putative integral membrane protein containing 12 putative transmembrane helices and a membrane lipoprotein lipid attachment site, and shares weak similarity with proteins of the tetracycline-resistance transporter family (Moss et al., 1999). The function of ShiF is currently unknown. Homology between pRSB107 and SHI-2 ends 9 bp downstream of shiF. The pRSB107 segment downstream of shiF is nearly identical (99·7 %) to a locus on plasmid pAPEC-1 of an avian pathogenic E. coli strain and contains the genes crcB and orf122. CrcB is a putative integral membrane protein possibly involved in chromosome condensation and camphor resistance (Pfam02537, COG0239), (Hu et al., 1996). Orf122 possesses the C-terminal part of an enolase-specific domain '(Pfam00113,COG0148). Interestingly, part of the orf122 sequence has been found to be specific for a novel virulence-associated locus in uropathogenic E. coli (SSH fragment SPL00265 (Sorsa et al., 2004).

Another gene region that encodes putative iron-acquisition genes is located next to the Tn10 insertion on pRSB107. On the other side, this region is flanked by a copy of IS26 (IS26-5, see Fig. 1). The gene product of orf82 is a putative high-affinity Fe2+/Pb2+ permease. In addition to eight probable transmembrane helices Orf82 includes the FTR1 domain (COG0672, Pfam03239) of the yeast FTR1 gene which has been shown to mediate high-affinity iron uptake (Stearman et al., 1996). Further, a conserved domain, similar to that of mammalian ferritin (REGAE) (Levi et al., 1994; Stearman et al., 1996), could be identified within the amino acid sequence of Orf82. The glycine residue of the REGAE motif is thought to interact with iron. Orf83 possesses the Tpd domain (COG3470), which is present on uncharacterized periplasmic proteins, probably involved in high-affinity Fe2+ transport. The genes downstream of orf83 encode a putative integral membrane protein with eight probable transmembrane helices (Orf84, COG4393, Pfam04945), two ABC-type inner-membrane permeases with four putative transmembrane helices each (Orf85, Orf86, COG4591, COG0577), an ABC-transporter ATP-binding protein (Orf87, COG1136) and a peroxiredoxin (Orf88, COG1225). Currently it is unknown whether these latter gene products also play a role in the context of iron uptake. The orf82orf88 region most probably is organized in two operons, since putative promoter sequences could be identified upstream of orf82 and orf84. Gene regions homologous to orf82orf88 were previously identified in a 102 kb pathogenicity island of the human pathogen Yersinia pestis (accession no. AL031866) and in the genome of the enterobacterial phytopathogen Erwinia carotovora subsp. atroseptica (accession no. NC_004547). A comparison of the genetic organization of the corresponding gene regions is shown in Fig. 4. Strikingly, certain segments of the orf82orf88 region were also found to be specific for, respectively, neonatal meningitis-associated and uropathogenic Escherichia coli strains (Bonacorsi et al., 2000; Zhang et al., 2000). In detail, clones SauE15.B10, SauE4.A2 and SauE4.C10 from neonatal meningitis-associated E. coli and P5 from uropathogenic E. coli are identical or almost identical to corresponding sequences of the pRSB107 orf82orf88 region. These observations led to the assumption that the pRSB107-encoded iron-acquisition systems could enhance virulence of pathogenic bacteria harbouring pRSB107. Many studies have demonstrated the important role of iron in virulence. Pathogens have to compete for iron supply with cells of the host organism. For example, Shigella flexneri strains that could not produce functional aerobactin, were less infectious than the wild-type strain (Lawlor et al., 1987; Nassif et al., 1987). Likewise, derivatives of Pseudomonas aeruginosa PAO1 deficient in the production of the siderophores pyoverdin and pyochelin, resulting in decreased iron supply, did not show lethal virulence in mice, as the wild-type strain does (Takase et al., 2000).



(20K):

Fig. 4. Genetic organization of the putative high-affinity Fe2+-uptake system present on pRSB107 and comparison with related chromosomal gene regions of Erwinia carotovora subsp. atroseptica SCRI1043 and Yersinia pestis. The arrows indicate coding sequences and the direction of their transcription. Homologous genes are shown in the same colour. Predicted functions of gene products are given above the coding sequences. Identities and similarities (in %) between corresponding pRSB107 and Erwinia carotovora subsp. atroseptica SCGI1043 or Yersinia pestis gene products are shown below the coding sequences. The DNA sequences were taken from the GenBank database: Erwinia carotovora subsp. atroseptica SCGI1043 (accession no. NC_004547), Yersinia pestis (accession no. AL031866).

A putative virulence-associated gene region is located upstream of RepFIA
Two copies of the virulence-associated genes vagCD were found in a pRSB107 region upstream of the aerobactin-synthesis operon iuc/iut. The two copies of vagCD are separated by an intervening sequence encoding orf129.

The pRSB107 vagCD copies are 90 % identical to each other at the DNA-sequence level. Orthologues of these genes were previously identified on plasmid R64 of Salmonella typhimurium (accession no. NC_005014), the virulence plasmid pLVPK of Klebsiella pneumoniae strain CG43 (Chen et al., 2004) and a virulence plasmid of Salmonella enterica subsp. enterica serovar Dublin (Pullinger & Lax, 1992). For the latter plasmid it has been shown that a mutation in vagC leads to reduced virulence. It was suggested that the VagCD proteins play a role in coordination of plasmid replication and cell division, thus ensuring plasmid maintenance. VagC contains the SpoVT/AbrB-like domain (Pfam04014). One member of this protein family, namely AbrB, controls gene expression during the transition between vegetative growth and the onset of stationary phase. Growth-phase-dependent activity of VagC would be in accordance with a role in delaying cell division until plasmid replication has been completed. Results obtained by Pullinger & Lax (1992) indicated that VagC modulates the activity of vagD, the product of which is a predicted nucleic-acid-binding protein containing a PIN (PilT N-terminus) domain (COG1487). The function of the PIN domain is unknown but a role in signalling is discussed.

The ugp operon of pRSB107 encodes an sn-glycerol-3-phosphate uptake system
A predicted sn-glycerol-3-phosphate uptake system (ugp: uptake of sn-glycerol-3-phosphate) is encoded from coordinates 78 420 to 83 475 on pRSB107. The 5372 bp ugp operon shows 90 % identity to the corresponding operon in the genome of Enterobacter aerogenes (accession no. AY243367) and contains the genes ugpA, ugpE, phe, ugpC and ugpB. The products of ugpA, ugpB, ugpC and ugpE are responsible for uptake of sn-glycerol-3-phosphate whereas the phe product allows for growth on dimethyl phosphate (DMP) as the sole phosphorus source (McLoughlin et al., 2004). The four Ugp proteins constitute an ABC-type transporter including two permease components (UgpA and UgpE, COG0395), an ATPase component (UgpC, COG3839, Pfam00005) and a periplasmic substrate-binding protein (UgpB, COG1653). The Phe protein belongs to the family of phosphodiesterases (Pfam00149) and is responsible for the hydrolysis of DMP (McLoughlin et al., 2004). The sequence motif DXH(X)nGDXXD(X)nGNHD/E, which is specific for the large group of phosphoesterases (e.g. Ser/Thr protein phosphatases and purple acid phosphatases, PAP) is also present within Phe encoded on pRSB107 (Koonin, 1994). Presence of a putative Pho box (GCTTCATCAAACCATCGT) upstream of the ugp operon indicates that the operon is controlled by the transcriptional regulator PhoB.

To test the ability of E. coli DH5α harbouring pRSB107 to utilize DMP as the sole phosphorus source, plasmid-containing and plasmid-free cells were grown in MOPS minimal medium with 0·1 M DMP. In addition, MOPS minimal medium without DMP was used to ensure that E. coli DH5α cells with and without pRSB107 are not able to grow under phosphorus starvation. The results showed that E. coli cells containing pRSB107 were able to utilize DMP as the sole phosphorus source, whereas plasmid-free cells could not grow under these conditions.

The gene kdgT, which also has a function in hexose metabolism, is located 2299 bp upstream of ugpA. The encoded 2-keto-3-deoxygluconate permease (Pfam03812) is 62 % identical to KdgT of Erwinia chrysanthemi (accession no. P15701) and to KdgT encoded by the uropathogenic E. coli strain CFT073 (accession no. NP_756715). The KdgT permease transports 2-keto-3-deoxygluconate into the cell, which then can be degraded to pyruvate and 3-phosphoglyceraldehyde. Oxidation of the latter metabolite yields ATP, NADH2 and pyruvate.

The pRSB107 accessory modules are flanked by different IS elements
The pRSB107 accessory modules Tn21, Tn10, the putative high-affinity Fe2+-uptake locus, the sn-glycerol-3-phosphate uptake system (ugp) and the aerobactin-synthesis operon (iut/iuc) are framed by insertion sequence (IS) elements. The two transposons are flanked and separated from each other by three IS1 copies (IS1-1, IS1-2 and IS1-3). The high-affinity Fe2+-uptake locus is bordered by a relict of IS26 and an intact copy of IS26 whereas the ugp region is terminated by remnants of IS629 downstream of ugpB. Finally, the iut/iuc operon is bounded by two IS1 copies (IS1-4 and IS1-5). In addition, the resistance determinants integrated in Tn21 are also framed by IS elements. Four copies of IS26 and one copy of IS6100 are located within Tn21. IS-specific sequences account for approximately 13 300 bp (11 % of the total plasmid size). Some accessory modules on pRSB107 represent composite transposons, although they did not enter the plasmid by transposition since corresponding target-site duplications (direct repeats, DR) could not be found next to the terminal inverted repeats of the IS elements. It is assumed that different horizontally acquired DNA modules were assembled during plasmid evolution by using IS elements as homologous DNA segments for recombination. Only Tn21 clearly entered the plasmid by transposition. Consequently pRSB107 can be considered as a mosaic of different modules derived from different sources, including other resistance and virulence plasmids.

Concluding remarks
The IncF plasmid pRSB107 confers antibiotic and mercury resistance and other beneficial properties upon its host bacterium. IncF plasmids, in general, are known to encode antibiotic-resistance determinants, haemolysins, toxins, invasins and colicins (Burland et al., 1998; Gibbs et al., 1993; Venkatesan et al., 2001; Womble & Rownd, 1988) and are widespread in the family Enterobacteriaceae. Therefore it is very likely that the original host for pRSB107 also is an enterobacterium. Plasmid pRSB107 exhibits a mosaic structure consisting of modules which were previously identified on resistance and/or possible virulence plasmids and in the chromosomes of human and plant pathogens. In detail, the multiresistance Tn21 transposon on pRSB107 derives from other Tn21 elements present on different resistance or virulence-associated plasmids. The putative high-affinity iron-acquisition system and the sn-glycerol-3-phosphate uptake operon were recently identified in the genomes of Yersinia pestis and Enterobacter aerogenes, respectively. The pRSB107 iuc/iut gene region responsible for siderophore-dependent iron uptake has also been found on virulence plasmids and on the chromosomes of pathogenic bacteria. Taking these observations together it has to be concluded that pRSB107 is a chimera of antibiotic-resistance and virulence-associated plasmids which acquired its accessory modules horizontally from different sources. Wastewater-treatment plants have previously been shown to be a reservoir for antibiotic-resistance plasmids and here we provide evidence that these facilities also harbour bacteria carrying virulence-associated plasmids. It seems likely that exchange of genetic material between resistance plasmids and virulence plasmids occurs in sewage bacteria. Newly recombined plasmids promoting resistance and virulence can then be released with the sewage treatment plant's final effluents and disseminated among bacteria in the wider environment. Transfer of these plasmids to human pathogens could clearly be of relevance for public health.

We thank the Bioinformatics Resource Facility (BRF) at the Centre of Biotechnology (CeBiTec, Bielefeld) for their support regarding bioinformatics, and especially for their help with the annotation tool GenDB. This work was supported by a grant from the Bundesministerium für Bildung und Forschung (BMBF), Förderkennzeichen: 0312384.

References

Bateman, A., Coin, L., Durbin, R. & 10 other authors (2004). The Pfam protein families database. Nucleic Acids Res 32 (Database issue), D138D141.[Abstract/Free Full Text]

Belogurov, A. A., Delver, E. P. & Rodzevich, O. V. (1993). Plasmid pKM101 encodes two nonhomologous antirestriction proteins (ArdA and ArdB) whose expression is controlled by homologous regulatory sequences. J Bacteriol 175, 48434850.[Abstract/Free Full Text]

Bergquist, P. L., Saadi, S. & Maas, W. K. (1986). Distribution of basic replicons having homology with RepFIA, RepFIB, and RepFIC among IncF group plasmids. Plasmid 15, 1934.[CrossRef][Medline]

Blàzquez, J., Navas, A., Gonzalo, P., Martinez, J. L. & Baquero, F. (1996). Spread and evolution of natural plasmids harboring transposon Tn5. FEMS Microbiol Ecol 19, 6371.

Bonacorsi, S. P., Clermont, O., Tinsley, C., Le Gall, I., Beaudoin, J. C., Elion, J., Nassif, X. & Bingen, E. (2000). Identification of regions of the Escherichia coli chromosome specific for neonatal meningitis-associated strains. Infect Immun 68, 20962101.[Abstract/Free Full Text]

Boyd, E. F., Hill, C. W., Rich, S. M. & Hartl, D. L. (1996). Mosaic structure of plasmids from natural populations of Escherichia coli. Genetics 143, 10911100.[Abstract]

Burlage, R. S., Bemis, L. A., Layton, A. C., Sayler, G. S. & Larimer, F. (1990). Comparative genetic organization of incompatibility group P degradative plasmids. J Bacteriol 172, 68186825.[Abstract/Free Full Text]

Burland, V., Shao, Y., Perna, N. T., Plunkett, G., Sofia, H. J. & Blattner, F. R. (1998). The complete DNA sequence and analysis of the large virulence plasmid of Escherichia coli O157 : H7. Nucleic Acids Res 26, 41964204.[Abstract/Free Full Text]

Cavalli, L. L., Lederberg, J. & Lederberg, E. M. (1953). An infective factor controlling sex compatibility in Bacterium coli. J Gen Microbiol 8, 89103.[Medline]

Chalmers, R., Sewitz, S., Lipkow, K. & Crellin, P. (2000). Complete nucleotide sequence of Tn10. J Bacteriol 182, 29702972.[Abstract/Free Full Text]

Chen, Y. T., Chang, H. Y., Lai, Y. C., Pan, C. C., Tsai, S. F. & Peng, H. L. (2004). Sequencing and analysis of the large virulence plasmid pLVPK of Klebsiella pneumoniae CG43. Gene 337, 189198.[CrossRef][Medline]

Davies, J. (1994). Inactivation of antibiotics and the dissemination of resistance genes. Science 264, 375382.[Abstract/Free Full Text]

Davison, J. (1999). Genetic exchange between bacteria in the environment. Plasmid 42, 7391.[CrossRef][Medline]

de Lorenzo, V. & Neilands, J. B. (1986). Characterization of iucA and iucC genes of the aerobactin system of plasmid ColV-K30 in Escherichia coli. J Bacteriol 167, 350355.[Abstract/Free Full Text]

de Lorenzo, V., Bindereif, A., Paw, B. H. & Neilands, J. B. (1986). Aerobactin biosynthesis and transport genes of plasmid ColV-K30 in Escherichia coli K-12. J Bacteriol 165, 570578.[Abstract/Free Full Text]

Di Lorenzo, M., Stork, M., Tolmasky, M. E. & 9 other authors (2003). Complete sequence of virulence plasmid pJM1 from the marine fish pathogen Vibrio anguillarum strain 775. J Bacteriol 185, 58225830.[Abstract/Free Full Text]

Dröge, M., Pühler, A. & Selbitschka, W. (1998). Horizontal gene transfer as a biosafety issue: a natural phenomenon of public concern. J Biotechnol 64, 7590.[CrossRef][Medline]

Dröge, M., Pühler, A. & Selbitschka, W. (2000). Phenotypic and molecular characterization of conjugative antibiotic resistance plasmids isolated from bacterial communities of activated sludge. Mol Gen Genet 263, 471482.[CrossRef][Medline]

Engelberg-Kulka, H. & Glaser, G. (1999). Addiction modules and programmed cell death and antideath in bacterial cultures. Annu Rev Microbiol 53, 4370.[CrossRef][Medline]

Gerdes, K., Moller-Jensen, J. & Bugge Jensen, R. (2000). Plasmid and chromosome partitioning: surprises from phylogeny. Mol Microbiol 37, 455466.[CrossRef][Medline]

Gibbs, M. D., Spiers, A. J. & Bergquist, P. L. (1993). RepFIB: a basic replicon of large plasmids. Plasmid 29, 165179.[CrossRef][Medline]

Grant, S. G., Jessee, J., Bloom, F. R. & Hanahan, D. (1990). Differential plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-restriction mutants. Proc Natl Acad Sci U S A 87, 46454649.[Abstract/Free Full Text]

Herrero, M., de Lorenzo, V. & Neilands, J. B. (1988). Nucleotide sequence of the iucD gene of the pColV-K30 aerobactin operon and topology of its product studied with phoA and lacZ gene fusions. J Bacteriol 170, 5664.[Abstract/Free Full Text]

Heuer, H., Szczepanowski, R., Schneiker, S., Pühler, A., Top, E. M. & Schlüter, A. (2004). The complete sequences of plasmids pB2 and pB3 provide evidence for a recent ancestor of the IncP-1β group without any accessory genes. Microbiology 150, 35913599.[Abstract/Free Full Text]

Hu, K. H., Liu, E., Dean, K., Gingras, M., DeGraff, W. & Trun, N. J. (1996). Overproduction of three genes leads to camphor resistance and chromosome condensation in Escherichia coli. Genetics 143, 15211532.[Abstract]

Hynes, M. F., Simon, R. & Pühler, A. (1985). The development of plasmid-free strains of Agrobacterium tumefaciens by using incompatibility with a Rhizobium meliloti plasmid to eliminate Patc58. Plasmid 13, 99105.[CrossRef][Medline]

Kawasaki, Y., Matsunaga, F., Kano, Y., Yura, T. & Wada, C. (1996). The localized melting of mini-F origin by the combined action of the mini-F initiator protein (RepE) and HU and DnaA of Escherichia coli. Mol Gen Genet 253, 4249.[CrossRef][Medline]

Koonin, E. V. (1994). Conserved sequence pattern in a wide variety of phosphoesterases. Protein Sci 3, 356358.[Abstract]

Kurtz, S., Choudhuri, J. V., Ohlebusch, E., Schleiermacher, C., Stoye, J. & Giegerich, R. (2001). REPuter: the manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res 29, 46334642.[Abstract/Free Full Text]

Lane, D., de Feyter, R., Kennedy, M., Phua, S. H. & Semon, D. (1986). D protein of miniF plasmid acts as a repressor of transcription and as a site-specific resolvase. Nucleic Acids Res 14, 97139728.

Lawley, T. D., Klimke, W. A., Gubbins, M. J. & Frost, L. S. (2003). F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett 224, 115.[CrossRef][Medline]

Lawlor, K. M., Daskaleros, P. A., Robinson, R. E. & Payne, S. M. (1987). Virulence of iron transport mutants of Shigella flexneri and utilization of host iron compounds. Infect Immun 55, 594599.[Abstract/Free Full Text]

Levi, S., Santambrogio, P., Cozzi, A., Rovida, E., Corsi, B., Tamborini, E., Spada, S., Albertini, A. & Arosio, P. (1994). The role of the L-chain in ferritin iron incorporation. Studies of homo and heteropolymers. J Mol Biol 238, 649654.[CrossRef][Medline]

Liebert, C. A., Hall, R. M. & Summers, A. O. (1999). Transposon Tn21, flagship of the floating genome. Microbiol Mol Biol Rev 63, 507522.[Abstract/Free Full Text]

Luck, S. N., Turner, S. A., Rajakumar, K., Sakellaris, H. & Adler, B. (2001). Ferric dicitrate transport system (Fec) of Shigella flexneri 2a YSH6000 is encoded on a novel pathogenicity island carrying multiple antibiotic resistance genes. Infect Immun 69, 60126021.