Abstract
Abbreviations: AD, activation domain; A-motility, adventurous motility; BD, binding domain; CW, Calcofluor White; EPS, exopolysaccharide; SD, selective dropout; S-motility, social motility; TB, Trypan Blue
The dif system was found to be necessary for S-motility, fibril (exopolysaccharide, EPS) production and fruiting-body formation (Yang et al., 1998, 2000). The operon was originally believed to have five possible genes that encode a set of proteins homologous to Escherichia coli chemotaxis proteins: DifA is homologous to the chemoreceptor MCP (methyl-accepting chemotaxis protein), DifC is homologous to CheW, DifD is homologous to the response regulator CheY, and DifE is homologous to CheA, a sensor histidine kinase. Another ORF (designated DifB) has no known protein homologies in the NCBI protein database. A recent study by Lancero et al. (2002) found a sixth possible dif gene in the operon, and designated it DifF. DifF has 27 % identity to CheC of Bacillus subtilis (Helmann et al., 1988). The study by Lancero et al. (2002) also found that most previously isolated dsp mutants were actually dif mutants.
The aim of this study was to analyse the interactions between the known Dif proteins in the operon, and to search for new Dif-interacting proteins that are part of the Dif signalling pathway. Using the yeast two-hybrid system, we studied the protein partners of the Dif proteins, and based on our findings we propose a model for the Dif signalling pathway.
Strains, media, growth conditions and plasmid construction.The yeast host strain PJ69-4A was a gift from Lynda Plamann (University of Missouri-Kansas City, Kansas City, MO, USA), and was grown on either YPDA plates or liquid medium, which were prepared according to the Matchmaker Two-Hybrid System 2 protocol (Clontech Laboratories). The M. xanthus strains used in this study are listed in Table 1. M. xanthus cells were grown and maintained at 32 °C in CYE medium (casitone and yeast extract; Campos et al., 1978). Selective dropout (SD) yeast medium lacking leucine and tryptophan (SD Leu, Trp), leucine, tryptophan and histidine (SD Leu, Trp, His), or leucine, tryptophan, histidine and adenine (SD Leu, Trp, His, Ade) was purchased from Clontech. All other chemicals were obtained from Sigma. Primer pairs that were used to amplify the full-length difA, difB, difC, difD, difE, difF and nla19 genes of M. xanthus, in addition to a difA fragment corresponding to a stable cytoplasmic fragment of the E. coli chemoreceptor Tsr (Ames & Parkinson, 1994), are listed in Table 2. The external restriction sites used to clone each of the amplified fragments into both pGAD and pGBD vectors (James et al., 1996) are indicated as lower-case letters in Table 2.
Table 1. Strains used in this study
Table 2. Primers used to amplify interacting proteins for the yeast two-hybrid analysis Lower-case letters indicate the restriction sites (ggatcc, BamHI; gaattc, EcoRI; ctgcag, PstI) used to generate gene fusions of the GAL4 AD- or the GAL4 DNA BD-encoding genes, and the genes of interest listed here.
Yeast two-hybrid analysis.
The yeast two-hybrid analyses for proteinprotein interaction were performed according to the Clontech Matchmaker Two-Hybrid System 2 protocol. All possible combinations of the plasmids generated below, including combinations with the empty pGAD and pGBD, were transformed into Saccharomyces cerevisiae pJ69-4A using the lithium acetate method (Sambrook et al., 1989) to test the pair-wise interaction of the proteins of interest, as well as self-activation of the individual constructs. The presence of both plasmids was verified by PCR analysis of the yeast colonies using plasmid- and insert-specific primers, in addition to phenotypic screening on low-stringency medium (SD Leu, Trp). Growth on this medium confirms the presence of the pGAD and pGBD plasmid derivatives, without selective pressure for the interaction of the fusion proteins. The colonies were then transferred for further evaluation onto the medium-stringency (SD Leu, Trp, His) and high-stringency (SD Leu, Trp, His, Ade) media. The yeast strain pJ69-4A contains three reporter genes (HIS3, ADE2 and lacZ) under the control of three different promoter elements (GAL1, GAL2 and GAL7) that respond to the same inducer (Gal4), but share little sequence similarity, a feature that greatly reduces promoter-specific false-positive colonies (James et al., 1996). Additionally, these promoters display various degrees of stringency of expression, thus allowing qualitative discrimination between more transient and stronger interactions.
Known dif genes were constructed into the bait vector (pGBD) and the prey vector (pGAD) (Table 3). Given the fact that DifA has a transmembrane domain that may have limited functions in yeast two-hybrid analyses, we made two versions of DifA: the full-length DifA (DifAfull) and the cytoplasmic portion only (DifAcyto) (Table 3). Each PCR product was ligated in-frame into the multiple cloning site of pGBD-C1 (bait vector) and pGAD-C1 (prey vector).
Table 3. Constructs produced in this study for yeast two-hybrid analysis
Known dif genes in the bait vectors (pGBD) were used to screen against known dif genes in the prey vectors (pGAD) (indicated as one-on-one interaction in this paper), as well as against the M. xanthus genomic library for interacting proteins. The M. xanthus genomic library was constructed by Lynda Plamann's laboratory using Philip James's protocol (James et al., 1996). The library was constructed by fusing M. xanthus chromosomal DNA to the 3' end of a gene with the GAL4 activation domain, as described by Thomasson et al. (2002). The library was prepared by digesting M. xanthus DNA with AciI, HinPII or MspI, and ligating the products to pGAD plasmids in three different frames to produce three plasmid libraries: pGAD-C1, pGAD-C2 and pGAD-C3. All three libraries were used in the study. The libraries were amplified in E. coli XL-1 Blue.
For the one-on-one interactions, the yeast transformants were plated on low-, medium- and high-stringency media. The transformants that grew on all three media were considered strong interactions. The positive clones that grew on the high-stringency medium were further confirmed with colour change on a β-galactosidase filter paper using the flash-freezing filter assay (James et al., 1996), and examined with the β-galactosidase assay described below.
For genomic library screens, transformations were performed using the lithium acetate method (Sambrook et al., 1989), and plated on low- and medium-stringency media. For each interaction, colonies were counted on the low-stringency medium to calculate transformation efficiency; more than four times coverage of the genome was calculated. The colonies that grew on the medium-stringency agar were transferred to high-stringency agar to screen for GAL2-ADE2 reporter activity. Colonies that grew on the high-stringency medium were tested for β-galactosidase activity using the assays described above and below. Plasmids from the positive clones were extracted and sequenced at the UCLA Genetic Core Facility.
β-Galactosidase assay.
The yeast cultures were transferred into fresh medium, grown to mid-exponential phase, pelleted and resuspended in 50 µl STES buffer [0·2 M Tris/HCl (pH 7·6); 0·5 M NaCl; 0·1 % (w/v) SDS; 0·01 M EDTA]. Glass beads (0·5 mm, Fisher Scientific) and 20 µl TE buffer (10 mM Tris/HCl, 1 mM EDTA, pH 7·6) were added to each tube. This mixture was vortexed vigorously (4 min) at room temperature in a Turbo Mixer (Scientific Industries), and centrifuged at maximum speed for 5 min. The supernatant was transferred into 1·1 ml Z-buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4; pH 7·0), supplemented with 50 mM β-mercaptoethanol. A 100 µl volume of this suspension was used to determine the protein concentration of the sample. The remaining sample was used to measure β-galactosidase activity with ONPG (4 mg ml1 in Z-buffer) as a substrate. One unit (U) of enzyme activity corresponds to the hydrolysis of 1 nmol ONPG min1 (mg protein)1.
Construction of genetic mutants.
The in-frame ΔdifB mutant (HL400) was constructed according to the following PCR fusion procedure, as described by Ho et al. (1989). The primers were engineered to have an EcoRI site at the 5' end, and a BamHI site at the 3' end (shown in lower-case letters). For the first PCR, two fragments, the EcoRI fragment and the BamHI fragment, were amplified. The EcoRI fragment (1250 bp) was amplified using the following primer pair: gaattcATGGGGCTGGCGCTGACG and CGTCTGGCTCATGGGCCCAGGCGGAAGCTGCGCACGAC. The BamHI fragment (474 bp) was amplified using the following primer pair: CCATGAGCCAGACGGCGGCGGGTTCGTCCCGG TCGAAG and cgggatcccgTCACTTGGAATGGGTGAA. For the ligation, 1 µl EcoRI fragment and 1 µl BamHI fragment from the PCR reaction mix were combined as the template. The following primers were used for the PCR ligation reaction: gaattcATGGGGCTGGCGCTGACG and cgggatcccgTCA CTTGGAATGGGTGAA. The resulting 1724 bp PCR fragment was cloned into PCRII-TOPO vector according to the protocol of the manufacturer (Invitrogen) to create pTOPOBKO. The fragment was digested with EcoRI and BamHI, and ligated into pBJ113 to produce pDIFBKO. pDIFBKO was transferred into M. xanthus through electroporation, as described by Kashefi & Hartzell (1995). Chromosomal integration was selected by plating the cells onto CYE agar containing 100 µg kanamycin ml1 (positive selection). The Kanr transformants (plasmids cannot replicate in M. xanthus) were plated onto CYE agar containing 1 % galactose for negative selection. Southern blot analysis was used to screen the galactose-resistant (Kanr Gals) mutants for proper excision of difB (Ueki et al., 1996).
The yidC mutant (YIDC1) was constructed by amplifying a 600 bp internal region of yidC using the following primer pair, in which lower-case letters denote BamHI and EcoRI sites, respectively: cgggatcccgTGGGGTCGATGGCGCGGT and gaattcCGGTGCCGTGACGAGGGGT. The fragment was cloned into the PCRII-TOPO vector (according to the manufacturer's protocol) to create pYIDC1. pYIDC1 was transferred into M. xanthus DK1622 through electroporation, as described by Kashefi & Hartzell (1995). The insertional mutation was confirmed with PCR and Southern blotting (Sambrook et al., 1989). The yidCdifB double mutant (HL800) was constructed by electroporating pYIDC1 into ΔdifB (HL400), and selecting for Kanr transformants.
The nla19 mutant (AG319) was constructed as described by Caberoy et al. (2003). Briefly, to generate plasmid pNBC19, a 523 bp internal fragment of the nla19 gene was cloned into the pCRII-TOPO vector using the procedure described by the manufacturer. Next, plasmid pNBC19 was electroporated into DK1622 cells using the technique of Kashefi & Hartzell (1995). Chromosomal DNA was isolated from Kanr colonies, and used for Southern blot analysis to identify strains carrying an nla19 insertion mutation. SC100 and SC101 strains were constructed by transducing the nla19 mutation into DK1217 (aglB1) and DK1300 (sglG1), respectively (Hodgkin & Kaiser, 1979b).
Phenotypic characterization.
For characterization of the developmental phenotypes, cells from overnight cultures were resuspended in MOPS buffer (10 mM MOPS, 8 mM Mg2+, 8 mM Ca2+) at about 5x109 cells ml1, spotted on MOPS plates (20 µl spots), and incubated at 32 °C for 2 days. For characterization of fibril carbohydrates (EPS), 5 µl of 5x107 cells ml1 was spotted on 1·5 % CYE containing 5 µg ml1 Calcofluor White (CW), incubated at 32 °C for 5 days, and visualized under long-wave UV light. Trypan Blue (TB) assays (Black & Yang, 2004) were also performed to characterize the EPS on the cell surface. All strains tested were resuspended to approximately 2·8x108 cells ml1 in MOPS buffer. Stock solutions of the dyes were prepared in deionized distilled water at 100 µg ml1. A 1 : 10 dilution of dye stock to cell suspension was mixed to give a final concentration of 10 µg ml1. Control samples, containing each dye in MOPS buffer only, were included, and triplicate assays were performed for all samples. All samples were vortexed briefly, and incubated undisturbed in the dark at room temperature for 30 min. The cell suspensions were then pelleted at 16 000 g in a benchtop centrifuge for 5 min, and the absorbance of the supernatants was measured at 585 nm. For the agglutination assay, an overnight culture was resuspended in MOPS buffer at an OD600 of 0·5. Readings were taken for 2 h. For swarming assays, 5 µl of 5x107 cells ml1 were spotted on 1·5 % CYE agar or 0·3 % CYE agar, incubated at 32 °C for 5 days, and the colony edges were observed by phase-contrast microscopy.
As described above, most Dif proteins exhibit homology with common chemotaxis proteins (MCP, CheA, CheW, CheY and CheC), with the exception of DifB. We were very interested in how Dif proteins interact with each other; therefore, we performed the yeast two-hybrid analysis for the dif genes. For this study, each full-length dif gene was cloned into a plasmid containing the binding domain (BD), and into a plasmid containing the activation domain (AD) for the yeast two-hybrid assays. As shown in Table 4, DifA interacted with DifC, and DifC interacted with DifA and DifE. DifD interacted with two proteins, DifE and DifF, and DifE also interacted with two proteins, DifC and DifD. DifF interacted with DifD only. DifB did not interact with any of the Dif proteins. Empty plasmids of the activation domain (pGAD) and binding domain (pGBD) were used as negative controls in this one-on-one interaction experiment; empty plasmids showed no self-activation of transcription. Given the perfect match for each pair-wise interaction between the AD and the BD constructs, it is likely that the observed interactions are real. Furthermore, it is interesting to note that the interactions among Dif chemotaxis-like proteins are similar to those found in E. coli (Eisenbach, 1996; Grebe & Stock, 1998) and B. subtilis (Garrity & Ordal, 1995). It was particularly interesting to note that DifF had strong and definite interactions with DifD alone, and that DifB did not interact with any other Dif proteins.
Table 4. One-on-one protein interactions among the Dif proteins The assay was performed as described in Methods. The proteins were subcloned into both the pGAD and the pGBD plasmids. Yeast cells (PJ69-4A) were transformed with the plasmids indicated, and assayed for growth under low-, medium- and high-stringency conditions. Transformants that grew in all three conditions were considered as a strong interaction (+). More than 20 transformants in the high-stringency condition were obtained for each positive interaction. All strong interactions were further confirmed with specific β-galactosidase activity over 100 U, as described in Methods.
A search for additional Dif-interacting proteins in the M. xanthus genomic library
The above data suggest that Dif proteins are able to interact with each other on a one-on-one basis. We were interested in testing whether the similar interactions could be detected at the genome scale, and whether there are additional M. xanthus proteins that interact with the dif system. To achieve this goal, we performed the yeast two-hybrid analysis using Dif proteins as bait to screen the whole M. xanthus genomic library constructed on the prey vector (see Methods). As shown in Table 5, the DifC and DifD baits were able to pull DifE out of the genomic library. Similarly, the DifE bait pulled DifC and DifD out of the genomic library. In addition, the DifF bait was able to fish out DifD. These data further validate the interactions between DifC and DifE, DifD and DifE, and DifF and DifD as described in Table 4. Furthermore, these data indicate that these interactions are strong and specific, noting that there are several chemotaxis-like systems in the M. xanthus genome. It is particularly worth pointing out that the DifD bait pulled out over 20 positive clones, all identified as DifE, even though more than 90 different sensor histidine kinases are encoded in the M. xanthus genome (unpublished data revealed by the M. xanthus genome project).
Table 5. Screening M. xanthus genomic library for Dif-interacting proteins The assay was performed as described in Methods, and was similar to the one-on-one yeast two-hybrid assay. The Dif proteins were subcloned into the binding domain of pGBD plasmids. Both the full-length and the cytoplasmic portion of DifA constructs were used in this study with the same results. For each interaction, more than 25 000 colonies were obtained under the low-stringency condition to ensure sufficient genomic DNA molecules were transformed. More than five transformants in the high-stringency condition were obtained for the positive interactions presented in the table.
In contrast to the results shown in Table 4, DifA baits (both in full-length and cytoplasmic parts) failed to pull out any interacting proteins from the M. xanthus genomic library (Table 5), indicating the limitations of the prey library, possibly because not all the genes are represented in the M. xanthus prey library, or they are present in low copy numbers.
Most interesting, as shown in Table 5, the DifB bait was able to pull out an interacting protein which had strong homology with a membrane protein called YidC, which was also found in E. coli, and in lower eukaryotes and plants (Dalbey & Kuhn, 2004; Jiang et al., 2002; Samuelson et al., 2000; Urbanus et al., 2002). Furthermore, the DifE bait was able to pull out Nla19, an NtrC-like protein found to be involved in delayed aggregation and fruiting body formation (Caberoy et al., 2003). Both interactions were further confirmed in the one-on-one interaction experiment, although the interaction between DifE and Nla19 was relatively weak compared with the DifBYidC interaction (Table 5).
Genetic and phenotypic characterization of difB, yidC and nla19 for their roles in fibril (EPS) production, S-motility and development
In this part of the study, we used a genetic approach to examine whether these newly identified Dif-interaction proteins are indeed involved in development, S-motility and fibril (EPS) production. As described in Methods, and presented in Table 1, we constructed difB, yidC, difByidC and nla19 mutants for phenotypic characterization. CW and TB are two different assays that test for the presence of fibrils (EPS) (see Methods). As shown in Table 6, difB and yidC mutants, and the difByidC double mutant, had wild-type levels of fibrils (EPS). Furthermore, results of assays that measure A- and S-motility on soft agar plates (0·3 % agar) and hard agar plates (1·5 % agar) (Shi & Zusman, 1993), as well as development, were found to be similar to the wild-type (Table 6). However, nla19 was found to have increased fibril (EPS) production and defects in S-motility (Table 6), suggesting that it may be part of the Dif signalling pathway.
Table 6. Phenotypic characterization of difB, yidC and nla19
In summary, we were able to identify possible interactions between each Dif protein. We found that DifA, C, D, E and F interact in a similar fashion to chemotaxis proteins of E. coli and B. subtilis, and that DifB does not interact with other Dif proteins. Furthermore, using various Dif proteins as bait for screening an M. xanthus genomic library, we not only confirmed the specific interactions among known Dif proteins (including the interaction between DifF and DifD), but also discovered two novel interactions between DifE and Nla19, and DifB and YidC. Based on these findings, a model for the Dif signalling pathway is proposed, as illustrated in Fig. 1. DifA, a cytoplasmic membrane protein, would relay the signal to DifE, with DifC as a coupling factor. The signal may be further relayed via two different response regulators, DifD and Nla19. Based on the yeast two-hybrid analyses, the interaction between DifE and DifD is strong and stable, while the interaction between DifE and Nla19 is transient. The biological significance of these interactions is yet to be identified; however, some additional DifE-interacting response regulators could still exist, since DifE does not produce fibrils (EPS), whereas both DifD and Nla19 overproduce fibrils. The strong interaction between DifB and YidC suggests that DifB may indeed be a functional protein, despite the fact that it does not interact with other Dif proteins.
|
Footnotes
,†,References
Black, W. P. & Yang, Z. (2004). Myxococcus xanthus chemotaxis homologs DifD and DifG negatively regulate fibril polysaccharide production. J Bacteriol 186, 10011008.
Blackhart, B. D. & Zusman, D. R. (1985). Cloning and complementation analysis of the "Frizzy" genes of Myxococcus xanthus. Mol Gen Genet 198, 243254.[CrossRef][Medline]
Caberoy, N. B., Welch, R. D., Jakobsen, J. S., Slater, S. C. & Garza, A. G. (2003). Global mutational analysis of NtrC-like activators in Myxococcus xanthus: identifying activator mutants defective for motility and fruiting body development. J Bacteriol 185, 60836094.
Campos, J. M., Geisselsoder, J. & Zusman, D. R. (1978). Isolation of bacteriophage MX4, a generalized transducing phage for Myxococcus xanthus. J Mol Biol 119, 167178.[CrossRef][Medline]
Dalbey, R. E. & Kuhn, A. (2004). YidC family members are involved in the membrane insertion, lateral integration, folding, and assembly of membrane proteins. J Cell Biol 166, 769774.
Eisenbach, M. (1996). Control of bacterial chemotaxis. Mol Microbiol 20, 903910.[Medline]
Garrity, L. F. & Ordal, G. W. (1995). Chemotaxis in Bacillus subtilis: how bacteria monitor environmental signals. Pharmacol Ther 68, 87104.[CrossRef][Medline]
Grebe, T. W. & Stock, J. (1998). Bacterial chemotaxis: the five sensors of a bacterium. Curr Biol 8, R154R157.[CrossRef][Medline]
Helmann, J. D., Marquez, L. M. & Chamberlin, M. J. (1988). Cloning, sequencing, and disruption of the Bacillus subtilis sigma 28 gene. J Bacteriol 170, 15681574.
Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 5159.[CrossRef][Medline]
Hodgkin, J. & Kaiser, D. (1979a). Genetics of gliding motility in Myxococcus xanthus (Myxobacterales): genes controlling movement of single cells. Mol Gen Genet 171, 167176.[CrossRef]
Hodgkin, J. & Kaiser, D. (1979b). Genetics of gliding motility in Myxococcus xanthus: two gene systems control movement. Mol Gen Genet 171, 177191.[CrossRef]
James, P., Halladay, J. & Craig, E. A. (1996). Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 14251436.[Abstract]
Jiang, F., Yi, L., Moore, M., Chen, M., Rohl, T., Van Wijk, K. J., De Gier, J. W., Henry, R. & Dalbey, R. E. (2002). Chloroplast YidC homolog Albino3 can functionally complement the bacterial YidC depletion strain and promote membrane insertion of both bacterial and chloroplast thylakoid proteins. J Biol Chem 277, 1928119288.
Kaiser, D. (1979). Social gliding is correlated with the presence of pili in Myxococcus xanthus. Proc Natl Acad Sci U S A 76, 59525956.
Kashefi, K. & Hartzell, P. L. (1995). Genetic suppression and phenotypic masking of a Myxococcus xanthus frzF defect. Mol Microbiol 15, 483494.[CrossRef][Medline]
Kirby, J. R. & Zusman, D. R. (2003). Chemosensory regulation of developmental gene expression in Myxococcus xanthus. Proc Natl Acad Sci U S A 100, 20082013.
Lancero, H., Brofft, J. E., Downard, J., Birren, B. W., Nusbaum, C., Naylor, J., Shi, W. & Shimkets, L. J. (2002). Mapping of Myxococcus xanthus social motility dsp mutations to the dif genes. J Bacteriol 184, 14621465.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Samuelson, J. C., Chen, M., Jiang, F., Moller, I., Wiedmann, M., Kuhn, A., Phillips, G. J. & Dalbey, R. E. (2000). YidC mediates membrane protein insertion in bacteria. Nature 406, 637641.[CrossRef][Medline]
Shi, W. & Zusman, D. R. (1993). The two motility systems of Myxococcus xanthus show different selective advantages on various surfaces. Proc Natl Acad Sci U S A 90, 33783382.
Thomasson, B., Link, J., Stassinopoulos, A. G., Burke, N., Plamann, L. & Hartzell, P. L. (2002). MglA, a small GTPase, interacts with a tyrosine kinase to control type IV pili-mediated motility and development of Myxococcus xanthus. Mol Microbiol 46, 13991413.[CrossRef][Medline]
Ueki, T., Inouye, S. & Inouye, M. (1996). Positivenegative KG cassettes for construction of multi-gene deletions using a single drug marker. Gene 183, 153157.[CrossRef][Medline]
Urbanus, M. L., Froderberg, L., Drew, D., Bjork, P., de Gier, J. W., Brunner, J., Oudega, B. & Luirink, J. (2002). Targeting, insertion, and localization of Escherichia coli YidC. J Biol Chem 277, 1271812723.
Vlamakis, H. C., Kirby, J. R. & Zusman, D. R. (2004). The Che4 pathway of Myxococcus xanthus regulates type IV pilus-mediated motility. Mol Microbiol 52, 17991811.[CrossRef][Medline]
Ward, M. J. & Zusman, D. R. (1999). Motility in Myxococcus xanthus and its role in developmental aggregation. Curr Opin Microbiol 2, 624629.[CrossRef][Medline]
Yang, Z., Geng, Y., Xu, D., Kaplan, H. B. & Shi, W. (1998). A new set of chemotaxis homologues is essential for Myxococcus xanthus social motility. Mol Microbiol 30, 11231130.[CrossRef][Medline]
Yang, Z., Ma, X., Tong, L., Kaplan, H. B., Shimkets, L. J. & Shi, W. (2000). Myxococcus xanthus dif genes are required for biogenesis of cell surface fibrils essential for social gliding motility. J Bacteriol 182, 57935798.
Zusman, D. R. (1982). "Frizzy" mutants: a new class of aggregation-defective developmental mutants of Myxococcus xanthus. J Bacteriol 150, 14301437.
Received 1 November 2004; revised 6 January 2005; accepted 10 January 2005.
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |