Research Article

Identification and characterization of Pseudomonas membrane transporters necessary for utilization of the siderophore pyridine-2,6-bis(thiocarboxylic acid) (PDTC)

Microbiology 2006; 152(10):3157 · https://doi.org/10.1099/mic.0.29116-0

View at publisher PubMed

With thanks to our partners for supporting this archive.

Abstract

The compound pyridine-2,6-bis(thiocarboxylic acid) (PDTC) is known to be produced and excreted by three strains of Pseudomonas. Its reactivity includes the complete dechlorination of the environmental contaminant carbon tetrachloride. PDTC functions as a siderophore; however, roles as a ferric reductant and antimicrobial agent have also been proposed. PDTC function and regulation were further explored by characterizing the phenotypes of mutants in predicted membrane transporter genes. The functions of a predicted outer-membrane transporter (PdtK) and a predicted inner-membrane permease (PdtE) were examined in Pseudomonas putida DSM 3601. Uptake of iron from 55Fe(III):PDTC, and bioutilization of PDTC in a chelated medium, were dependent upon PdtK and PdtE. Another strain of P. putida (KT2440), which lacks pdt orthologues, showed growth inhibition by PDTC that could be relieved by introducing a plasmid containing pdtKCPE. Transcriptional activation in response to exogenously added PDTC (25 µM) was unaltered by the pdtK or pdtE mutations; each mutant showed activation of a pdt transcriptional reporter, indistinguishable from an isogenic PDTC utilization-proficient strain. The data demonstrate that PdtK and PdtE constitute a bipartite outer-membrane/inner-membrane transport system for iron acquisition from Fe(III):PDTC. Disruptions in this portion of the P. putida DSM 3601 pdt gene cluster do not abolish PDTC-dependent transcriptional signalling.
Abbreviations: Cm, chloramphenicol; CT, carbon tetrachloride; Fur, ferric uptake regulator; Gm, gentamicin; Km, kanamycin; o-p, 1,10-phenanthroline; PDTC, pyridine-2,6-bis(thiocarboxylic acid); Tc, tetracycline
Pyridine-2,6-bis(thiocarboxylic acid) (PDTC) has been identified as the agent responsible for the complete dechlorination of carbon tetrachloride (CT) by certain strains of Pseudomonas (Lee et al., 1999). Pseudomonas putida strains DSM 3601 and DSM 3602 and Pseudomonas stutzeri KC can excrete PDTC, and when P. stutzeri KC is injected into a CT-contaminated aquifer, enhanced CT removal is demonstrated (Dybas et al., 2002), signifying their potential for bioremediation. The degradation of CT via PDTC does not provide the bacteria with a carbon or energy source, indicating that PDTC-producing organisms must compete with other organisms for metabolic resources at CT-contaminated sites. Understanding the physiology of PDTC production is critical for optimizing performance under field conditions.

Evidence indicates that PDTC can function as a siderophore, a ferric iron reductant, and as an antimicrobial agent (Cortese et al., 2002; Criddle et al., 1990; Hersman et al., 2000; Lewis et al., 2004; Sebat et al., 2001). Criddle et al. (1990) first described the iron-sensitive nature of CT-dechlorination activity, and hypothesized that the dechlorinating agent might be a siderophore. The identification of PDTC as the dechlorinating agent further supports that hypothesis, since it was already known to be a ferric iron chelator (Hildebrand et al., 1983). Additional support comes from the sequencing of genes necessary for PDTC biosynthesis. The two sequenced pdt gene clusters (GenBank accession nos AF196567 and AY319946) have several characteristics of known siderophore gene clusters. A putative outer-membrane transporter PdtK is found in both the P. stutzeri KC and P. putida DSM 3601 pdt gene clusters. Ferric uptake regulator (Fur)-binding sites are predicted upstream of several of the pdt genes, and can explain iron-repressible transcription (Lewis et al., 2000; Sepulveda-Torres et al., 2002). The accumulated evidence in support of the siderophore role also includes a growth defect described for pdt mutants under conditions of decreased iron availability, and the uptake of ferric iron from 59Fe(III):PDTC by cells of PDTC-producing cultures (Lewis et al., 2004). Although other effects may be ascribed to PDTC (Sebat et al., 2001), they are probably fortuitous consequences of its structure/activity; PDTC biosynthesis and regulatory components are more likely to have evolved to fulfil a siderophore role.

Several siderophore-mediated iron-acquisition systems of Gram-negative bacteria have been characterized at the molecular level, including transport (Ferguson & Deisenhofer, 2002) and regulatory processes (Visca et al., 2002). Siderophore transport typically occurs through the function of TonB-dependent outer-membrane transporters, cytoplasmic-membrane-spanning ABC-type transporters, and periplasmic-binding proteins. Complex regulation has evolved for siderophore biosynthesis. This is apparently to prevent the wasteful expenditure of resources, when soluble iron is abundant, or when the siderophore diffuses away from the cell without the productive return of iron. Intracellular iron down-regulates the production of the siderophore at the transcriptional level by means of the Fur protein. In the presence of the cognate siderophore, some outer-membrane siderophore transporters are known to participate in activating the transcription of their respective genes, as well as that of the associated siderophore biosynthetic genes.

Signal transduction systems known to regulate siderophore biosynthetic genes in pseudomonads fall into two categories: those that involve membrane-spanning signal-transducing receptors, and those that involve an AraC-family transcriptional regulator (Poole & McKay, 2003). The second mechanism is less well understood but includes many known siderophore systems of Gram-negative bacteria, including pyochelin (Heinrichs & Poole, 1993), rhizobactin (Lynch et al., 2001), quinolobactin (Matthijs et al., 2004), alcaligin (Brickman et al., 2001) and a utilization system for enterobactin (Anderson & Armstrong, 2004). This type of regulatory system is exemplified by the well-characterized pyochelin system of Pseudomonas aeruginosa. Pyochelin (pch) gene clusters encode the AraC-type transcriptional activator PchR (Michel et al., 2005). A model to explain activation of pch biosynthetic and receptor gene transcription posits that ferripyochelin is an essential effector, interacting with PchR to bring about transcriptional activation (Heinrichs & Poole, 1996; Poole & McKay, 2003). Support for this model comes from studies demonstrating that PchR binds specific DNA sequences in a pyochelin-dependent manner (Michel et al., 2005). An implicit component of the pyochelin effector model is the import of the ferrisiderophore into the cytoplasm to allow interaction with a DNA-binding protein.

Like the pyochelin system, transcription of genes within the pdt gene cluster of P. putida DSM 3601 is upregulated in response to exogenous PDTC (Lewis et al., 2004). Additionally, the pdt gene clusters described to date contain an araC homologue (Lewis et al., 2000) (GenBank AY319946). In this study, we have examined the predicted outer-membrane transporters encoded by the pdtK genes from P. stutzeri KC and P. putida DSM 3601, as well as the cytoplasmic membrane transporter encoded by pdtE. These gene products were expected to be essential for the siderophore function of PDTC, and regulation of PDTC production, by virtue of their transport activity. Characterization of mutants of P. putida DSM 3601 lacking the predicted transporters was undertaken in order to test these proposed roles.

Growth media and culture conditions.
Tryptic soy broth and Luria broth were used to maintain cultures of pseudomonads and Escherichia coli, respectively. Pseudomonas spp. were incubated at 30 °C. Small cultures (5 ml) of pseudomonads were incubated on a roller drum. Larger cultures (50 ml) were grown in 250 ml Erlenmeyer flasks on a rotary shaker. PIPES-buffered minimal medium (PM) (Lewis et al., 2004) was used to culture pseudomonads under iron-limiting conditions. PDTC was chemically synthesized by the method of Hildebrand et al. (1983), and was used at a concentration of 10 or 25 µM. Pyoverdine3601 was provided by J.-M. Meyer, Université Louis Pasteur, Strasbourg, and was prepared as described previously (Lewis et al., 2004). Antibiotics were used at the following concentrations: chloramphenicol (Cm, 50 µg ml1), kanamycin (Km, 50 µg ml1), tetracycline (Tc, 15 µg ml1), gentamicin (Gm, 15 µg ml1) and ampicillin (Amp, 100 µg ml1). 1,10-Phenanthroline (o-p) was used at 50 µM.

For growth curves, cultures were grown in 96 well microtitre plates in PM, and turbidity was measured using a BioTek plate reader at 630 nm. Media were inoculated (0.1 %, v/v) from 24 h PM cultures adjusted to OD600 0.35.

Strain/plasmid construction.
Strains used in this study are listed in Table 1. DNA amplified by PCR was cloned into pGEM-T easy (Promega). P. putida strain LLA3 was created through allelic exchange, replacing wild-type pdtK of strain DSM 3601 with a deletion/disruption allele containing a Gm-resistance (GmR) cassette in the same transcriptional orientation. DNA flanking an internal portion of pdtK was amplified and cloned, followed by insertion of the GmR cassette (Fig. 1). This construct resulted in the replacement of DNA encoding aa 189425 of the 662 aa PdtK protein with the GmR cassette. The disrupted allele was inserted into the suicide vector pVT1460 via EcoRI sites, forming pVTΔK. E. coli BW20767 was used as the donor for conjugal transfer of this and other constructs into P. putida DSM3601 via the filter mating technique (DeLorenzo et al., 1990). GmR P. putida were selected on tryptone soy agar (TSA) containing Gm and Cm (P. putida is inherently CmR). GmR isolates were then further screened for Km sensitivity to identify allelic replacements. Allelic replacement was verified by Southern analysis. Probe synthesis utilized the AlkPhos Direct Labelling kit according to the manufacturer's instructions (Amersham Biosciences).


Table 1. Bacterial strains and plasmids DSMZ, Deutsche Sammlung von Mikroorganism und Zellkulturen; EEZ, Estacion Experimental del Zaidin, Granada.



(10K):

Fig. 1. Gene clusters encoding PDTC biosynthesis and utilization functions in P. stutzeri KC and P. putida DSM 3601. Open arrows indicate the positions and orientations of GmR cassettes inserted in pdtK and pdtE, with dashed lines indicating the extent of deletions in the respective alleles. The flag symbol indicates the position and orientation of a mini-TnxylE insertion in pdtI used as a transcriptional reporter. Angled arrows indicate predicted transcription start sites. The line at the bottom shows locations of restriction sites in the P. putida DSM 3601 genome segment: Bg, BglII; X, XhoI; N, NotI.

PdtK3601 was cloned after amplification of the coding region and ∼500 bp of upstream flanking sequences. For expression of the P. stutzeri KC pdtK gene in P. putida, pdtKKC was inserted into the expression vector pJB861T. The entire pdtKKC ORF was amplified from P. stutzeri KC genomic DNA using primers that contained BspHI sites for insertion into the AflIII site of pJB861T, allowing in-frame fusion to the start codon, provided by the vector and creating pKKC9. A construct with the insert in opposite orientation (pKKC10) was also obtained and used as a control for background activity.

Allelic exchange was also used to replace the P. putida DSM 3601 pdtE gene with a deletion/disruption allele containing a GmR cassette in the reverse transcriptional orientation. The disruption allele consisted of the first 177 bp and terminal 12 bp of the 1281 bp pdtE coding region, interrupted by the GmR cassette. PCR and Southern analysis were used to verify allelic replacement at pdtE.

For expression of the P. putida pdtE gene, the amplified gene was inserted into pJB861T utilizing the AflIII site, as described for pdtKKC.

To obtain a chromosomal pdtI : : xylE reporter fusion in wild-type, pdtK and ΔpdtE backgrounds, a previously described pdtI : : xylE allele (Lewis et al., 2004) was inserted as a KpnI fragment into pEPGm, creating pSac2 : : SEMKmR. For use with pdtK and ΔpdtE recipients, the construct was further modified by replacing the plasmid-borne GmR with TcR (amplified from pACYC184), yielding pEPSTc. Conjugal transfer into P. putida was followed by selection on Km-containing medium. KmR transconjugants were then screened for the resistance marker of the vector (GmR or TcR). Allelic replacement or co-integration was verified by Southern analysis.

Inverse PCR.
Cosmid DNA (pJS52 or pJS59) was digested with PstI and ligated with T4 ligase. Nested PCR was performed using two sets of primers, oriented in an outward direction from the mini-transposon KmlacZ1 (DeLorenzo et al., 1990): set 1 consisted of Trp-lacinv (TCGCTGCTTTTACCTGATCC) and KmRinv (TCAGCAACACCTTCTTCAG); and set 2 consisted of KmlacZF (GCCGCACTTGTGTATAAG) and KmlacZR (GGCCAGATCTGATCAAGA). Sequencing was done at the Vermont Cancer Center DNA Analysis Facility on an AB3100 genetic analyser. Cycle sequence chemistry employed the Big Dye Terminator Chemistry version 3.1 and was analysed using Sequence Analysis 5. The sequence data were compiled using Sequencher 4.2 (GeneCodes).

XylE assays.
Catechol dioxygenase was assayed by measuring the production of α-hydroxymuconic semialdehyde from catechol (Klecka & Gibson, 1981). The reaction was monitored at 375 nm on a Cary 50 spectrophotometer (Varian Instruments) with constant stirring at 30 °C. Cells were harvested upon entry into the stationary phase. Protein quantification for all experiments used the BCA protein assay kit (Pierce).

Outer-membrane protein analysis.
Sarkosyl fractionation was used to isolate outer-membrane proteins of both P. putida and P. stutzeri (Cornelis et al., 1989). Proteins (15 µg per lane) were run on an 8 % SDS-PAGE gel, and stained with 0.2 % Coomassie blue (Laemmli, 1970). The broad-range molecular mass standard was purchased from New England Biolabs. A 65 kDa band derived from strain CTN1/pT31, and corresponding to PdtK, was transferred from an SDS-PAGE gel to PVDF, and submitted for analysis. The N-terminal sequence was determined at the Protein Chemistry Laboratory, University of Texas Medical Branch at Galveston, TX, USA.

55Fe uptake.
Uptake assays were performed using a modification of our previous protocol (Lewis et al., 2004). 55Fe:PDTC was made by first adding 100 mM Tris/HEPES-buffered nitrilotriacetic acid (NTA, pH 6) to 55FeCl3 [NEN Biolabs; 69.64 mCi (2.577 GBq) (mg Fe)1, 0.5 M HCl] to stabilize the iron in soluble form. The mixture was adjusted to pH 6 by addition of NaOH (0.8 µl 1 M NaOH to 10 µl 55Fe:PDTC). Immediately prior to each experiment, PDTC was mixed with 55Fe/NTA in the stoichiometric ratio of 2 : 1. The mixture was then incubated for 20 min at room temperature. UV-visible spectrophotometry showed that this protocol produced quantitative yields of Fe(III):PDTC. Fe(II):PDTC, although readily resolved by UV-visible spectrophotometry (Cortese et al., 2002), was not detected in this synthesis. The determination of statistical significance among uptake assay data involved a two-tailed t test.

Cells for iron-uptake assays were grown to early stationary phase (18 h, 30 °C), washed twice and resuspended in PM to OD600 0.8. P. putida DSM 3601 strains were pre-grown without antibiotic selection, as this reduced variability and mean uptake values for vector controls. Plating efficiencies on antibiotic-containing and control media were determined for cells used in assays, and were not significantly different. The addition of inducer (3-methylbenzoate) in conjunction with expression clones was omitted, as its inclusion did not affect results obtained for one of the constructs (LLΔE/pE3601) in a control experiment.

Reactions were started by the addition of 11.1 nmol 55Fe:PDTC to 4 ml cell suspensions, and incubation at 30 °C. Aliquots (1 ml) were removed and the cells were sedimented in a microcentrifuge, and washed twice with 1 ml ice-cold PM. The washed cell pellet was suspended in Biosafe II scintillation fluid (Research Products International), and radioactivity was measured in a Beckman LS6000IC scintillation counter. Linearity was verified by time-course studies with P. stutzeri KC and P. putida cells. Thereafter, our standard protocol utilized a 30 min incubation. A negative control was run to report non-specific sorption of 55Fe in the cell pellet. In that experiment, aliquots of a cell suspension were incubated at either 30 °C (experimental) or 4 °C (control), after the addition of 55Fe:PDTC.

Identification of PdtK in outer-membrane fractions of P. stutzeri KC and P. putida DSM 3601
PdtK, a putative outer-membrane transporter, is encoded within the pdt gene clusters of P. stutzeri KC (Lewis et al., 2000) and P. putida DSM 3601 (Fig. 1; GenBank AY319946). The proteins are 44 % identical, and PdtK3601 is 29 % identical to FepA of E. coli. In both Pseudomonas species, the translated genes were predicted to encode proteins of ∼71 kDa after removal of a predicted Sec-dependent signal sequence (Bendtsen et al., 2004). When grown under iron limitation, the outer-membrane protein profiles of both P. putida DSM 3601 and P. stutzeri strain KC showed an iron-regulated protein band migrating at ∼65 kDa (Lewis et al., 2004) (Fig. 2). To determine whether the band was PdtK, the outer-membrane profiles from a series of strains derived from P. stutzeri KC were analysed. Strain CTN1 is a spontaneously derived mutant of strain KC that lacks a 170 kb chromosomal segment that includes the entire pdt gene cluster. The Pdt phenotype (PDTC production defect) of CTN1 was complemented by a cosmid (pT31) containing the pdt gene cluster (Lewis et al., 2000). Outer-membrane proteins derived from the complemented strain (CTN1/pT31) grown under iron-limited conditions showed a band at 65 kDa, whereas the vector-bearing control (CTN1/pRK311) did not (Fig. 2A), indicating that the 65 kDa protein was likely encoded within the 25.7 kb pdt gene cluster. The N-terminal amino acid sequence was determined for the 65 kDa band derived from a CTN1/pT31 outer-membrane preparation. The sequence of the first 10 aa (APGSAASPDS) corresponded exactly to those predicted for the mature protein, and confirmed that the 65 kDa protein was PdtKKC.



(76K):

Fig. 2. Assignment of a 65 kDa outer-membrane protein as PdtK. Outer-membrane proteins were run on 8 % polyacrylamide gels. (A) Lane 1, molecular size marker; lane 2, P. stutzeri KC; lane 3, P. stutzeri KC grown with 50 µM FeCl3; lane 4, P. stutzeri CTN1; lane 5, P. stutzeri CTN1/pRK311; lane 6, P. stutzeri CTN1/pT31. (B) Lane 1, P. putida DSM 3601; lane 2, LLA3; lane 3, LLA3/pJB3Tc20; lane 4, LLA3/pK3601; lane 5, molecular size marker. The positions of the band identified as PdtK by N-terminal sequencing, and the 97 and 66 kDa standards, are indicated.

Outer-membrane protein preparations from iron-replete P. putida DSM 3601 contained additional bands near 65 kDa, compared to those from strain KC. However SDS-PAGE revealed an iron-regulated band within that size range (Lewis et al., 2004). The 65 kDa band was not seen in the mutant bearing a pdtK deletion allele (LLA3), but was present when plasmid-borne pdtK3601 was provided (Fig. 2B), allowing the 65 kDa band to be classified as PdtK3601.

Uptake of iron from 55Fe:PDTC is PdtK dependent
Uptake of 55Fe from 55Fe:PDTC is iron regulated, as would be expected for a siderophore system (Lewis et al., 2004) (Table 2). The measured uptake was also curtailed by incubation at 4 °C, indicating a metabolic rather than a sorptive effect (data not shown). To determine if PdtK was essential for iron assimilation from Fe:PDTC, uptake assays of pdtK and pdtK+ strains were performed. P. stutzeri KC assimilated significantly more 55Fe from 55Fe:PDTC than did the pdt mutant CTN1. The iron-uptake phenotype of CTN1 was complemented by the cosmid pT31 (Table 2), demonstrating that the pdt gene cluster was sufficient for PDTC-bound iron uptake.


Table 2. Uptake of 55Fe from 55Fe:PDTC by Pseudomonas strains


Iron-uptake assays were also performed on pdtK and pdtK+ P. putida DSM 3601 strains. The pdtK3601 mutant LLA3 showed a severe defect in 55Fe uptake from 55Fe:PDTC, similar to the results observed with iron-replete DSM 3601 cells. The uptake deficiency of strain LLA3 was partially restored upon complementation with plasmid-encoded pdtK3601 (Table 2), confirming a role for PdtK in the transport of Fe:PDTC. To determine if the two PdtK proteins were functionally equivalent, a plasmid-borne copy of pdtKKC was introduced into strain LLA3. Significant 55Fe uptake in that strain (LLA3/pKKC9) confirmed that the two genes are functional orthologues (Table 2).

The pdtE gene product is necessary for iron assimilation from Fe:PDTC
The predicted eleven-transmembrane-domain protein PdtE shares sequence similarity with the single-polypeptide-type permeases of the rhizobactin (rhtX) and pyochelin (fptX) utilization systems (Cuiv et al., 2004). These characteristics suggest that PdtE constitutes the cytoplasmic-membrane component of the Fe:PDTC-uptake machinery (Paszczynski et al., 2004). A P. putida DSM 3601 mutant with a deletion/disruption allele of pdtE (LLΔE) was found to be devoid of detectable iron uptake from 55Fe:PDTC, a phenotype that could be partially restored by the presence of pdtE on a multicopy plasmid (Table 2).

Comparing the membrane transport mutants, the pdtE mutant was more severely compromised for 55Fe assimilation than was the pdtK mutant (Table 2, P=0.004). A possible explanation is that there are other modes of transport of Fe:PDTC into the periplasm that are much less efficient than PdtK, but that cytoplasmic transport depends solely upon PdtE.

PdtK and PdtE are necessary for full tolerance to transition metal deprivation
The iron-uptake data predicted that pdtK and pdtE mutants would have growth defects under conditions in which PDTC is normally required. Mutants defective in PDTC production are more sensitive to the transition metal chelator o-p than their isogenic counterparts, and tolerance to o-p can be restored to these mutants by addition of PDTC to the culture medium (Lewis et al., 2004). Although DSM 3601 can also produce pyoverdine, that capacity contributes less to o-p resistance than does PDTC production (Lewis et al., 2004). Therefore, we used o-p tolerance to assess the roles of PdtK and PdtE, as a means of physiological corroboration of the iron-uptake data (Fig. 3).



(12K):

Fig. 3. Roles for PdtK and PdtE in tolerance to o-p. Growth curves for (A) DSM 3601, (B) LLA3 (pdtK), (C) LLA3/pJB3Tc20, (D) LLA3/pK3601, (E) LLΔE (pdtE), (F) LLΔE/pJB861T, and (G) LLΔE/pE3601. •, PM minimal medium; , PM+50 µM o-p. Values are the averages of two parallel experiments. The experiments were repeated with similar results.

Although both strains retained the capacity to produce PDTC (data not shown), they showed an increased sensitivity to the effects of o-p (Fig. 3). The pdtK mutant was more adversely affected by 50 µM o-p than the wild-type, but was still capable of growth. The pdtE mutant was even more sensitive to 50 µM o-p, and was unable to overcome o-p-induced growth inhibition. Both mutants could be complemented for o-p sensitivity phenotypes by the respective genes introduced singly in trans (Fig. 3). An unexpected result was that the phenotype of the pdtK mutant was more severe when harbouring a plasmid vector. The data confirmed that PdtK and PdtE were essential for the o-p-resistance phenotype of DSM 3601, and corroborated the iron-uptake data, indicating that the pdtK mutant LLA3 possessed residual capacity to transport Fe:PDTC complexes into the cytoplasm.

pdtKCPE is sufficient for 55Fe:PDTC uptake and PDTC bioutilization
A two-protein system consisting of individual outer-membrane and cytoplasmic-membrane transport proteins is sufficient for utilization of rhizobactin and pyochelin siderophores by heterologous hosts (Cuiv et al., 2004). Therefore, to test whether PdtK and PdtE were sufficient for PDTC utilization, a segment of the DSM 3601 pdt gene cluster containing complete ORFs for PdtK and PdtE, as well as putative regulatory components (PdtC and PdtP), was transferred to the P. putida reference strain KT2440 on a multicopy plasmid. The strain KT2440 genome has been sequenced (Nelson et al., 2002), and no homologues of pdt genes were found by BLAST searches (Altschul et al., 1997). pdtKCPE in trans conferred upon strain KT2440 the ability to take up 55Fe from 55Fe:PDTC (Table 2), and also relieved a PDTC-sensitive phenotype seen for KT2440 (Fig. 4). The fact that this small subset of genes could confer utilization upon a heterologous host supported the two-protein uptake system model, and indicated that the PDTC antimicrobial effect was due solely to a lack of these components.



(7K):

Fig. 4. Resistance to the antimicrobial effect of PDTC is conferred by pdtKCPE. P. putida KT2440 bearing either plasmid vector (pJB321Gm, •) or cloned pdtKCPE genes from P. putida DSM 3601 (pPA21KΔXho, ) were inoculated into PM with 10 µM PDTC. Values are the averages of two parallel experiments. The experiments were repeated with similar results.

Transcriptional activation by PDTC in transport mutants
To assess the roles of the described transporters in expression of pdt genes, we measured pdt gene expression in pdtK and pdtE backgrounds. Transcriptional regulation of pdt genes in response to exogenously added PDTC has been demonstrated previously by measuring expression of a chromosomal pdtI : : xylE transcriptional fusion (Lewis et al., 2004). The same pdtI : : xylE reporter fusion was recombined into the pdtK and pdtE backgrounds in order to assess the roles of the respective genes in that activation. Since the allele containing the reporter abolishes endogenous PDTC production, any response seen would have been due solely to exogenously added PDTC. Assays of reporter expression showed that the pdtK and pdtE reporter strains responded to 25 µM PDTC in a manner indistinguishable from that of the isogenic (pdtK+ pdtE+) strain TLI1 (Fig. 5). This demonstrated that transcriptional activation by exogenously added PDTC still occurred, even in strains carrying mutations that severely reduced or abrogated PDTC-dependent iron uptake.



(17K):

Fig. 5. Transcriptional activation of a chromosomal pdtI : : xylE reporter fusion in response to PDTC. Cell-free extracts were prepared from the following cultures, grown on PM (black bars) or PM with 25 µM PDTC (grey bars). TLI1, pdtI : : xylE; LLA3I, pdtI : : xylE pdtK; LLΔEI, pdtI : : xylE pdtE.

Characterization of cosmid clones assigned as pdtKKC insertions
Previous data suggest a role for pdtK in the regulation of PDTC production by P. stutzeri KC (Lewis et al., 2000); however, these data are equivocal. Two transposon insertions were mapped within a cosmid-borne copy of pdtKKC, and led to either abolition of (pJS59), or no effect on, PDTC production (pJS52). We determined the precise positions of these transposon insertions by inverse PCR and sequencing. The pJS59 transposon integration site was determined to lie at nt 872 of pdtF, and thus the resulting phenotype did not reflect an effect of the disruption of pdtK. The pJS52 insertion site was determined at nt 1066 of the 2063 bp pdtKKC ORF, likely generating a pdtK null phenotype. Therefore, since pJS52 conferred levels of PDTC production indistinguishable from those of the uninterrupted cosmid (Lewis et al., 2000), no role was indicated for PdtKKC in regulating PDTC genes present in multicopy. The data presented clarify the physiological role for which PDTC production has evolved, distinguishing it from other activities that can be also be attributed to PDTC. A role for PdtK was demonstrated as an outer-membrane component in the receptor-mediated uptake of iron from the Fe:PDTC complex. Orthology between pdtK genes from two PDTC-producing strains was also established. Previous attempts to demonstrate receptor-mediated uptake of iron from Fe:PDTC have not been successful (Cortese et al., 2002), most likely due to the filtration-based protocol used to assay iron uptake in these experiments. That filtration-based technique led to very high background counts, not observed with the centrifugation protocol used in both this and our previous study (Lewis et al., 2004). It seems likely that the high background obscures the physiological accumulation of iron. Another important finding derived from the 55Fe-uptake assays, and the dependence of the observed activity upon an outer-membrane transporter, was that the bulk of the uptake of iron occurred without reduction to ferrous ion by added PDTC; the Fe:PDTC preparations used were confirmed as Fe(III):PDTC spectrophotometrically. In addition, the ferric-reducing activity, shown previously for PDTC (at ∼50-fold higher concentrations than those used in our uptake assays) incubated with insoluble ferric hydroxides, was ∼10-fold slower than the uptake rates measured in our work (Cortese et al., 2002; data for DSM 3601, Table 2, normalized to h1).

55Fe uptake and bioutilization assays also showed that PdtE was necessary for PDTC-dependent iron uptake. By homology to the rhizobactin and pyochelin systems (Cuiv et al., 2004), PdtK and PdtE were predicted as the analogous Fe:PDTC utilization system, providing outer-membrane/TonB-dependent, and cytoplasmic-membrane permease functions, respectively. This supposition was supported by data demonstrating that pdtKCPE was sufficient for relieving a growth-inhibitory effect of PDTC seen for a strain of P. putida devoid of pdt gene orthologues (Fig. 4). Therefore, the observed antimicrobial effect described for PDTC (Sebat et al., 2001) is likely to be due to the avid iron-chelating property of PDTC (Stolworthy et al., 2001) in the absence of a cognate uptake system. In light of the avid iron affinity, it is interesting that the small set of genes was sufficient to relieve growth inhibition caused by PDTC, since it also implies that iron removal from Fe:PDTC can occur once the complex is translocated into the cell. This may arise through non-specific reduction, since the affinity of PDTC for Fe2+ is drastically lower than that for Fe3+ (Brandon et al., 2003).

In light of the ability to confer resistance to PDTC-induced growth inhibition on a heterologous host, it is unclear why plasmid-borne pdtK or pdtE only partially complemented the iron uptake and o-p-resistance phenotypes of strains LLA3 and LLΔE, respectively. Possible explanations include poor expression, complicating effects of plasmids or antibiotic selection, or additional defects caused by the constructed alleles. We did not quantitatively assess expression of the respective plasmid-borne genes, but we did observe a corresponding band in SDS-PAGE (pK3601, Fig. 2), and verified promoter integrity by sequencing (pE3601). At least two effects related to plasmids or antibiotic selection were observed: growth of control strains (containing empty vectors) in the presence of antibiotics led to high counts in uptake assays, and significant reduction in siderophore (pyoverdine) production was seen in strains harbouring the RK2-based plasmids used in this work (data not shown). The high counts seen in iron-uptake assays were not physiologically relevant, since the bioutilization experiments showed that no advantage was gained by harbouring control plasmids in a chelated medium with antibiotic selection. In fact, strain LLA3 showed impaired ability to grow in the chelated medium while harbouring a control plasmid (Fig. 3). These observations indicate that plasmid functions and/or antibiotic selection result in changes in the physical properties of the cell envelope, which confound uptake assays and impede transition metal uptake. Although we cannot resolve the potential factors contributing to the poor complementation, we have revealed complexity in the genetic requirements of the P. putida DSM 3601 transition metal-acquisition systems.

In addition to clarifying the physiological role of PDTC, further information regarding regulation of PDTC biosynthesis was obtained in the present work. Current models to explain siderophore signalling include membrane transporters acting as direct signal transducers, and transport activities potentially bringing necessary effectors into the cytoplasm. Evaluation of the pdt gene cluster has identified similarity between the PDTC system and the pyochelin system of P. aeruginosa, in that both have araC-like regulatory genes, pdtC and pchR, respectively. The PchR/ferrisiderophore co-effector model, in which transcriptional activation requires a protein activator and a ferrisiderophore, has received experimental support. It has recently been demonstrated that PchR binds to a consensus PchR box element found in two locations within the pch gene cluster, and that binding requires the presence of pyochelin (Michel et al., 2005). We have shown that a pdtK mutation, which does not support transport of iron from Fe:PDTC above iron-repressed levels, did not eliminate transcriptional activation by exogenous PDTC. The predicted cytoplasmic-membrane permease PdtE was found to have an even more important role in transport, and was likewise shown not to be essential for transcriptional activation. In other work, we have found that pdtC alone is sufficient to allow PDTC-dependent transcriptional activation of a pdt promoter by P. putida KT2440 (S. Morales and T. Lewis, unpublished data). Transporter-independent signalling has also been indicated for other siderophore-responsive regulatory systems, including that of yersiniabactin in Yersinia pestis (Fetherston et al., 1996) and enterochelin in Bordetella spp. (Anderson & Armstrong, 2004). Models to reconcile our data with a PdtC/co-effector model would require cellular import/diffusion of the effector without pdtK or pdtE, and that the necessary amount of effector import does not alleviate iron deprivation. It is possible that Fe:PDTC is transported across the outer membrane by an alternative transporter, or it may diffuse through porins at a low rate, as has been seen for other siderophores (Ghysels et al., 2004, 2005; Meyer, 1992). There could also be cytoplasmic transporters with a limited cross-specificity for Fe:PDTC. The first suggestion might explain the residual ability of the pdtK mutant to take up iron from Fe:PDTC. However, transport of Fe:PDTC in the absence of PdtE was below our detection limit, and the residual ability to respond would have required a very sensitive sensing mechanism to explain the observed transcriptional activation. Alternatively, the zwitterionic form of PDTC may be cell-permeable and, once inside the cell, it may bind iron from cytosolic sources. However, since the pKa for conversion to a species with no net charge is 2.58 (Stolworthy et al., 2001), the steady-state concentration of that species would be very low at physiological pH. In summary, the ferrisiderophore effector model of transcriptional activation could explain activation in the absence of specific transporters, but the uncoupling between physiological levels of transport and regulation remains to be explained mechanistically.

An appealing element of the ferrisiderophore effector model is that it could also explain the phenomenon of coordination between two separate siderophore systems of the same organism (Poole & McKay, 2003). It was not an explicit goal of this study to test that model, but it would be interesting to determine how, or whether, transport components affect the interplay between siderophore systems. Unravelling the regulatory circuits involved may not only yield information vital to an optimal bioremediation strategy, but also inform us about regulatory coordination between important competitive and virulence determinants of bacteria.

The authors would like to thank Doug Johnson for comments on the manuscript, Anne Mason, Kathryn Docherty and Stacey Gilk for helpful technical advice, and Hadley Hartwell for technical assistance. This work was supported by the Vermont Agricultural Experiment Station.

References

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25, 33893402.[Abstract/Free Full Text]

Anderson, M. T. & Armstrong, S. K. (2004). The BfeR regulator mediates enterobactin-inducible expression of Bordetella enterobactin utilization genes. J Bacteriol 186, 73027311.[Abstract/Free Full Text]

Bendtsen, J. D., Hielsen, H., von Heijne, G. & Brunak, S. (2004). Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340, 783795.[CrossRef][Medline]

Blatny, J. M., Brautaset, T., Winther-Larsen, H. C., Haugan, K. & Valla, S. (1997a). Construction and use of a versatile set of broad-host-range cloning and expression vectors based on the RK2 replicon. Appl Environ Microbiol 63, 370379.[Abstract/Free Full Text]

Blatny, J. M., Brautaset, T., Winther-Larsen, H. C., Karunakaran, P. & Valla, S. (1997b). Improved broad-host-range RK2 vectors useful for high and low regulated gene expression levels in Gram-negative bacteria. Plasmid 38, 3551.[CrossRef][Medline]

Brandon, M. S., Paszczynski, A., Korus, R. A. & Crawford, R. L. (2003). The determination of the stability constant for the iron(II) complex of the biochelator pyridine-2,6-bis(monothiocarboxylic acid). Biodegradation 14, 7382.[CrossRef][Medline]

Brickman, T. J., Kang, H. Y. & Armstrong, S. K. (2001). Transcriptional activation of Bordetella alcaligin siderophore genes requires the AlcR regulator with alcaligin as inducer. J Bacteriol 183, 483489.[Abstract/Free Full Text]

Cornelis, P., Bouia, A., Belarbi, A., Guyonvarch, A., Kammerer, B., Hannaert, V. & Hubert, J. C. (1989). Cloning and analysis of the gene for the major outer memrane lipoprotein from Pseudomonas aeruginosa. Mol Microbiol 3, 421428.[Medline]

Cortese, M., Paszczynski, A., Lewis, T. A., Sebat, J. & Crawford, R. L. (2002). Metal chelating properties of pyridine-2,6-bis(thiocarboxylic acid) produced by Pseudomonas spp. and the biological activities of the formed complexes. BioMetals 15, 103120.[CrossRef][Medline]

Criddle, C. S., DeWitt, J. T., Grbic-Galic, D. & McCarty, P. L. (1990). Transformation of carbon tetrachloride by Pseudomonas sp. strain KC under denitrification conditions. Appl Environ Microbiol 56, 32403246.[Abstract/Free Full Text]

Cuiv, P. O., Clarke, P., Lynch, D. & O'Connell, M. (2004). Identification of rhtX and fptX, novel genes encoding proteins that show homology and function in the utilization of the siderophores rhizobactin 1021 by Sinorhizobium meliloti and pyochelin by Pseudomonas aeruginosa, respectively. J Bacteriol 186, 29963005.[Abstract/Free Full Text]

DeLorenzo, V., Herrero, M., Jakubzik, U. & Timmis, K. (1990). Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in Gram-negative eubacteria. J Bacteriol 172, 65686572.[Abstract/Free Full Text]

Ditta, G., Stanfield, S., Corbin, D. & Helinski, D. R. (1980). Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci U S A 77, 73477351.[Abstract/Free Full Text]

Dybas, M. J., Hyndman, D. W., Heine, R. & 7 other authors (2002). Development, operation, and long-term performance of a full-scale biocurtain utilizing bioaugmentation. Environ Sci Technol 36, 36353644.

Ferguson, D. A. & Deisenhofer, J. (2002). TonB-dependent receptors structural perspectives. Biochim Biophys Acta 1565, 318332.[Medline]

Fetherston, J. D., Bearden, S. W. & Perry, R. D. (1996). YbtA, an AraC-type regulator of the Yersinia pestis pesticin/yersiniabactin receptor. Mol Microbiol 22, 315325.[CrossRef][Medline]

Ghysels, B., Dieu, B., Beatson, S., Pirnay, J.-P., Ochsner, U., Vasil, A. & Cornelis, P. (2004). FpvB, an alternative type I ferripyoverdine receptor of Pseudomonas aeruginosa. Microbiology 150, 16711680.[Abstract/Free Full Text]

Ghysels, B., Ochsner, U., Möllman, U., Heinisch, L., Vasil, M., Cornelis, P. & Matthijs, S. (2005). The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues. FEMS Microbiol Lett 246, 167174.[CrossRef][Medline]

Heinrichs, D. E. & Poole, K. (1993). Cloning and sequence analysis of a gene (pchR) encoding an AraC family activator of pyochelin and ferripyochelin receptor synthesis in Pseudomonas aeruginosa. J Bacteriol 175, 58825889.[Abstract/Free Full Text]

Heinrichs, D. E. & Poole, K. (1996). PchR, a regulator of ferripyochelin receptor gene (fptA) expression in Pseudomonas aeruginosa, functions both as an activator and as a repressor. J Bacteriol 178, 25862592.[Abstract/Free Full Text]

Hersman, L. E., Huang, A., Maurice, P. A. & Forsythe, J. H. (2000). Siderophore production and iron reduction by Pseudomonas mendocina in response to iron deprivation. Geomicrobiol J 17, 261273.

Hildebrand, U., Ockels, W., Lex, J. & Budzikiewicz, H. (1983). Zur struktur eines 1 : 1-adduktes von pyridin-2,6-dicarbothiosäure und pyridin. Phosphorus Sulfur 16, 361364.[CrossRef]

Klecka, G. M. & Gibson, D. T. (1981). Inhibition of catechol 2,3-dioxygenase from Pseudomonas putida by 3-chlorocatechol. Appl Environ Microbiol 41, 11591165.[Abstract/Free Full Text]

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680685.[CrossRef][Medline]

Lee, C.-H., Lewis, T. A., Paszczynski, A. & Crawford, R. L. (1999). Identification of an extracellular catalyst of carbon tetrachloride dehalogenation from Pseudomonas stutzeri strain KC as pyridine-2,6-bis(thiocarboxylate). Biochem Biophys Res Commun 261, 562566; erratum 265, 770.

Lewis, T. A., Cortese, M., Sebat, J., Green, T., Lee, C.-H. & Crawford, R. L. (2000). A Pseudomonas stutzeri gene cluster encoding the biosynthesis of the CCl4-dechlorination agent pyridine-2,6-bis(thiocarboxylic acid). Environ Microbiol 2, 407416.[CrossRef][Medline]

Lewis, T. A., Leach, L., Morales, S. E., Austin, P. R., Hartwell, H. J., Kaplan, B., Forker, C. & Meyer, J.-M. (2004). Physiological and molecular genetic evaluation of the dechlorination agent, pyridine-2,6-bis(monothiocarboxylic acid) (PDTC) as a secondary siderophore of Pseudomonas. Environ Microbiol 6, 159169.[CrossRef][Medline]

Lynch, D., O'Brien, J., Welch, T., Clarke, P., Cuiv, P. O., Crosa, J. H. & O'Connell, M. (2001). Genetic organization of the region encoding regulation, biosynthesis, and transport of rhizobactin 1021, a siderophore produced by Sinorhizobium meliloti. J Bacteriol 183, 25762583.[Abstract/Free Full Text]

Matthijs, S., Baysse, C., Koedam, N. & 8 other authors (2004). The Pseudomonas siderophore quinolobactin is synthesized from xanthurenic acid, an intermediate of the kynurenine pathway. Mol Microbiol 52, 371384.[CrossRef][Medline]

Meyer, J.-M. (1992). Exogenous siderophore-mediated iron uptake in Pseudomonas aeruginosa: possible involvement of porin OprF in iron translocation. J Gen Microbiol 138, 951958.[Abstract/Free Full Text]

Michel, L., Gonzales, N., Jagdeep, S., Nguyen-Ngoc, T. & Reimmann, C. (2005). PchR-box recognition by the AraC-type regulator PchR of Pseudomonas aeruginosa requires the siderophore pyochelin as an effector. Mol Microbiol 58, 495509.[CrossRef][Medline]

Miller, V. & Mekalanos, J. (1988). A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 170, 25752583.[Abstract/Free Full Text]

Nelson, K. E., Weinei, C., Paulsen, I. T. & 40 others (2002). Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 4, 799808.[CrossRef][Medline]

Ockels, W., Römer, A. & Budzikiewicz, H. (1978). An Fe(III) complex of pyridine-2,6-di (monothiocarboxylic acid) a novel bacterial metabolic product. Tetrahedron Lett 36, 33413342.

Paszczynski, A., Sebat, J., Erwin, D. & Crawford, R. L. (2004). Biotransformation of carbon tetrachloride by the facultative anaerobic bacterium Pseudomonas stutzeri. In Strict and Facultative Anaerobes: Medical and Environmental Aspects, 1st edn, pp. 317328. Edited by M. M. Nakano & P. Zuber. Wymondham: Horizon Bioscience.

Poole, K. & McKay, G. A. (2003). Iron acquisition and its control in Pseudomonas aeruginosa: many roads lead to Rome. Front Biosci 8, 661686.[CrossRef]

Schweizer, H. P. (1993). Small broad-host-range gentamycin resistance gene cassettes for site-specific insertion and deletion mutagenesis. BioTechniques 15, 831833.[Medline]

Sebat, J., Paszczynski, A., Cortese, M. & Crawford, R. L. (2001). Antimicrobial properties of pyridine-2,6-dithiocarboxylic acid, a metal chelator produced by Pseudomonas spp. Appl Environ Microbiol 67, 39343942.[Abstract/Free Full Text]

Sepulveda-Torres, L. d, C., Huang, A., Kim, H. & Criddle, C. S. (2002). Analysis of regulatory elements and genes required for carbon tetrachloride degradation in Pseudomonas stutzeri strain KC. J Mol Microbiol Biotechnol 4, 151161.[Medline]

Stolworthy, J. C., Paszczynski, A., Korus, R. A. & Crawford, R. L. (2001). Metal binding by pyridine-2,6-bis(monothiocarboxylic acid), a biochelator produced by Pseudomonas stutzeri and Pseudomonas putida. Biodegradation 12, 411418.[CrossRef][Medline]

Visca, P., Leoni, L., Wilson, M. J. & Lamont, I. L. (2002). Iron transport and regulation, cell signaling and genomics: lessons from Escherichia coli and Pseudomonas. Mol Microbiol 45, 11771190.[CrossRef][Medline]

Received 4 May 2006; revised 15 June 2006; accepted 21 June 2006.