Research Article

Binding and transcriptional activation of non-flagellar genes by the Escherichia coli flagellar master regulator FlhD2C2

Microbiology 2005; 151(6):1779 · https://doi.org/10.1099/mic.0.27879-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

The gene hierarchy directing biogenesis of peritrichous flagella on the surface of Escherichia coli and other enterobacteria is controlled by the heterotetrameric master transcriptional regulator FlhD2C2. To assess the extent to which FlhD2C2 directly activates promoters of a wider regulon, a computational screen of the E. coli genome was used to search for gene-proximal DNA sequences similar to the 4244 bp inverted repeat FlhD2C2 binding consensus. This identified the binding sequences upstream of all eight flagella class II operons, and also putative novel FlhD2C2 binding sites in the promoter regions of 39 non-flagellar genes. Nine representative non-flagellar promoter regions were all bound in vitro by active reconstituted FlhD2C2 over the KD range 38356 nM, and of the nine corresponding chromosomal promoterlacZ fusions, those of the four genes b1904, b2446, wzzfepE and gltI showed up to 50-fold dependence on FlhD2C2 in vivo. In comparison, four representative flagella class II promoters bound FlhD2C2 in the KD range 1243 nM and were upregulated in vivo 30- to 990-fold. The FlhD2C2-binding sites of the four regulated non-flagellar genes overlap by 1 or 2 bp the predicted 35 motif of the FlhD2C2-activated σ70 promoters, as is the case with FlhD2C2-dependent class II flagellar promoters. The data indicate a wider FlhD2C2 regulon, in which non-flagellar genes are bound and activated directly, albeit less strongly, by the same mechanism as that regulating the flagella gene hierarchy.
Abbreviations: CRP, cAMP receptor protein; HI, heterology index
The motility of bacteria like Escherichia coli, Salmonella typhimurium and Proteus mirabilis is mediated by 15 µm long peritrichous flagella: helical propellers' assembled on the cell surface. More than 40 genes are specifically required for flagellar biogenesis (Macnab, 1996), and these are organized with those for chemotaxis in a transcriptional hierarchy that underlies temporal and spatial control of the assembly process (Kutsukake et al., 1990; Kalir et al., 2001; Soutourina & Bertin, 2003). At the apex of this hierarchy is the flagellar master operon flhDC which assimilates environmental and physiological signals, and in E. coli and related bacteria is tightly regulated at the transcriptional (Dufour et al., 1998; Soutourina & Bertin, 2003; Francez-Charlot et al., 2003) and translational (Claret & Hughes, 2000a; Tomoyasu et al., 2003) levels. This activates expression of the early class II genes encoding membrane components of the flagellar basal body, the cytosolic and membrane proteins of the export machinery, and the sigma factor σ28 that switches on class III genes encoding chemotaxis proteins and the structural subunits of the flagellum (Chadsey et al., 1998; Karlinsey et al., 2000; Soutourina et al., 1999). Activation of flagellar class II promoters is determined by the heterotetrameric FlhD2C2 complex, composed of the FlhD (13·3 kDa) and FlhC (21·5 kDa) proteins, which are closely conserved among enterobacterial species (Kutsukake et al., 1990; Givskov et al., 1995; Furness et al., 1997; Young et al., 1999; Givaudan & Lanois, 2000). While FlhC2 dimers can bind to target class II promoters independently, FlhD2 enhances the affinity, stability and specificity of the interaction between class II flagellar promoters and the FlhD2C2 complex (Claret & Hughes, 2002).

In addition to its role in swimming motility, the flhDC operon is pivotal to multicellular swarming migration (Allison & Hughes, 1991; Fraser et al., 2002), during which it is strongly upregulated, and contributes to virulence-factor expression in several pathogens (Allison et al., 1994; Dufour et al., 1998; Young et al., 1999; Kim et al., 2003). In addition, microarray comparisons of mRNA levels from E. coli wild-type and flhDC mutant strains have suggested that the flagellar master operon regulates several non-flagellar genes (Prüss et al., 2001, 2003). These observations have encouraged the concept of a substantial flhDC transcriptional regulon, but it is not clear whether flhDC-dependent regulation is determined directly by FlhD2C2 binding to non-flagellar promoters or reflects indirect pathways in which FlhD2C2 acts by influencing other regulators.

DNase footprinting and primer extension analyses of class II flagellar promoter sequences from P. mirabilis, E. coli and S. typhimurium (Kutsukake et al., 1990; Liu & Matsumura, 1996; Claret & Hughes, 2002) have generated a consensus FlhD2C2 binding sequence of a 4244 bp imperfect inverted repeat in which two FlhD2C2 box arms, each AA(C/T)G(C/G)N2/3AAATA(A/G)CG, are separated by a non-conserved spacer of 1012 nucleotides (N1012) (Claret & Hughes, 2002). To assess the nature and extent of the proposed flhDC regulon, we have used this consensus recognition sequence to identify putative target genes in the E. coli genome. Putative target promoters identified were assayed by in vitro binding of reconstituted, transcriptionally active FlhD2C2, and by in vivo FlhD2C2-dependent transcription of the chromosomal genes.

Computer survey of the E. coli genome.
The E. coli MG1655 genome (GenBank accession no. U00096) was surveyed for putative FlhD2C2 binding sites by a heterology index (HI) based computer program, details of which can be obtained from Tomoo Ogi (t.ogi{at}sussex.ac.uk ). Briefly, a scoring matrix was compiled from the sequences of both FlhD2C2 boxes (i.e. the arms of the inverted repeat) of 18 known class II flagellar promoters, including the 12 experimentally defined promoters originally used by Claret & Hughes (2002). Only the length of the non-conserved N1012 spacer was considered, not the base sequence. HI values were thus calculated for every one of the ∼4·64x106 possible 4244 base sequences of the genome by adding the HI for appropriately spaced (N1012) inverted FlhD2C2 box arms. This allowed identification of sites with a range of HI values from 6·1 upwards. A perfect consensus binding site would have an HI value of 0, with HI values above 20 indicating weak potential for true FlhD2C2 binding, judging from their high frequency (∼500), and previous experiments on other regulons (Berg & Von Hippel, 1988; Lewis et al., 1994; Fernandez de Henestrosa et al., 2000).

Bacterial strains.
E. coli strains were grown at 37 °C in LB broth or on LB agar. E. coli XL-1 Blue or XL10 Gold (Stratagene) transformants were selected by appropriate antibiotics (gentamicin, 5 µg ml1; kanamycin and ampicillin, 50 µg ml1) plus 80 µg X-Gal ml1 and 20 mM IPTG. Motile E. coli MC1000 wild-type and the non-motile flhD : : km derivative containing a polar Tn5 transposon insertion were obtained from B. Prüss (University of Illinois, Chicago, USA). E. coli MC1000 strains fur : : km, fliA : : km and hns : : km were created by P1 phage transduction from MC4100 hns : : km, MG1655 fliA : : km and MC4100 fur : : km, obtained from Simon Andrews (University of Reading, UK) and the University of Wisconsin E. coli genome project (Kang et al., 2004).

In vitro DNA binding.
The FlhD and FlhC proteins were expressed separately in E. coli BL21 DE3 from plasmids pET11-FlhD and pET15-FlhC and recovered from insoluble pellets after cell lysis in a French pressure cell, as previously described (Claret & Hughes, 2000a). The FlhD pellet was resuspended in 6 M urea, 20 mM Tris/HCl (pH 8·0), and the protein purified by anion-exchange chromotography; the FlhC pellet was resuspended in 6 M guanidine/HCl, pH 8·0, and His-tagged FlhC protein was affinity purified by Ni-NTA chromatography. The two proteins were mixed, refolded and solubulized during dialysis against binding buffer (20 mM Tris/HCl, pH 8·0, 0·1 M NaCl, 0·1 mM EDTA, 1 mM DTT, 1 mM MgCl2, 100 mg BSA ml1, 15 %, w/v, glycerol) according to Claret & Hughes (2000a) to form the transcriptionally active FlhD2C2 complex. The His-tagged FlhC is comparable to the native FlhC in FlhD2C2 complex formation and DNA binding, and was able to complement the non-motile phenotype of an flhC mutant (not shown). The complex was pre-incubated in 20 ml binding buffer for 20 min at 25 °C, then incubated for 20 min with radiolabelled DNA probes of 175226 bp PCR amplified from the E. coli chromosome with Pfu Turbo polymerase and oligonucleotide primers containing EcoRI and BamHI sites. Each PCR product was digested with EcoRI and dephosphorylated by calf intestinal alkaline phosphatase (Roche) before 5' phosphorylation with [γ-32P]ATP (Amersham) using phage T4 polynucleotide kinase (NEB) and purification on a 5 % (w/v) polyacrylamide gel containing 1x TBE (100 mM Tris/borate, pH 8·3, 2 mM EDTA). The resulting end-labelled probes were included at a concentration of 0·3 nM (i.e. providing a molar excess of protein complex) with a 1000-fold excess of non-specific competitior poly(dIdC). After electrophoresis of DNA : protein complexes through 6 % polyacrylamide (0·5x TBE), the gels were dried and the relative intensities of the bound/unbound DNA were detected using a cyclone phosphorimager and quantified by OPTIQUANT software (Packard). Binding affinity was expressed as KD, the concentration of FlhD2C2 complex required to achieve a ratio of 1 : 1 for the free : bound DNA probe. All assays were performed at least twice and the mean binding affinities (KD) reported.

Construction of chromosomal transcriptional fusions.
Plasmid pGPS123 was constructed by excision of the kanamycin resistance gene of pRS551 (Simons et al., 1987) using XhoI and HindIII and replacement with the gentamicin resistance cassette of p34SGm (Dennis & Zylstra, 1998). DNA sequences used as probes in in vitro DNA-band shift assays were PCR amplified with Pfu Turbo polymerase from the E. coli chromosome using specific oligonucleotide primers that each generated a 5' EcoRI site and a 3' BamHI site. DNA fragments were cleaned using QIAspin columns (Qiagen), digested with EcoRI and BamHI, and ligated with EcoRI/BamHI digested pGPS123. After transformation into E. coli XL1 Blue or XL10, blue GmR colonies were selected, and inserts verified by PCR and sequencing (Department of Genetics, University of Cambridge) using vector-specific primers.

The flhB-80 promoter fragment was obtained by first amplifying the FlhD2C2 binding site plus 95 bp of 5' DNA using primers FlhBFor (TTGAATTCATGGTGGCGTGACCACCACGTCAT) and FlhB-DCRev (TAGCCGCGGTGATGCCAGAAAAAAACCCCGTCACGTTCAAGCTTAATGGTTGAGTAAGG), then the σ70 promoter plus 57 bp of 3' DNA using primers FlhBRev (CGGGATCCTTTTGTCGTCGCTCTCG) and FlhBs70 (TAGCCCGCGGTGATGCGCTTGATGGCCGAGTCTCCGATTACAAGCTTGAACGCTTTGCGC). These two primers contain SacII restriction sites (CCGCGG) at their 5' ends, allowing ligation of the PCR products to form the 270 bp flhB-80 fragment construct and its cloning into pGPS123. The source of the intervening extra sequence in primers FlhBs70For and FlhB-DCRev is the flhA gene, which contains no transcriptional features.

MC1000 strains containing each pGPS123 transcriptional-fusion-bearing plasmid were individually infected with phage λRS45, and lysates were used to produce blue GmR ApS lysogen colonies (Simons et al., 1987). Fusion inserts in the chromosome were confirmed by sequencing using vector- and insert-specific primers, and correct insertion into the λatt site was verified according to the method of Powell et al. (1994).

The flhDC complementation plasmid pflhDC was constructed by amplification of the flhDC genes and flanking DNA containing the native promoter sequence, using the primers DC-coliF (GGAATTCTGCGCAACATCCCATTTCG) and DC-coliR (GGGAATTCCAGTTAAACAGCCTGTACTCT), restriction with EcoRI, and ligation into EcoRI-restricted pAcTrc (provided by Dr Gillian Fraser, Department of Pathology, University of Cambridge).

In vivo assay of transcription activity.
Chromosomal transcriptional fusion expression was assessed as whole-cell β-galactosidase activity (Miller, 1972). Triplicate overnight cultures were diluted to OD600=0·001 in LB and sampled hourly during batch culture. We performed the assays at 37 °C.

The E. coli MC1000 strain showed comparable motility at 37 °C and 30 °C (not shown), in agreement with observations of constant swimming speeds between 24 °C and 37 °C, and comparable FliC protein and transcript levels over a similar temperature range (Adler & Templeton, 1967; Mizushima et al., 1994). Activities were recorded as means of at least three cultures. In complementation experiments, flhDC was provided in trans by expression without induction from the plasmid pflhDC.

Computational identification of putative FlhD2C2 regulon genes
To identify genes of the potential FlhD2C2 regulon, the 4639 kb DNA of the E. coli MG1655 genome sequence was surveyed by a statistical mechanics search program, as previously described in the characterization of the cAMP receptor protein (CRP) and LexA regulons (Berg & Von Hippel, 1988; Lewis et al., 1994; Fernandez de Henestrosa et al., 2000). In the program, differences between a query DNA sequence and the protein binding site consensus are assigned a penalty reflecting the frequency of each base at every position in known target sequences, and this is used to calculate a heterology index (HI). Low HI scores indicate closeness to the consensus.

The search identified 7834 genome sequences with an HI lower than 25, while 499 had an HI below 20, and 145 an HI equal to or below 18. Of the 145 sequences, 99 were within coding sequences and/or located more than 250 bp 5' of predicted start codons. These were excluded, since the known FlhD2C2 binding sequences of flagellar class II promoters are all between 74 bp and 160 bp 5' of their respective start codons. This left 47 putative FlhD2C2 binding sequences with an HI lower than our arbitrary cut-off of 18 or in non-coding sequence close to genes putatively transcribed alone or in operons. These are listed in Table 1 with the known or indicated function of the gene immediately 3' of the promoter. This number is comparable with the 69 putative LexA regulon binding sites similarly identified with an HI lower than 15 (Fernandez de Henestrosa et al., 2000). The 47 promoter regions are estimated to control 86 of the 4287 predicted ORFs in the E. coli genome ().


Table 1. Summary of putative FlhD2C2 binding sequences Sequences (47) with a heterology index (HI) of 18 or less were identified by screening with the inverted repeat consensus (shown at the top in bold). Flagellar genes are in bold; the control rcsA and argR are included at the bottom. Nucleotides identical to or different from the consensus sequence are shown in upper- and lower-case type, respectively.


The search identified the binding sequences of all the seven known class II flagellar operons of E. coli, each with a low HI value: flgAMN (HI 6·1), flgBCDEFGHIJ (HI 6·1), flhBAE (HI 11·9), fliE (HI 12·2), fliFGHIJK (HI 12·2), fliAZY (HI 13·1) and fliLMNOPQR (HI 14·7). An FlhD2C2 binding site was also identified 5' of the fliDST (HI 12·2) operon that has not been previously reported in E. coli but is compatible with the presence of both class II and III promoters for this operon in the closely related S. typhimurium (Ide et al., 1999). This reflects the direct activation of 35 flagella genes by FlhD2C2. The remaining 39 putative FlhD2C2 binding sequences are located in promoter regions which control approximately 51 non-flagellar genes. Ten are 5' of single genes or operons with products of known function, involved in global regulation (hupB and hns histone-like proteins, groES(L) protein folding, icc (cpdA) cAMP catabolite repression), the secM protein secretion regulator, polysaccharide synthesis (uppS) or modification (wzzfepE,O-antigen chain length control, pmrD LPS composition), and involvement in membrane transport (livKHGMF, leucine uptake, chaC putative calcium transporter, gltI glutamate transport). A further 20 genes have putative functions predicted only from the presence of conserved domains or motifs (), and eight only have a predicted cellular location (assessed at ).

In vitro binding of FlhD2C2 to target sites of the E. coli genome
The theoretical assumptions underlying this search approach have been validated by experimental binding affinities of the CRP and LexA proteins for target promoters of their regulons (Berg & Von Hippel, 1988; Lewis et al., 1994; Fernandez De Henestrosa et al., 2000). In our studies, DNA-band shift assays were used to assess recognition by the FlhD2C2 complex of 13 representative sequence targets with low HI chosen from the 47 listed in Table 1. Four were located 5'of the flagellar operons flgB (HI 6·1), flhB (HI 11·9), fliA (HI 13·1) and fliL (HI 14·7), representing a range of HI, to establish a positive control dataset for the study. Nine were upstream of the putative non-flagella targets b1904 (HI 10·9), b2446 (HI 11·5), yejO (HI 13·7), gltI (HI 13·7), icc (HI 14·1), yegH (HI 14·6), hns (HI 14·7), wzzfepE (HI 14·9) and hupB (HI 15·5). Two sequences with HI scores outside the 18 cut-off, rcsA (HI 18·8) and argR (18·7), were assessed in parallel as negative controls. In each case, a radiolabelled probe of 150230 bp, containing the putative FlhD2C2 binding site near its centre, was made by PCR amplification of genomic DNA from E. coli MC1000. Each probe was incubated with increasing concentrations of transcriptionally active heterotetrameric FlhD2C2 complex reconstituted from purified FlhD and FlhC proteins (Claret & Hughes, 2000b, 2002) in the presence of a large excess of the non-specific competitor poly(dIdC).

All 13 test probes, four flagellar and nine non-flagellar, were bound by FlhD2C2. This resulted in each case in a shift of the DNA to a slower-migrating species during native PAGE. Autoradiographs of three representative binding assays with sequences of differing HI are shown in Fig. 1A. To quantify this assay, phosphoimage analysis of the migrating band intensities allowed the ratio of bound : free DNA intensity to be plotted against protein concentration. The plots in Fig. 1B (i), (ii) show a broad range of FlhD2C2 affinities, with binding to several putative non-flagellar targets, such as b1904, comparable to that of the four class II flagella genes analysed.



(26K):

Fig. 1. In vitro binding of FlhD2C2 to putative regulation promoters. (A) DNA-band shift. Radiolabelled nucleotide probe fragments were incubated with increasing concentrations of FlhD2C2 complex (nM) in the presence of a 1000-fold excess of non-specific competitor poly(dIdC), and analysed on 6 % native polyacrylamide. (B) Ratios of bound : free FlhD2C2 probes observed in DNA-band shifts (mean of three experiments, error20 %) plotted against FlhD2C2 protein concentration [(i) 070 nM; (ii) 0175 nM].

From these plots, the apparent dissociation constant KD was calculated for each binding site as the protein concentration at which 50 % of probe was bound, in other words, the ratio of bound : free DNA probe was 1. The class II flagellar promoter regions of flgB, flhB, fliA and fliL displayed low KD values of 12·5 nM, 21 nM, 25 nM and 43 nM, respectively, as did those of genes b1904, b2446 and wzzfepE: 38 nM, 60 nM and 86 nM, respectively. The KD values for the non-flagellar promoter regions of yejO, gltI, icc, yegH, hns and hupB were substantially higher at 220 nM, 220 nM, 167 nM, 240 nM, 165 nM and 250 nM, respectively. Although FlhD2C2 bound to the control probe of rcsA, the KD of 356 nM was close to the limit of detection (450 nM), while no binding was observed to the argR sequence.

In vivo FlhD2C2-dependent promoter transcription
To assess whether the in vitro binding of FlhD2C2 correlated with FlhD2C2-dependent in vivo promoter activity, single-copy chromosomal lacZ transcriptional fusions were constructed to each of the promoter regions assessed in the DNA-band shift assay. Each of the 15 DNA probe sequences was fused to the lacZ reporter gene in the plasmid vector pGPS123, and the resulting construct was transferred as a single-copy fusion to the chromosome of both E. coli MC1000 wild-type and the isogenic flhDC null mutant by the phage λRS45 (Simons et al., 1987). The β-galactosidase activity of each transcriptional fusion was compared in the two strains grown at 37 °C and also in the flhDC mutant complemented in trans by the pflhDC plasmid, which expresses FlhD2C2 from its native promoter.

During batch growth in LB medium, peak expression of the four class II flagella gene promoter regions was substantially higher in the wild-type than the flhDC mutant (Table 2): flgB, 136-fold; flhB, 31-fold; fliA, 990-fold; fliL, 209-fold. Expression from the strongly bound b1904 promoter region was comparably higher, 191-fold, in the wild-type, while the b2446, wzzfepE and gltI promoter fusions were activated 11-, six- and twofold, respectively. Expression of these four differentially activated non-flagellar gene fusions in the flhDC mutant was enhanced by at least tenfold when FlhD2C2 was provided by plasmid pflhDC. In addition, although expression from the yejO promoter fusion was not different in the wild-type and flhDC strains, it was marginally complemented, 1·5- to twofold, by flhDC in trans. The promoters of yegH, hns, icc and hupB, with HI below 18 but weak FlhD2C2 binding (KD 160250 nM), were not activated, as was the case for the rcsA and argR control sequences with KD values of 356 and >450 nM.


Table 2. In vivo transcriptional activity of FlhD2C2 bound promoters Values shown are peak β-galactosidase activity (x102 Miller units) of single-copy lacZ fusions in E. coli wild-type and flhDC null mutant strains. Mean values from three experiments, error<15 %, are shown. Restoration to wild-type activity in the MC1000 flhDC mutant by flhDC expressed in trans is denoted by + or .


Table 3 summarizes the findings for the 13 test promoter regions analysed experimentally: similarity to the consensus binding sequence (HI), in vitro FlhD2C2 binding affinity and in vivo promoter activation by FlhD2C2. Low binding site HI correlates with low KD, in other words, strong binding, and in turn KD correlates with activation. The data indicate a KD threshold of about 100200 nM required for in vivo activation by FlhD2C2, but it seems that the location of the binding site with respect to the σ70 promoter is also critical. All seven of the genes activated in vivo, including gltI, have putative FlhD2C2 binding sites which overlap by 1 or 2 bp the known or likely σ70 35 motif. Those promoter regions that bound, but were nonetheless not activated, that is, those of yegH, hns, icc, rcsA and argR, do not show this binding site overlap. The only apparent exception to this is the hupB promoter, which was not activated in this assay.


Table 3. Characteristics of putative regulon promoters Overlap of the FlhD2C2 by 12 bp with a putative or confirmed σ70 35 box is shown as +; another location of the site between 12 and +190 bp is indicated by . ?, Not known. The KD (nM; the concentration required to achieve 50 % binding) was calculated from the plots in Fig. 1. Promoter activation is expressed as the ratio of in vivo lacZ fusion activity in wild-type and flhDC mutant strains, derived from Table 2.


To assess experimentally the influence of spacing between the FlhD2C2 binding site and the σ70 35 sequence (TTGACA), the binding site overlapping the strongly flhDC-activated flagellar class II flhB promoter was moved 5' 80 bp away from its 35 motif (TTGAAC), while keeping the σ70 promoter and FlhD2C2 binding sequence intact (Fig. 2A). The KD for in vitro binding of FlhD2C2 to the resulting site flhB-80 was 29 nM, comparable to the 21 nM of the wild-type binding site (Fig. 2B). However, assay of the respective chromosomal lacZ fusions in the wild-type and flhDC strains showed that the σ70 promoter of the uncoupled site was no longer activated by FlhD2C2 (Fig. 2C), and in trans overexpression of FlhD2C2 from pflhDC failed to restore promoter activation.



(34K):

Fig. 2. Uncoupling the FlhD2C2 binding site and promoter. (A) Representation of the flhBwild-type promoter fusion region (flhB-WT) and the flhB-80 derivative in which an 80 bp transcriptionally inactive DNA sequence was inserted between the 3' FlhD2C2 box (CCTTACTCAAACCATT) and the 35 sequence (TTGAAC). (B) DNA-band shift of flhB-WT and flhB-80 probes, performed as in Fig. 1. (C) Activity of flhB-WT and flhB-80 chromosomal promoter fusions (as in Fig. 2). The means of triplicate experiments, error10 %, are shown. WT, wild-type.
We have set out to identify non-flagellar E. coli genes directly under the control of the flagella master transcriptional regulator FlhD2C2, in other words to ascertain the nature of a putative wider regulon. We identified possible FlhD2C2 binding sites by comparing every 4244 bp genomic sequence with the experimentally defined consensus FlhD2C2 binding site (Berg & Von Hippel, 1988; Lewis et al., 1994; Claret & Hughes, 2002). The computational promoter search identified a pool of 47 sequences 5' of putative gene promoters, with an HI below the arbitrary cut off of 18. These were located upstream of all eight class II flagellar promoters and 39 non-flagellar promoters, a figure comparable with the 69 putative E. coli LexA regulon binding sites identified with an HI below 15 (Lewis et al., 1994; Fernandez de Henestrosa et al., 2000). Nine non-flagellar sequences with HI values ranging from 10·8 to 15·5 were analysed by in vitro binding of reconstituted active FlhD2C2 and comparison of in vivo promoter activity in wild-type and flhDC mutant E. coli.

All nine non-flagellar sequences were bound by FlhD2C2, with affinities (KD 38250 nM) one- to 20-fold weaker than those of the four representative class II flagella promoter sequences tested (flgB, flhB, fliA and fliL; HI 6·514·7; KD 1243 nM). No false positive sites were identified, which contrasts with the LexA screen, in which the dinJ promoter of HI 7·1 was not bound in vitro (Fernandez de Henestrosa et al., 2000). Like the four class II flagella promoters, four of the nine non-flagellar promoters tested were FlhD2C2 regulated: b1904 (HI 10·5) was bound strongly (KD 38 nM) and activated more than 30 fold; b2446 (HI 11·5) and wzzfepE (HI 14·9) had KD values of 60 nM and 86 nM and were activated tenfold and sixfold, respectively. Activation of the weakly bound gltI promoter (HI 13·7, KD 220 nM) was twofold higher in the wild-type than in the flhDC null mutant, but as was the case with b1904, b2446 and wzzfepE, it was strongly activated by flhDC in trans.

The four FlhD2C2 bound and regulated non-flagellar genes b1904, b2446, wzzfepE and gltI are not in the same operon. Gene b1904 is located at 42·81 min, adjacent to ftn (encoding the iron storage protein ferritin) in the 10 kb region between the fliAZY and flagellar flhDC operons (43·09 and 42·59 min, respectively). It has no known function or significant homologues, but does have a putative outer membrane lipoprotein cleavage signal (LGAC) near the N-terminus of its deduced amino acid sequence. The product of the b2446 gene also has no known function or homology and lies at 55·18 min in an as yet anonymous region of the chromosome. It has a DNA-binding AT-hook motif, present in many transcriptional regulators (Bustin & Reeves, 1996; Cayuela et al., 2003). The wzzfepE gene (13·31 min) was originally named fepE, putatively encoding part of the enterobactin uptake system in E. coli, but its role in iron transport has not been established (Ozenberger et al., 1987; Murray et al., 2003), and wzz fepE has been shown to modulate O-antigen chain length in the polysaccharide capsule of S. typhimurium (Murray et al., 2003). Polysaccharide is an important factor in the swarming motility of S. typhimurium and P. mirabilis (Gygi et al., 1995; Toguchi et al., 2000), and a recent microarray study observed upregulation of the wzzfepE gene during swarming of S. typhimurium (Wang et al., 2004). The fourth gene, gltI, encodes a periplasmic glutamate/aspartate binding protein (Urbanowski et al., 2000) lying at 14·79 min in, or 5' of, the gltJKL operon responsible for glutamate uptake. It is possible that FlhD2C2 regulation of these genes may reflect connections to motility, but this is unknown. We searched for FlhD2C2 binding sites in the genomes of the uropathogenic (UPEC) E. coli CFT073 (accession no. NC_004431) and the enterohaemorrhagic (EHEC) E. coli O157 (accession no. AE00517) to assess if there might be co-regulation of flagellar and virulence genes. The findings (not shown) were very similar to those for E. coli K-12, and no putative sites were identified in the pathogenicity islands of either organism.

In the four FlhD2C2-dependent non-flagellar promoters, the binding site overlaps the putative σ70 35 motif by 12 bp (Fig. 3). These four σ70 35 motifs have 50 % identity with the consensus (TTGACA), and in each case TT nucleotides form the end of the right hand (3') FlhD2C2 box. This overlap is also seen in all flagellar class II gene promoters from E. coli, S. typhimurium and P. mirabilis (Fig. 3) (Kutsukake et al., 1990; Liu et al., 1995; Claret & Hughes, 2002). This identity strengthens the likelihood that FlhD2C2 activates flagellar and non-flagellar genes by the same mechanism, in other words, as a class I transcription factor contacting the α-C-terminal domain of the RNA polymerase holoenzyme during transcriptional initiation (Liu et al., 1995; Claret & Hughes, 2002). The significance of this proximity was emphasized by uncoupling FlhD2C2 binding and promoter dependence following insertion of 80 bp of transcriptionally inert DNA between the FlhD2C2 binding site and the 35 motif. In the low-affinity non-regulated σ70 promoter regions of argR, rcsA, icc/cpdA and hns, the FlhD2C2 binding site does not overlap the 35 site: it is separated by 50 bp or more. The only possible exception to this is the weak FlhD2C2 binding site (HI 15·5, KD 250 nM) of the hupB P3 promoter, which was not regulated in the in vivo assay. However, in this complex promoter region, the FlhD2C2 binding site overlaps high-affinity binding sites (KD 510 nM) for the transcriptional regulators CRP and FIS (factor for inversion stimulation), which may be dominant under the conditions tested (Claret & Rouviere-Yaniv, 1996).



(92K):

Fig. 3. Alignment of FlhD2C2 bound promoter regions. FlhD2C2 binding sequences are highlighted in grey; known or putative 10 and 35 σ70 sequences promoters are shown in bold. The class II promoters from E. coli (including the fliA, flhB and fliL promoters defined by Liu & Matsumura, 1994) are aligned with the five FlhD2C2 bound and regulated non-flagellar promoters identified in this study, including the marginally regulated yejO promoter. The flagellar class II promoters shown from S. typhimurium and P. mirabilis have been experimentally defined by Kutsukake & Ide (1995) and Claret & Hughes (2002), respectively.

The range of KD and activity values extends the possibility that FlhD2C2 can influence the expression of the hierarchy of flagellar and non-flagellar promoters via differential binding (Claret & Hughes, 2002). If the concentration of FlhD2C2 in exponentially growing E. coli is similar to the 35 nM estimated for vegetatively growing P. mirabilis (Claret & Hughes, 2000b), then the KD values for non-regulated sites are over four times higher than those for any of the flagella genes tested here (maximum 43 nM), suggesting that they may be poorly bound by FlhD2C2 in vivo. The gltI promoter has the lowest affinity (KD 220 nM) for FlhD2C2 binding and shows marginal activation in vivo, but taking all our data into account, it seems that direct and strong regulation by FlhD2C2 applies to promoters with a site that has an HI below 15 determining a KD below ∼100 nM, and which overlaps by 12 bp the σ70 35 promoter motif.

While the differential affinity of FlhD2C2 for the binding sites of its regulon promoters seems important for the sequential activation of class II gene expression, these promoters are also subject to fine tuning by FliA (σ28) (Kalir & Alon, 2004). We assessed the influence of FliA on the four novel FlhD2C2-regulated genes (wzzfepE, b2446, b1904 and gltI) by measuring the activity of the respective lacZ fusions in the MC1000 fliA : : Km strain and comparing to their activity in the wild-type strain: there was no difference except for a 50 % reduction in transcription of the gltI promoter (data not shown). The DNA sequence 5' of the gltI start codon contains a putative FliA 10 motif, GACGATAA. This may explain the difference in the regulation of the gltI and yejO promoter fusions (twofold and non-regulated), which have identical binding affinities (220 nM) and σ70 sequences.

Prüss and colleagues (Prüss et al., 2001) have postulated an extended FlhD2C2 regulon in E. coli, chiefly based on microarray studies in which the expression of several non-flagellar genes was influenced by the flhDC operon. However, their assay of corresponding multicopy plasmid transcriptional fusions did not establish direct activation of these genes by FlhD2C2. Similarly, we found no in vitro binding of FlhD2C2 to the promoter of mreB (data not shown), a gene identified in these microarray comparisons. Further microarrays have indicated regulation of genes encoding enzymes of the EntnerDoudoroff pathway by FlhD2C2 via the aer gene. This has a characteristic σ28 (FliA)-dependent promoter sequence (TAAAN15GCCGACAT) 5' of its translational start site (Park et al., 2001), but no putative FlhD2C2 binding sequence, suggesting that regulation proceeds indirectly from FlhD2C2 to fliA then aer. Our data indicate that regulation of many other of these microarray-highlighted genes is probably indirect, since we did not find any putative promoter FlhD2C2 binding sequences with an HI below 18, or indeed 22 (the lowest HI of these genes is that of napF: 22·9). The microarray comparisons did not detect regulation of the FlhD2C2 regulon genes established in our study, b1904, b2446, wzzfepE and gltI. It is possible that their transcript signals are below the detection level of the microarray technology, as was the case in microarray comparisons in Yersinia enterocolitica (Kapatral et al., 2004), which failed to detect flhDC regulation of the class II and III genes flhA, fleC and cheY, which RT-PCR analysis confirmed were subject to two- to 12-fold regulation.

The main role for FlhD2C2 is the tight control of gene expression underlying flagella biosynthesis. Our study indicates a wider FlhD2C2 regulon, in which direct activation of non-flagellar promoters follows binding of the flagellar master regulator at the RNA polymerase binding site, though less avidly than to class II flagellar promoters.

We thank Laurent Claret, Gillian Fraser and Richard Hayward for useful discussions and Keith Hayward for computer assistance. This work was supported by a Wellcome Trust Program grant (C. H.) and a Uehara Memorial Foundation overseas research fellowship (T. O.).

References

Adler, J. & Templeton, B. (1967). The effect of environmental conditions on the motility of Esherichia coli. J Gen Microbiol 46, 175184.[Medline]

Allison, C. & Hughes, C. (1991). Closely linked genetic loci required for swarm cell differentiation and multicellular migration by Proteus mirabilis. Mol Microbiol 5, 19751982.[Medline]

Allison, C., Emody, L., Coleman, N. & Hughes, C. (1994). The role of swarm cell differentiation and multicellular migration in the uropathogenicity of Proteus mirabilis. J Infect Dis 169, 11551158.[Medline]

Berg, O. G. & Von Hippel, P. H. (1988). Selection of DNA binding sites by regulatory proteins. II. The binding specificiity of the cyclic AMP receptor protein to recognition sites. J Mol Biol 200, 709723.[CrossRef][Medline]

Bustin, M. & Reeves, R. (1996). High-mobility-group chromosomal proteins, architectural components that facilitate chromatin function. Prog Nucleic Acid Res Mol Biol 54, 35100.[Medline]

Cayuela, M. L., Elias-Arnanz, M., Penalver-Mellado, M., Padmanabhan, S. & Murillo, F. J. (2003). The Stigmatella aurantiaca homolog of Myxococcus xanthus high-mobility-group A-type transcription factor CarD: insights into the functional modules of CarD and their distribution in bacteria. J Bacteriol 185, 35273537.[Abstract/Free Full Text]

Chadsey, M. S., Karlinsey, J. E. & Hughes, K. T. (1998). The flagellar anti-sigma factor FlgM actively dissociates Salmonella typhimurium σ28 RNA polymerase holoenzyme. Genes Dev 12, 31233136.[Abstract/Free Full Text]

Claret, L. & Hughes, C. (2000a). Rapid turnover of FlhD and FlhC, the flagellar regulon transcriptional activator proteins, during Proteus swarming. J Bacteriol 182, 833836.[Abstract/Free Full Text]

Claret, L. & Hughes, C. (2000b). Functions of the subunits in the FlhD2C2 transcriptional master regulator of bacterial flagellum biogenesis and swarming. J Mol Biol 303, 467478.[CrossRef][Medline]

Claret, L. & Hughes, C. (2002). Interaction of the atypical prokaryotic transcription activator FlhD2C2 with early promoters of the flagellar gene hierarchy. J Mol Biol 321, 185199.[CrossRef][Medline]

Claret, L. & Rouviere-Yaniv, J. (1996). Regulation of HU alpha and HU beta by CRP and FIS in Escherichia coli. J Mol Biol 263, 126139.[CrossRef][Medline]

Dennis, J. J. & Zylstra, G. J. (1998). Plasposons: modular self-cloning minitransposon derivatives for rapid genetic analysis of Gram-negative bacterial genomes. Appl Environ Microbiol 64, 27102715.[Abstract/Free Full Text]

Dufour, A., Furness, R. B. & Hughes, C. (1998). Novel genes that upregulate the Proteus mirabilis flhDC master operon controlling flagellar biogenesis and swarming. Mol Microbiol 29, 741751.[CrossRef][Medline]

Fernandez de Henestrosa, A. R., Ogi, T., Aoyagi, S., Chafin, D., Hayes, J. J., Ohmori, H. & Woodgate, R. (2000). Identification of additional genes belonging to the LexA regulon in Escherichia coli. Mol Microbiol 35, 15601572.[CrossRef][Medline]

Francez-Charlot, A., Laugel, B., Van Gemert, A., Dubarry, N., Wiorowski, F., Castanie-Cornet, M. P., Gutierrez, C. & Cam, K. (2003). RcsCDB His-Asp phosphorelay system negatively regulates the flhDC operon in Escherichia coli. Mol Microbiol 49, 823832.[CrossRef][Medline]

Fraser, G. M., Claret, L., Furness, R., Gupta, S. & Hughes, C. (2002). Swarming-coupled expression of the Proteus mirabilis hpmBA haemolysin operon. Microbiology 148, 21912201.[Abstract/Free Full Text]

Furness, R. B., Fraser, G. M., Hay, N. A. & Hughes, C. (1997). Negative feedback from a Proteus class II flagellum export defect to the flhDC master operon controlling cell division and flagellum assembly. J Bacteriol 179, 55855588.[Abstract/Free Full Text]

Givaudan, A. & Lanois, A. (2000). flhDC, the flagellar master operon of Xenorhabdus nematophilus, requirement for motility, lipolysis, extracellular hemolysis, and full virulence in insects. J Bacteriol 182, 107115.[Abstract/Free Full Text]

Givskov, M., Eberl, L., Christiansen, G., Benedik, M. J. & Molin, S. (1995). Induction of phospholipase and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD. Mol Microbiol 15, 445454.[Medline]

Gygi, D., Rahman, M. M., Lai, H. C., Carlson, R., Guard-Petter, J. & Hughes, C. (1995). A cell-surface polysaccharide that facilitates rapid population migration by differentiated swarm cells of Proteus mirabilis. Mol Microbiol 17, 11671175.[CrossRef][Medline]

Ide, N., Ikebe, T. & Kutsukake, K. (1999). Reevaluation of the promoter structure of the class 3 flagellar operons of Escherichia coli and Salmonella. Genes Genet Syst 74, 113116.[CrossRef][Medline]

Kalir, S. & Alon, U. (2004). Using a quantitative blueprint to reprogram the dynamics of the flagella gene network. Cell 117, 713720.[CrossRef][Medline]

Kalir, S., McClure, J., Pabbaraju, K., Southward, C., Ronen, M., Leibler, S., Surette, M. G. & Alon, U. (2001). Ordering genes in a flagella pathway by analysis of expression kinetics from living bacteria. Science 292, 20802083.[Abstract/Free Full Text]

Kang, Y., Durfee, T., Glasner, J. D., Qiu, Y., Frisch, D., Winterberg, K. M. & Blattner, F. R. (2004). Systematic mutagenesis of the Escherichia coli genome. J Bacteriol 186, 49214930.[Abstract/Free Full Text]

Kapatral, V., Campbell, J. W., Minnich, S. A., Thomson, N. R., Matsumura, P. & Pruss, B. M. (2004). Gene array analysis of Yersinia enterocolitica FlhD and FlhC: regulation of enzymes affecting synthesis and degradation of carbamoylphosphate. Microbiology 150, 22892300.[Abstract/Free Full Text]

Karlinsey, J. E., Tanaka, S., Bettenworth, V., Yamaguchi, S., Boos, W., Aizawa, S. I. & Hughes, K. T. (2000). Completion of the hook-basal body complex of the Salmonella typhimurium flagellum is coupled to FlgM secretion and fliC transcription. Mol Microbiol 37, 12201231.[CrossRef][Medline]

Kim, D. J., Boylan, B., George, N. & Forst, S. (2003). Inactivation of ompR promotes precocious swarming and flhDC expression in Xenorhabdus nematophila. J Bacteriol 185, 52905294.[Abstract/Free Full Text]

Kutsukake, K. & Ide, N. (1995). Transcriptional analysis of the flgK and fliD operons of Salmonella typhimurium which encode flagellar hook-associated proteins. Mol Gen Genet 247, 275281.[CrossRef][Medline]

Kutsukake, K., Ohya, Y. & Iino, T. (1990). Transcriptional analysis of the flagellar regulon of Salmonella typhimurium. J Bacteriol 172, 741747.[Abstract/Free Full Text]

Lewis, L. K., Harlow, G. R., Gregg-Jolly, L. A. & Mount, D. W. (1994). Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli. J Mol Biol 241, 507523.[CrossRef][Medline]

Liu, X. & Matsumura, P. (1994). The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons. J Bacteriol 176, 73457351.[Abstract/Free Full Text]

Liu, X. & Matsumura, P. (1996). Differential regulation of multiple overlapping promoters in flagellar class II operons in Escherichia coli. Mol Microbiol 21, 613620.[CrossRef][Medline]

Liu, X., Fujita, N., Ishihama, A. & Matsumura, P. (1995). The C-terminal region of the alpha subunit of Escherichia coli RNA polymerase is required for transcriptional activation of the flagellar level II operons by the FlhD/FlhC complex. J Bacteriol 177, 51865188.[Abstract/Free Full Text]

Macnab, R. M. (1996). Flagella and Motility. In Escherichia coli and Salmonella typhimurium, Cellular and Molecular Biology, pp. 123145. Edited by F. C. Neidhardt. Washington, DC: American Society for Microbiology.

Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbour, NY: Cold Spring Harbor Laboratory.

Mizushima, T., Tomura, A., Shinpuku, T., Miki, T. & Sekimizu, K. (1994). Loss of flagellation in dnaA mutants of Escherichia coli. J Bacteriol 176, 55445546.[Abstract/Free Full Text]

Murray, G. L., Attridge, S. R. & Morona, R. (2003). Regulation of Salmonella typhimurium lipopolysaccharide O antigen chain length is required for virulence; identification of FepE as a second Wzz. Mol Microbiol 47, 13951406.[CrossRef][Medline]

Ozenberger, B. A., Nahlik, M. S. & McIntosh, M. A. (1987). Genetic organization of multiple fep genes encoding ferric enterobactin transport functions in Escherichia coli. J Bacteriol 169, 36383646.[Abstract/Free Full Text]

Park, K., Choi, S., Ko, M. & Park, C. (2001). Novel σF-dependent genes of Escherichia coli found using a specified promoter consensus. FEMS Microbiol Lett 202, 243250.[Medline]

Powell, B. S., Rivas, M. P., Court, D. L., Nakamura, Y. & Turnbough, C. L., Jr (1994). Rapid confirmation of single copy lambda prophage integration by PCR. Nucleic Acids Res 22, 57655766.[Free Full Text]

Prüss, B. M., Liu, X., Hendrickson, W. & Matsumura, P. (2001). FlhD/FlhC-regulated promoters analyzed by gene array and lacZ gene fusions. FEMS Microbiol Lett 197, 9197.[Medline]

Prüss, B. M., Campbell, J. W., Van Dyk, T. K., Zhu, C., Kogan, Y. & Matsumura, P. (2003). FlhD/FlhC is a regulator of anaerobic respiration and the EntnerDoudoroff pathway through induction of the methyl-accepting chemotaxis protein Aer. J Bacteriol 185, 534543.[Abstract/Free Full Text]

Simons, R. W., Houman, F. & Kleckner, N. (1987). Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53, 8596.[CrossRef][Medline]

Soutourina, O. A. & Bertin, P. N. (2003). Regulation cascade of flagellar expression in Gram-negative bacteria. FEMS Microbiol Rev 27, 505523.[CrossRef][Medline]

Soutourina, O., Kolb, A., Krin, E., Laurent-Winter, C., Rimsky, S., Danchin, A. & Bertin, P. (1999). Multiple control of flagellum biosynthesis in Escherichia coli, role of H-NS protein and the cyclic AMP-catabolite activator protein complex in transcription of the flhDC master operon. J Bacteriol 181, 75007508.[Abstract/Free Full Text]

Toguchi, A., Siano, M., Burkart, M. & Harshey, R. M. (2000). Genetics of swarming motility in Salmonella enterica serovar typhimurium: critical role for lipopolysaccharide. J Bacteriol 182, 63086321.[Abstract/Free Full Text]

Tomoyasu, T., Takaya, A., Isogai, E. & Yamamoto, T. (2003). Turnover of FlhD and FlhC, master regulator proteins for Salmonella flagellum biogenesis, by the ATP-dependent ClpXP protease. Mol Microbiol 48, 443452.[CrossRef][Medline]

Urbanowski, M. L., Stauffer, L. T. & Stauffer, G. V. (2000). The gcvB gene encodes a small untranslated RNA involved in expression of the dipeptide and oligopeptide transport systems in Escherichia coli. Mol Microbiol 37, 856868.[CrossRef][Medline]

Wang, Q., Frye, J. G., McClelland, M. & Harshey, R. M. (2004). Gene expression patterns during swarming in Salmonella typhimurium: genes specific to surface growth and putative new motility and pathogenicity genes. Mol Microbiol 52, 169187.[CrossRef][Medline]

Young, G. M., Smith, M. J., Minnich, S. A. & Miller, V. L. (1999). The Yersinia enterocolitica motility master regulatory operon, flhDC, is required for flagellin production, swimming motility, and swarming motility. J Bacteriol 181, 28232833.[Abstract/Free Full Text]

Received 10 January 2005; revised 3 March 2005; accepted 7 March 2005.