Research Article

Prc protease promotes mucoidy in mucA mutants of Pseudomonas aeruginosa

Microbiology 2005; 151(7):2251 · https://doi.org/10.1099/mic.0.27772-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

Mucoid strains of Pseudomonas aeruginosa that overproduce the exopolysaccharide alginate are a frequent cause of chronic respiratory infections in cystic fibrosis (CF) patients. The overproduction of alginate by these strains is often caused by mutations within mucA of the algU mucABCD gene cluster. This gene cluster encodes an extreme stress response system composed of the ECF alternative sigma factor AlgU, the anti-sigma factor MucA located in the inner membrane and the negative regulator MucB located in the periplasm. Most of the mutations in mucA found in mucoid strains cause a truncation of the C-terminal, periplasmic domain of MucA. The most significant effect of these mutations appears to be to reduce the levels of MucA. PA3257 (prc) was identified as a regulator of alginate production in P. aeruginosa through the isolation and study of mutations that partially suppressed the mucoid phenotype of a mucA22 strain. The suppressor of mucoidy (som) mutants isolated produced very little alginate when grown on LB medium, but were still mucoid when grown on Pseudomonas isolation agar. These som mutations and another previously isolated suppressor mutation were complemented by cosmids or plasmids carrying PA3257. PA3257 is predicted to encode a periplasmic protease similar to Prc or Tsp of Escherichia coli. Sequencing of prc from three strains with som suppressor mutations confirmed that each had a mutation within the prc coding region. The authors propose that Prc acts to degrade mutant forms of MucA. Additional evidence in support of this hypothesis is: (1) transcription from the AlgU-regulated algD reporter was reduced in som mutants; (2) inactivation of prc affected alginate production in mucoid strains with other mucA mutations found in CF isolates; (3) inactivation or overexpression of prc did not affect alginate production in strains with wild-type MucA.
Abbreviations: CF, cystic fibrosis; PIA, Pseudomonas isolation agar
A major complication of cystic fibrosis (CF) is chronic respiratory infections caused by mucoid strains of Pseudomonas aeruginosa that overproduce the exopolysaccharide alginate. Individuals with CF are prone to bacterial respiratory infections because they have mutations in a chloride ion transporter called CFTR that leads to the buildup of a sticky mucus in their airways that impairs mucociliary clearance (Govan & Deretic, 1996). CF patients are usually initially colonized by nonmucoid strains of P. aeruginosa, but eventually mucoid strains, which overproduce alginate, appear and become the dominant type of isolates (Govan & Deretic, 1996). There are several possible mechanisms by which the alginate coating may contribute to the virulence of P. aeruginosa. These include the ability to inhibit phagocytosis, increased resistance to antibiotics and reactive oxygen intermediates, and alterations of the host's immune response (Govan & Deretic, 1996).

The most frequent cause of the conversion to the mucoid phenotype is mutations within mucA (Boucher et al., 1997b). The mucA gene is located within the algU mucABCD gene cluster that appears to encode the most important regulators of alginate production in P. aeruginosa (Govan & Deretic, 1996). The algU and mucB genes of this cluster have also been called algT and algN, respectively (DeVries & Ohman, 1994; Goldberg et al., 1993). The algU mucABCD gene cluster appears to encode factors that form a regulatory system found in many bacteria that senses and signals stressful extracytoplasmic conditions (Govan & Deretic, 1996; Missiakas & Raina, 1998). In P. aeruginosa, AlgU is an alternative sigma factor that directs the transcription of alginate biosynthetic genes at the algD promoter and of other genes that encode protective factors (Martin et al., 1993, 1994; Schurr et al., 1995). MucA has been demonstrated to be an anti-sigma factor of AlgU by experiments that showed that MucA can bind to AlgU and inhibit its activity in vitro (Schurr et al., 1996; Xie et al., 1996). The MucA protein is located in the inner membrane via a single transmembrane domain with its N-terminus in the cytoplasm and its C-terminus in the periplasm (Mathee et al., 1997). Interestingly, almost all the mutations in mucA found in mucoid isolates of P. aeruginosa cause a truncation or alteration of the C-terminal, periplasmic domain of MucA protein (Boucher et al., 1997b). The MucB protein is located in the periplasm and appears to help MucA inhibit AlgU by interacting with the C-terminal, periplasmic domain of MucA (Rowen & Deretic, 2000; Schurr et al., 1996). MucC is predicted to be an inner-membrane protein that appears to play only a minor role in regulation, by an undefined mechanism (Boucher et al., 1997a). MucD is a periplasmic protease homologous to HtrA or DegP of Escherichia coli that is thought to remove misfolded proteins in the periplasm (Boucher et al., 1996, 1997a).

Recent studies of the homologous σE extracytoplasmic stress response system in E. coli indicate that proteases play a critical role in regulating this system (Ades et al., 1999; Alba et al., 2002; Kanehara et al., 2002; Walsh et al., 2003). In these studies, it was observed that the key event in the activation of σE-dependent transcription was the sequential cleavage of RseA, a homologue of MucA, by DegS and then YeaL. DegS is a membrane-anchored, periplasmic serine protease (Ades et al., 1999). The activity of DegS appears to be activated by its PDZ domain binding to proteins with a C-terminal sequence YQF that is found on several outer-membrane proteins (Walsh et al., 2003). PDZ domains are a conserved domain motif found in many proteins and they appear to mediate interaction between proteins through the recognition of C-terminal sequences. After activation, DegS cleaves off the last 68 amino acids of the C-terminal, periplasmic domain of RseA (Walsh et al., 2003). The cleavage of RseA by DegS then appears to make RseA a substrate for cleavage by the zinc metalloprotease YeaL (Alba et al., 2002; Kanehara et al., 2002). YeaL is located in the inner membrane via four transmembrane domains and contains a PDZ domain located in the periplasm and a zinc protease domain located in the cytoplasm (Kanehara et al., 2001). YeaL is similar to the site-2 protease (S2P) of mammals. S2P acts to activate SREBP (sterol regulatory element binding protein) by cleavage of one of its transmembrane domains that span the endoplasmic reticulum membrane after another protease, site-1 protease (S1P), first cleaves a domain of SREBP located in the lumen (Brown et al., 2000). By analogy, YeaL is thought to cleave the transmembrane domain of RseA, and this cleavage of RseA is thought to cause the remainder of RseA to be rapidly degraded by other proteases (Alba et al., 2002; Kanehara et al., 2002). However, the exact mechanism by which YeaL is activated to cleave RseA is not known. It has been recently observed that the presence of portions of the RseA periplasmic domain that contain a high number of glutamine residues appears to inhibit YeaL activity and the removal of these residues by deletion or proteolysis by DegS makes RseA a substrate for YeaL (Kanehara et al., 2003). These observations also help to explain how extracytoplasmic stress response systems actually sense stress. It is now hypothesized that during stressful conditions, outer-membrane proteins with the C-terminal YQF sequence become misfolded, and their free C-termini become bound by the PDZ domains of DegS, thereby activating the protease to cleave RseA (Walsh et al., 2003). The elimination of RseA frees σE molecules to activate transcription.

Several observations made in P. aeruginosa suggest that proteases could also play a role in activating alginate production in mucoid strains by affecting MucA levels. First, Boucher et al. (1997b) observed that almost all of the mutations in mucA found in mucoid isolates from CF patients cause a truncation of the C-terminal, periplasmic domain of the MucA protein. Rowen & Deretic (2000) later observed that the mutations in the periplasmic domain of MucA did not eliminate the ability of MucA to bind and inhibit AlgU, but instead affected the steady-state levels of MucA and its interaction with MucB. These results suggest that the truncation of MucA may make the protein more susceptible to proteolysis. In this study, we report that the predicted periplasmic protease encoded by PA3257 (prc) plays a role in regulating alginate production in mucoid mucA strains. We hypothesize that Prc promotes alginate production in mucoid CF isolates with mucA mutations by degrading the truncated forms of MucA produced in those strains.

Bacterial strains and growth conditions.
P. aeruginosa strains and plasmids used in this study are listed in Table 1. All the P. aeruginosa strains studied are derivatives of PAO1 except for the CF strains that were isolated from CF patients (see Results; Boucher et al., 1997b). P. aeruginosa was grown on Pseudomonas isolation agar (PIA, Difco) or LB (Lennox formulation) supplemented with carbenicillin (300600 µg ml1), tetracycline (300 or 50 µg ml1, for PIA and LB respectively), gentamicin (150 or 50 µg ml1, respectively), sucrose (10 %, v/v), 300 mM NaCl or IPTG (1 mM) when required. E. coli strains were grown on LB supplemented with ampicillin (100 µg ml1), tetracycline (15 µg ml1) or kanamycin (50 µg ml1) when required.


Table 1. Strains and plasmids


Genetic manipulations.
We isolated our suppressor-of-mucoidy (som) mutants by maintaining a pure culture of mucoid cells of mucA22 (or alternatively mucAΔG440) strain PAO578 on LB agar plates for 48 days at room temperature. Cells were streaked to isolation from the maintained culture and their phenotype determined on LB and PIA media. For the complementation studies, cosmids from the minimal tiling path (MTP) library (Pseudomonas Genetic Stock Center, ) or plasmids were introduced into the P. aeruginosa strains via triparental conjugation using previously described methods (Konyecsni & Deretic, 1988). To measure transcription from the algD promoter, we introduced the algD : : xylE reporter construct from the plasmid pHYDX (Yu et al., 1995) into the chromosome of the strains via a single crossover. To insertionally inactivate prc, we employed a two-step allelic exchange procedure using either the prc : : Tcr-containing plasmid pDR184 or the prc : : Gmr-containing plasmid pDR147. In either case, we first selected single-crossover merodiploid exconjugants on PIA supplemented with carbenicillin. For the prc : : Tcr strains, the double recombinants were identified as Tcr Cbs cells that were isolated after passage of the merodiploid on PIA supplemented with 10 % (w/v) sucrose to select for the loss of the plasmid vector sequences. For the prc : : Gmr strains, the double recombinants were identified as Gmr Cbs cells after passage on PIA supplemented with 10 % (w/v) sucrose. All gene replacements were confirmed by PCR with primers to sites contained in the plasmid and to sites outside of the sequences carried in the plasmid.

DNA manipulations.
To test complementation by prc, the prc sequences from MTP194 were amplified with oligos oDR25 (CCTCTAGAGAACGCCTTGCACAATTGG) and oDR26 (GTGGATCCGCGTTGTCGGCAGAGTAGT), which creates XbaI and HindIII restriction sites on each end respectively (underlined). The resulting PCR fragment was ligated into pBluescript KS+ (Stratagene) after digestion with XbaI and BamHI to create pDR142. Plasmid pDR145 was then created by ligation of the prc-containing HindIIIXbaI fragment from pDR142 into pVDZ'2 (Deretic et al., 1987). To insertionally inactivate prc, we deleted the portion of the prc coding region from nucleotide 218 to 1445 by digestion of pDR142 with BglII. To make the prc : : Tcr allele, we inserted a PCR product containing the Tcr gene from pALTER-1 (Promega) that was generated by amplification with oligos oDR67 ATAGATCTGCGAGCGGTATCAGCTCA and oDR68 ATAGATCTGTGCGGCTGCTGGAGATG) and digestion with BglII (the underlined bases show the BglII sites created). To make the prc : : Gmr allele, a BamHI fragment containing the Gmr cassette from pkI11G was inserted into BglII-digested pDR142. XhoI fragments containing the prc : : Tcr and prc : : Gmr alleles were then cloned into a SalI site within the suicide vector pCVD442 to create pDR184 and pDR147 respectively. To overexpress prc, we amplified the prc gene from 26 bp upstream of the predicted start codon to 97 bp downstream of the predicted stop codon from genomic DNA by using oligos oDR49 (TTGGATCCTTACTCCGCCATCAGTCGAA) and oDR50 (TTCTCGAGTGGAACGCTCTCGTGACAAT). The resulting PCR product was digested with BamHI and XhoI and ligated behind the tac promoter of BamHI/SalI-digested pVDtac24 to create ptac-prc.

Sequencing of prc from PAO578, PAO578-2, PAO578-21 and PAO578-23.
We amplified the prc sequence from each strain by using oligos oDR25 and oDR26 and ligated the resulting PCR products into pGEM-T Easy (Promega). The nucleotide sequence of the coding region of prc was determined on both strands of one PCR product for each strain. Any differences were confirmed by sequencing the altered region from three independent clones, two of which were derived from different PCR reactions.

Enzyme and alginate assays.
Catechol 2,3-dioxygenase activity was measured in sonic extracts as previously described (Yu et al., 1995). Alginate assays were performed as described by Knutson & Jeanes (1976) with slight modifications.

Isolation of suppressor of mucoidy (som) mutants
The mucoid phenotype of many mucoid strains is unstable during passage in the laboratory due to the appearance of a second-site suppressor mutation (DeVries & Ohman, 1994; Govan & Deretic, 1996; Schurr et al., 1994). The results of Schurr et al. (1994) suggested that suppressor mutations can occur at multiple sites in a mucA22 strain. They observed three distinct phenotypes in strains with suppressor mutations due to differences in their alginate production during growth on LB and PIA medium. One type of suppressor mutation, referred to as type III, eliminated alginate production under all growth conditions, while another type, referred to as type II, only eliminated it under some growth conditions, such as LB medium. That study also reported that two out of three strains with the type III phenotype tested had a mutation in algU. Other studies have also reported that strains with suppressor mutations frequently have a mutation in algU (DeVries & Ohman, 1994; Wyckoff et al., 2002). These results suggest that while mutations in algU may be the most frequent cause of suppression, they are not the only cause, and that studies of strains with suppressor mutations may identify additional factors that regulate alginate production. We decided to begin by investigating the mechanism of mucoid suppression in strains that had a phenotype similar to the previously reported type II phenotype. We reasoned that these strains are likely to have a mutation in a factor that plays a role in regulating alginate production.

We first attempted to isolate strains with a suppressor mutation that produced a similar phenotype to the previously described type II, namely, non-mucoid on LB and mucoid on PIA. To obtain suppressor mutations, we simply checked the phenotype of cells obtained from a culture of mucA22 strain PAO578 that were being maintained on LB agar at room temperature for several days. After 4 days, we began to see the appearance of cells that were non-mucoid or only slightly mucoid when grown on LB medium. We then determined the phenotype of these cells on PIA. The vast majority of the suppressor mutants we tested were also non-mucoid to slightly mucoid on PIA medium, but occasionally we isolated a strain that was mucoid on PIA. We ultimately isolated eight strains that showed a phenotype similar to a strain (PAO578-2) with a type II phenotype (Fig. 1). We referred to the suppressor mutation in all these strains as som (suppressor of mucoidy). Measurements of alginate levels in som strains indicated that these strains produced very little alginate while growing on LB, and produced high but still somewhat reduced levels of alginate when grown on PIA as compared to the original PAO578 strain (compare PAO578-21 and PAO578-23 to PAO578 in Table 2). The alginate levels seen in the som mutants we isolated were similar to those of a strain with a type II suppressor mutation, PAO578-2 (Fig. 1, Table 2). Strain PAO578-2 has also been referred to as PAO578 type II or PAO578(II) (Boucher et al., 1996; Schurr et al., 1994).



(123K):

Fig. 1. Phenotype of the mucA22 strain PAO578 and three strains with som suppressor mutations derived from it: the growth of PAO578, PAO578-2, PAO578-21 and PAO578-23 (genotypes in parentheses) on LB medium after incubation for 2 days at 37 °C. Strain PAO578-2 contains the previously described suppressor mutation that confers the type II phenotype (Schurr et al., 1994), while PAO578-21 and PAO578-23 contain som suppressor mutations isolated in this study.

Table 2. Alginate production in strains with prc mutations


Complementation of som mutations by PA3257 (prc)
To identify the gene or genes mutated in the strains with som mutations, we sought to identify genomic fragments that restored the mucoid phenotype to two strains with som mutations (PAO578-21 and PAO578-23) when grown on LB medium. For this process, we introduced all 338 members of the minimal tiling path (MTP) cosmid library obtained from the Pseudomonas Genetic Stock Center () into PAO578-21 and PAO578-23. This library was created from a larger cosmid library of P. aeruginosa strain PAO1293 originally created in the laboratory of Bruce Holloway (Ratnaningsih et al., 1990). We discovered two cosmids, MTP194 and MTP195 (or alternatively pMO011713 and pMO013317, respectively), which restored alginate production in PAO578-21 and PAO578-23 to levels similar to those seen in the parental strain PAO578 with a vector plasmid (Table 3). To rule out the possibility that the cosmids themselves were able to cause an increase in alginate production, we introduced both cosmids into PAO578 and the wild-type strain PAO1. No significant change in alginate production was observed in either PAO578 or PAO1 when they carried MTP194 or MTP195 (Table 3). Analysis of the sequences reported to be contained in MTP194 and MTP195 revealed that they both contained an approximately 11 kb region of the P. aeruginosa genome that spans nucleotides 3641025 to 3652056 (Fig. 2) (Ratnaningsih et al., 1990; Stover et al., 2000). Among the nine predicted reading frames contained within this region was PA3257 or prc. PA3257 is predicted to encode a periplasmic protease similar to a protease called Prc or Tsp in E. coli (Stover et al., 2000). Since mutations in a protease that acts to degrade the anti-sigma factor MucA would be predicted to reduce alginate production, we tested whether PA3257 prc could complement som mutations. The introduction of the prc-containing plasmid pDR145 into either PAO578-21 or PAO578-23 restored their alginate production to levels similar to those seen in PAO578 or in PAO578-21 and PAO578-23 with either MTP194 or MTP195 (Table 3). We also observed that the introduction of prc-containing plasmids, particularly pDR145, into the som strains or PAO578 increased the frequency of the appearance of nonmucoid cells during the passage of pure cultures of these strains. This sometimes caused a mixed population of nonmucoid and mucoid cells to be observed on plates set up for alginate assays. We hypothesized that these cells had higher Prc activity than normal because they carried prc on a plasmid and this increased the selection for suppressor mutations that are normally observed in mucoid mucA strains. Therefore, we only measured alginate levels from cultures that appeared to contain only mucoid cells. However, we cannot exclude that some of the cells in the population had suppressor mutations; this would explain why we observed somewhat lower alginate levels and more variation in results in some of the strains when they were carrying pDR145. Introduction of the plasmid vector pVDZ'2 (Table 3) or cosmids lacking prc (data not shown) into PAO578-21 or PAO578-23 did not cause an increase in alginate production. These results suggest that PAO578-21 and PAO578-23 have a mutation in prc and that mutations in prc can suppress alginate production in mucA22 strains.


Table 3. Complemention of som mutations by prc-containing plasmids



(10K):

Fig. 2. The sequences containing prc found in plasmids used in this study. The nucleotide numbering is based on the reported genomic sequence of PAO1 (Stover et al., 2000). The prc gene is depicted as a black rectangle and is predicted to span nucleotides 3642963 to 3645059. The plasmids pDR142 and pDR145 contain the sequences from nucleotide 3642361 to 3645059. Tcr, tetracycline resistance; Gmr, gentamicin resistance; tac, the tac promoter provided by pVDtac24 vector.

Prc regulates alginate production in mucA22 strains
To confirm that Prc plays a role in regulating alginate production, we examined the effect of the loss of Prc in the mucA22 strain PAO578. Insertional inactivation of prc (PAO578-184) reduced alginate production to levels similar to those seen in the som strains PAO578-21 and PAO578-23 (Table 2). The alginate levels seen in PAO578-184 were not statistically different from any of the strains with som mutations (P values from t-tests were 0·20). In addition, inactivation of prc did not cause any noticeable growth defect in P. aeruginosa. In E. coli, prc was required for growth at elevated temperature (above 42 °C) on low-salt medium (LB without salt) (Hara et al., 1991). We did not notice any defect in the growth of PAO578-184 even on LB no-salt medium at 42 or 45 °C.

PAO578-21 and PAO578-23 have a mutation in prc
To confirm that prc is mutated in PAO578-21 and PAO578-23, we PCR-amplified and sequenced prc from PAO578-21, PAO578-23 and PAO578 by PCR. The prc genes from PAO578-21 and PAO578-23 both had a mutation within the coding region as compared to the PAO578 prc sequence, which was the same as that reported for prc by the Pseudomonas genome project (Stover et al., 2000). PA3257 Prc is predicted to contain a novel type of serine protease domain (Clan SK, family S41A) and a single PDZ domain (Stover et al., 2000; Beebe et al., 2000; Rawlings et al., 2002). In PAO578-21, we observed a change of A to G at position 433 and a deletion of a C at position 483 relative to the predicted start codon. These changes would result in change of Ile-145 to Val and a frameshift after codon 161. The frameshift is predicted to cause the protein to terminate after the addition of 15 aberrant amino acids and is unlikely to encode a functional product as the protein would not contain the predicted PDZ and protease domains of the protein (Fig. 3). In PAO578-23, we detected a change of G nucleotide 877 to A. This would cause Ala-293 within the PDZ domain of Prc to be changed to Thr (Fig. 3). Since the mutation in prc in PAO578-23 only changed one amino acid, we examined whether this allele produced a protein that retained partial activity. Overexpression of the prc from either PAO578-21 or PAO578-23 did not increase alginate production in the prc-disrupted strain PAO578-184, while overexpression of wild-type prc restored alginate production (data not shown). These results indicate that strains PAO578-21 and PAO578-23 have a mutation in prc that inactivates the protein.



(6K):

Fig. 3. Location of proposed domains within the Prc protein and the alterations of the Prc sequence caused by mutations in prc observed in PAO578-21 (som-21), PAO578-23 (som-23) and PAO578-2 (som-2). The numbering represents the predicted amino acid sequence except for ΔC483, which indicates the deletion of a cytosine nucleotide at position 483 relative to the predicted start of translation of prc that was observed in PAO578-21 (som-21).

PAO578-2 and the other som strains have a mutation in prc
After determining that the suppressor mutants PAO578-21 and PAO578-23 had a mutation in prc, we examined whether prc could complement the suppressor mutations in other som strains and a strain with the type II suppressor mutation. Introduction of prc-containing plasmids into the six other som strains we isolated (data not shown) and the type II strain PAO578-2 (Table 3) restored alginate production in the strains to levels similar to those seen in PAO578. Sequencing of prc from PAO578-2 revealed a mutation that changed A-1561 to C, which changes Thr-521 within the protease domain of Prc to Pro (Fig. 3). To confirm that the change in prc observed in PAO578-2 affected Prc activity, we overexpressed the prc allele from PAO578-2 in the prc-disrupted strain PAO578-184. We did not observe any increase in alginate production upon overexpression of the prc allele from PAO578-2. These results indicate that a PAO578-2, and most likely all of our som mutants, have a mutation in prc.

Suppressor mutations in prc reduce algD transcription
The transcription of an alginate biosynthetic gene operon beginning with algD is elevated in mucoid mucA strains, due in part to the higher AlgU activity in these strains (Govan & Deretic, 1996). AlgU is thought to be more active in mucoid mucA strains because the truncated forms of MucA produced in these strains are less stable and degraded more rapidly, and thus the levels of MucA are not high enough to inhibit AlgU (Rowen & Deretic, 2000). One possible mechanism of action of Prc is that it promotes the elimination of mutant forms of MucA by cleaving off their C-terminus. Therefore we examined whether suppressor mutations in prc affected transcription from the algD promoter with an algD : : xylE reporter construct. We observed significantly less catechol 2,3-dioxygenase activity in the som mutant strains PAO578-21 and PAO578-23 [0·04±0·01 and 0·07±0·01 U (mg protein)1, respectively; means±SE] as compared to PAO578 [2·11±0·14 U (mg protein)1] when they were grown on LB medium. These results are consistent with AlgU activity being reduced in som strains and with the hypothesis that Prc acts to cleave MucA22, thereby promoting its degradation.

Prc appears to act against other mutant forms of MucA
As described, mutations in prc affected alginate production in a mucA22 strain. Since mucA22 is only one of the truncated forms of MucA observed in mucoid strains from CF patients, we examined whether the insertional inactivation of prc would also affect alginate production in two mucoid strains isolated from CF patients (CF20 and CF25) which have different mutations in mucA. CF20 is reported to have a C to T transition at nucleotide 436 relative to the start codon that creates a stop codon after 145 amino acids (Boucher et al., 1997b). CF20 is predicted to produce a protein similar in length to MucA22 of PAO578 but with different C-terminal residues (Fig. 4). CF25 is reported to have a C to T transition at position 352 that creates a stop codon which would cause the protein to terminate after only 117 amino acids (Fig. 4) (Boucher et al., 1997b). Insertional inactivation of prc in CF20 and CF25 caused a decrease in alginate production during growth on both LB and PIA (compare CF20 and CF25 to CF20-184 and CF25-184 in Fig. 4). The reduction in alginate production in both of these strains was similar to that observed in the mucA22 strain PAO578 (Fig. 4). These results indicate that prc plays a role in promoting alginate production in three different mucA mutants and is probably an important factor in contributing to high-level alginate production in most if not all mucA mutant strains.



(15K):

Fig. 4. Inactivation of prc only reduces alginate production in strains with mucA mutations. (a) The strains in which prc was inactivated and their genotype. PAO1 and PAO6857 contain wild-type mucA, while CF20, PAO578 and CF25 have a mutation in mucA. The strains with inactivated prc are indicated with -184 or -147. (b) The MucA protein predicted to be produced in each strain. The predicted transmembrane domain of MucA is indicated by a black rectangle. The numbering at the end of each MucA protein represents the last conserved amino acid predicted to be present. The addition of aberrant amino acids due to a frameshift mutation is indicated by a dashed line at the end of the protein, and the number of aberrant amino acids added before translation terminates is indicated by the number after the + sign. (c) The mean level (±SE) of alginate measured in µg (mg wet cell weight)1 from at least three independent cultures grown on the indicated media at 37 °C for 2 days (except for the cultures of the CF25 strains, which were grown for only 1 day to prevent the activation of a latent bacteriophage that occurs if the incubation continues for 2 days).

Prc does not appear to act against wild-type MucA
Since mutations in prc affected alginate production in mucA mutant strains, we also examined whether Prc would affect alginate production in cells with wild-type MucA protein. To test this possibility, we insertionally inactivated prc in the wild-type strain PAO1 and the mucB strain PAO6857. We inactivated prc in a mucB strain because the wild-type strain produces little or no alginate, whereas the mucB strain is mucoid on PIA medium and MucB is hypothesized to act to protect MucA from proteases. Therefore we felt we would be more likely to see an effect from prc inactivation in a mucB strain. We observed no decrease in alginate production in either of the strains from prc disruption (Fig. 4). We also did not observe any growth defects in the prc-inactivated strains, even when grown on hypotonic media above 42 °C. It is possible that PAO1 and PAO6857 produced too little alginate for us to observe a reduction in alginate production from a disruption of prc. Therefore we decided to test whether overexpression of prc would cause an increase in alginate production in either the wild-type strain PAO1 or the mucB strain PAO6857. For this experiment, we introduced a plasmid that contains a prc gene whose transcription was under the control of a tac promoter into the cells (ptac-prc in Fig. 3). We observed no significant increase in alginate production in wild-type cells containing ptac-prc grown under inducing conditions (LB+1 mM IPTG) as compared to cells containing a vector control (1·1±0·2 for ptac-prc versus 1·1±0·2 for vector; means±SE). We also observed no increase in the mucB strain (0·6±0·1 for ptac-prc versus 0·4±0·1 for vector). We did observe a large increase in alginate production in som mutants containing ptac-prc growing on LB+IPTG medium, indicating that the plasmid was able to produce active Prc. These results suggest that Prc does act to promote alginate production in wild-type cells and is not essential for growth. The most likely explanation is that Prc does not act to cleave wild-type MucA. In this study, we have discovered that PA3257 (prc) plays a role in promoting alginate production in mucA mutant strains of P. aeruginosa. Mutations in mucA are the most common cause of mucoidy in CF isolates (Boucher et al., 1997b). We initially discovered that Prc plays a role in promoting alginate production by characterizing spontaneous mutations that partially suppressed the mucoid phenotype of a mucA22 strain. While the spontaneous reversion of mucoid strains to a non-mucoid phenotype due to second-site suppressor mutations has been known for a while (Govan & Deretic, 1996), the reason why mucoid strains so frequently develop suppressor mutations is still unclear. The observation that the suppressor mutations frequently occur in algU has led to the hypothesis that high AlgU activity is detrimental to cells (DeVries & Ohman, 1994; Schurr et al., 1994; Wyckoff et al., 2002). The majority of the suppressor mutants we isolated were non-mucoid to slightly mucoid on both LB and PIA and probably had a mutation in algU. In contrast, mutations in prc only partially suppressed the mucoid phenotype of mucA mutants and were only occasionally isolated in our study. However, it is likely that mutations in prc also act to reduce AlgU activity, thereby at least partially relieving the detrimental effect of high AlgU activity. The observation that both alginate production and transcription from the algD promoter were reduced to near wild-type levels in mucA prc strains growing on LB medium is consistent with this hypothesis. Therefore it is likely that we were able to isolate suppressor mutations in prc because they also partially suppress the detrimental effect of elevated AlgU activity seen in mucA strains by reducing AlgU activity, especially in cells growing on LB medium.

Our results indicate that Prc plays a role in promoting alginate production in mucA mutants. Insertional inactivation of prc reduced alginate production in three strains with different mucA truncation mutations. Since Prc is predicted to encode a periplasmic protease and truncations of MucA have been shown to reduce the levels of MucA proteins (Rowen & Deretic, 2000), the simplest explanation for the mechanism of action of Prc is that it acts to promote the degradation of the MucA protein by cleaving off the C-terminus of the truncated forms of MucA produced in mucA mutant strains (Fig. 5b). A similar mechanism has been observed in the homologous σE system in E. coli. In that system, it was shown that the cleavage of a portion of the C-terminus of the MucA homologue RseA by a periplasmic protease called DegS promotes the elimination of the RseA protein by other proteases, and the elimination of RseA leads to the activation of the σE (Ades et al., 1999; Walsh et al., 2003). Our results would therefore suggest that Prc of P. aeruginosa is able to bind to and cleave the truncated MucA protein produced in all three mucA mutant strains examined. That suggestion is a little surprising because E. coli Prc has been shown to preferentially cleave proteins with nonpolar C-termni (Keiler & Sauer, 1996; Keiler et al., 1995) and the predicted C-terminal residues of the three truncated forms of MucA examined vary in their polarity. A study by Keiler & Sauer (1996) indicated that the size and polarity of the last three C-terminal residues was a major factor in determining the rate of degradation of proteins by Prc. The MucA protein produced in mucA22 strain PAO578 is predicted to end with three acidic residues (RRR), while the C-termini of the MucA proteins produced in CF20 (GAP) and CF25 (MAQ) are predicted to contain at least one nonpolar residue (underlined) (Boucher et al., 1997b). Therefore our results may indicate that the substrate specificity of P. aeruginosa Prc is somewhat broader than that of E. coli Prc, but further studies on P. aeruginosa Prc are needed to confirm this hypothesis. Another key factor in determining the ability of E. coli Prc to cleave a protein was the availability of the C-termini of the protein to be bound by Prc (Keiler et al., 1995). It is likely that the truncation of MucA disrupts the folding of the remaining residues in the periplasmic domain of MucA, which makes the C-terminus readily available for binding by the PDZ domain of Prc. This model is supported by a couple of other observations. First, we observed no effect of the loss or overexpression of Prc in cells with wild-type MucA; this suggests that Prc does not act against wild-type MucA, in which the C-terminus is more likely to be folded into a stable configuration, making it unavailable for binding by Prc. Secondly, it has been observed that a missense mutation that only changed Pro-184 of MucA to Ser (10 residues from the C-terminus) caused a reduction in the levels of the MucA protein and an increase in alginate production (Rowen & Deretic, 2000). This observation suggests that disruption of the folding of the C-terminus of full-length MucA can make the protein a better target for degradation. These results together suggest that the availability of the C-termini of MucA may be the biggest factor in determining whether Prc and possibly other proteases could act against MucA. Therefore the most likely mechanism by which Prc acts to regulate alginate production is that it cleaves the less stably folded C-termini of truncated MucA; however, this hypothesis remains to be proven experimentally.



(13K):

Fig. 5. Current model of regulation of AlgU activity by Prc acting to degrade MucA. (a) In wild-type cells, MucA forms a complex with AlgU and MucB and bound AlgU is inactive. (b) In mucA mutant cells, the alteration of the C-terminus of MucA reduces the interaction of MucA with MucB and destabilizes the C-terminus of MucA, allowing Prc to cleave MucA. this reduces the levels of MucA, which means that AlgU is not inhibited and is free to activate transcription of the alginate biosynthetic genes at the algD promoter.

Another intriguing observation of this study is that mutations in prc only partially reduced alginate production in mucA cells grown on PIA medium, while they almost eliminated alginate production in cells grown on LB medium. The underlying cause of this difference in alginate production is not known. PIA and LB differ in their nitrogen/amino acid sources (2 %, w/v, peptone versus 1 % tryptone and 0·5 % yeast extract for LB), salts (0·06 M magnesium chloride and 0·15 M potassium sulfate for PIA versus 0·09 M sodium chloride for LB) and the presence of glycerol (2 %, v/v) and Irgasan in PIA. Alginate production could be affected by differences in any of the components in PIA, since it has been observed to be affected by a variety of extracellular conditions such as temperature, nitrogen source, carbon source and osmolytes (Govan & Deretic, 1996). The response to some of these extracellular conditions may be mediated by one of the ancillary regulatory factors that act along with AlgU and MucA to control alginate production, principally by regulating transcription of the alginate biosynthetic genes (Govan & Deretic, 1996). Studies in our laboratory suggest that peptone is the most important component in PIA involved in promoting elevated alginate production in mucA prc mutants, but the mechanism by which peptone promotes alginate production is not clear. One possibility is that growth on PIA activates an ancillary factor or pathway besides AlgU that would then act to stimulate alginate production, presumably by increasing transcription at the algD promoter. However, the studies of the known ancillary factors done to date do not suggest that one of them would act in this manner. Another possibility is that another protease acts to cleave truncated forms of MucA during growth on PIA, thereby activating AlgU activity. This hypothesis is supported by the several observations. First, Prc does not appear to be essential for growth of P. aeruginosa cells and there are over 100 potential proteases in the genome of P. aeruginosa (Rawlings et al., 2002). Second, E. coli σE is activated by the cleavage of RseA by two different proteases (Alba et al., 2002; Kanehara et al., 2002). Third, AlgU is required for alginate production and transcription from the algD promoter during growth on PIA (Boucher et al., 2000; Martin et al., 1993). Therefore we believe the most likely explanation is that that another protease besides Prc acts to cleave truncated forms of MucA during growth on PIA. A complete understanding of the mechanism by which the peptone in PIA promotes elevated alginate production in a mucA prc mutant may have to wait until future studies identify either another protease that cleaves MucA or an ancillary factor that is activated during growth on PIA.

Our results also suggest that PA3257 prc is not essential for growth of P. aeruginosa. We did not observe any noticeable growth defects in our prc mutants under the conditions we checked. In E. coli, prc is required for growth on hypotonic (low-salt) media at temperatures above 40 °C. We tested the growth of PAO578-21, PAO578-184 and PAO1-184 on LB medium lacking salt at 42 and 45 °C and did not notice any growth defects (data not shown). P. aeruginosa cells may contain other proteases that have some overlapping activity with Prc. In E. coli, other proteases have been identified which can partially replace Prc activity (Bass et al., 1996). Therefore it seems plausible that P. aeruginosa has one or more proteases with overlapping activity to Prc and one of these proteases could also act to degrade truncated MucA during growth on PIA.

We would like to thank V. Deretic (University of New Mexico Health Science Center) for providing the P. aeruginosa CF strains used in this study and for comments on this paper. This project was supported by grants ROWEN02GO0 from the Cystic Fibrosis Foundation and NIH Grant Number P20 RR16469 from the INBRE Program of the National Center for Research Resources.

References

Ades, S. E., Connolly, L. E., Alba, B. M. & Gross, C. A. (1999). The Escherichia coli σE-dependent extracytoplasmic stress response is controlled by the regulated proteolysis of an anti-sigma factor. Genes Dev 13, 24492461.[Abstract/Free Full Text]

Alba, B. M., Leeds, J. A., Onufryk, C., Lu, C. Z. & Gross, C. A. (2002). DegS and YaeL participate sequentially in the cleavage of RseA to activate the σE-dependent extracytoplasmic stress response. Genes Dev 16, 21562168.[Abstract/Free Full Text]

Bass, S., Gu, Q. & Christen, A. (1996). Multicopy suppressors of Prc mutant Escherichia coli include two HtrA (DegP) protease homologs (HhoAB) DksA and a truncated RlpA. J Bacteriol 178, 11541161.[Abstract/Free Full Text]

Beebe, K. D., Shin, J., Peng, J., Chaudhury, C., Khera, J. & Pei, D. (2000). Substrate recognition through a PDZ domain in tail-specific protease. Biochemistry 39, 31493155.[CrossRef][Medline]

Boucher, J. C., Martinez-Salazar, J., Schurr, M. J., Mudd, M. H., Yu, H. & Deretic, V. (1996). Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease HtrA. J Bacteriol 178, 511523.[Abstract/Free Full Text]

Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W. & Deretic, V. (1997a). Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity. Microbiology 143, 34733480.[Abstract]

Boucher, J. C., Yu, H., Mudd, M. H. & Deretic, V. (1997b). Mucoid Pseudomonas aeruginosa in cystic fibrosis: characterization of muc mutations in clinical isolates and analysis of clearance in a mouse model of respiratory infection. Infect Immun 65, 38383846.[Abstract]

Boucher, J. C., Schurr, M. J. & Deretic, V. (2000). Dual regulation of mucoidy in Pseudomonas aeruginosa and sigma factor antagonism. Mol Microbiol 36, 341351.[CrossRef][Medline]

Brown, M. S., Ye, J., Rawson, R. B. & Goldstein, J. L. (2000). Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans. Cell 100, 391398.[CrossRef][Medline]

Deretic, V., Chandrasekharappa, S., Gill, J. F., Chatterjee, D. K. & Chakrabarty, A. M. (1987). A set of cassettes and improved vectors for genetic and biochemical characterization of Pseudomonas genes. Gene 57, 6172.[CrossRef][Medline]

DeVries, C. A. & Ohman, D. E. (1994). Mucoid-to-nonmucoid conversion in alginate-producing Pseudomonas aeruginosa often results from spontaneous mutations in algT, encoding a putative alternate sigma factor, and shows evidence for autoregulation. J Bacteriol 176, 66776687.[Abstract/Free Full Text]

Donnesberg, M. S. & Kaper, J. B. (1991). Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect Immun 59, 43104317.[Abstract/Free Full Text]

Fyfe, J. A. M. & Govan, J. R. W. (1980). Alginate synthesis in mucoid Pseudomonas aeruginosa: a chromosomal locus involved in control. J Gen Microbiol 119, 443450.[Medline]

Goldberg, J. B., Gorman, W. L., Flynn, J. L. & Ohman, D. E. (1993). A mutation in algN permits trans activation of alginate production by algT in Pseudomonas species. J Bacteriol 175, 13031308.[Abstract/Free Full Text]

Govan, J. R. & Deretic, V. (1996). Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 60, 539574.[Abstract/Free Full Text]

Hara, H., Yamamoto, Y., Higashitani, A., Suzuki, H. & Nishimura, Y. (1991). Cloning, mapping, and characterization of the Escherichia coli prc gene, which is involved in C-terminal processing of penicillin-binding protein 3. J Bacteriol 173, 47994813.[Abstract/Free Full Text]

Kanehara, K., Akiyama, Y. & Ito, K. (2001). Characterization of the yaeL gene product and its S2P-protease motifs in Escherichia coli. Gene 281, 7179.[CrossRef][Medline]

Kanehara, K., Ito, K. & Akiyama, Y. (2002). YaeL (EcfE) activates the σE pathway of stress response through a site-2 cleavage of anti-σE, RseA. Genes Dev 16, 21472155.[Abstract/Free Full Text]

Kanehara, K., Ito, K. & Akiyama, Y. (2003). YaeL proteolysis of RseA is controlled by the PDZ domain of YaeL and a Gln-rich region of RseA. EMBO J 22, 63896398.[CrossRef][Medline]

Keiler, K. C. & Sauer, R. T. (1996). Sequence determinants of C-terminal substrate recognition by the Tsp protease. J Biol Chem 271, 25892593.[Abstract/Free Full Text]

Keiler, K. C., Silber, K. R., Downard, K. M., Papayannopoulos, I. A., Biemann, K. & Sauer, R. T. (1995). C-terminal specific protein degradation: activity and substrate specificity of the Tsp protease. Protein Sci 4, 15071515.[Abstract]

Knutson, C. A. & Jeanes, A. (1976). A new modification of the carbazole reaction: application to heteropolysaccharides. Anal Biochem 24, 470481.

Konyecsni, W. M. & Deretic, V. (1988). Broad-host-range plasmid and M13 bacteriophage-derived vectors for promoter analysis in Escherichia coli and Pseudomonas aeruginosa. Gene 74, 375386.[CrossRef][Medline]

Martin, D. W., Holloway, B. W. & Deretic, V. (1993). Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor. J Bacteriol 175, 11531164.[Abstract/Free Full Text]

Martin, D. W., Schurr, M. J., Yu, H. & Deretic, V. (1994). Analysis of promoters controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to σE and stress response. J Bacteriol 176, 66886696.[Abstract/Free Full Text]

Mathee, K., McPherson, C. J. & Ohman, D. E. (1997). Posttranslational control of the algT (algU)-encoded σ22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J Bacteriol 179, 37113720.[Abstract/Free Full Text]

Missiakas, D. & Raina, S. (1998). The extracytoplasmic function sigma factors: role and regulation. Mol Microbiol 28, 10591066.[CrossRef][Medline]

Ratnaningsih, E. S., Dharmsthiti, S., Krishnapillai, V., Morgan, A., Sinclair, M. & Holloway, B. W. (1990). A combined physical and genetic map of Pseudomonas aeruginosa PAO. J Gen Microbiol 136, 23512357.[Medline]

Rawlings, N. D., O'Brien, E. & Barrett, A. J. (2002). MEROPS: the protease database. Nucleic Acids Res 30, 343346.[Abstract/Free Full Text]

Rowen, D. W. & Deretic, V. (2000). Membrane-to-cytosol redistribution of ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Mol Microbiol 36, 314327.[CrossRef][Medline]

Schurr, M. J., Martin, D. W., Mudd, M. H. & Deretic, V. (1994). Gene cluster controlling conversion to alginate-overproducing phenotype in Pseudomonas aeruginosa: functional analysis in a heterologous host and role in the instability of mucoidy. J Bacteriol 176, 33753382.[Abstract/Free Full Text]

Schurr, M. J., Yu, H., Martinez-Salazar, J. M., Hibler, N. S. & Deretic, V. (1995). Biochemical characterization and posttranslational modification of AlgU, a regulator of stress response in Pseudomonas aeruginosa. Biochem Biophys Res Commun 216, 874880.[CrossRef][Medline]

Schurr, M. J., Yu, H., Martinez-Salazar, J. M., Boucher, J. C. & Deretic, V. (1996). Control of AlgU, a member of the σE -like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis. J Bacteriol 178, 49975004.[Abstract/Free Full Text]

Stover, C. K., Pham, X. Q., Erwin, A. L. & 23 other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959964.[CrossRef][Medline]

Walsh, N. P., Alba, B. M., Bose, B., Gross, C. A. & Sauer, R. T. (2003). OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain. Cell 113, 6171.[CrossRef][Medline]

Wyckoff, T. J. O., Thomas, B., Hassett, D. J. & Wozniak, D. J. (2002). Static growth of mucoid Pseudomonas aeruginosa selects for non-mucoid variants that have acquired flagellum-dependent motility. Microbiology 148, 34233430.[Abstract/Free Full Text]

Xie, Z.-D., Hershberger, C. D., Shankar, S., Ye, R. W. & Chakrabarty, A. M. (1996). Sigma factor-anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA. J Bacteriol 178, 49904996.[Abstract/Free Full Text]

Yu, H., Schurr, M. J. & Deretic, V. (1995). Functional equivalence of Escherichia coli σE and Pseudomonas aeruginosa AlgU: E. coli rpoE restores mucoidy and reduces sensitivity to reactive oxygen intermediates in algU mutants of P. aeruginosa. J Bacteriol 177, 32593268.[Abstract/Free Full Text]

Received 17 November 2004; revised 21 March 2005; accepted 23 March 2005.