Abstract
Abbreviations: IHT, island of horizontal transfer; MLEE, multi-locus enzyme electrophoresis; MLST, multi-locus sequence typing; mCGH, microarray comparative genome hybridization; RMS, restriction/modification system
The ArrayExpress accesssion numbers for the array data related to this paper are A-TIGR-22 and E-TIGR-129.
A supplementary figure and two supplementary tables are available with the online version of this paper.
N. meningitidis is a causative agent of epidemic bacterial meningitis but is also a commensal isolated from 820 % of healthy individuals (Janda & Knapp, 2003). Upon acquisition, N. meningitidis may colonize the nasopharynx and can cross the epithelial barrier to enter the bloodstream. In the bloodstream, it can replicate causing septicaemia and/or cross the bloodbrain barrier to cause meningitis.
There are five major pathogenic serogroups of N. meningitidis (A, B, C, W135 and Y) based on different capsular polysaccharide structures (Janda & Knapp, 2003). However, these pathogenic serogroups arise from a limited number of genetically defined clonal complexes that emerge and spread globally (Stephens, 1999). For example, W135 strains were known to be pathogenic but were not usually responsible for widespread outbreaks (Aguilera et al., 2002). Recently, novel W135 strains in the ST-11/ET-37 clonal complex have emerged and were responsible for worldwide meningitis outbreaks in pilgrims returning from the 2000 and 2001 Hajj pilgrimages and for regional outbreaks in 2002 and 2003 in Burkina Faso (Aguilera et al., 2002).
N. meningitidis strains MC58 and Z2491 have published genome sequences (Parkhill et al., 2000; Tettelin et al., 2000). N. gonorrhoeae FA1090 (GenBank AE004969) and N. meningitidis FAM18 () genome sequences are also available. Other genome-based techniques such as comparative genome hybridization (mCGH) and subtractive hybridization have addressed issues of (1) cross-species comparisons, (2) particular islands of horizontal transfer, (3) phylogeny, (4) particular regions of biological interest, and/or (5) total genomic content (Bille et al., 2005; Perrin et al., 1999, 2002; Snyder et al., 2004, 2005; Snyder & Saunders, 2006; Stabler & Hinds, 2006; Stabler et al., 2005). We sought to explore the variable gene content of N. meningitidis in an effort to understand the prevalence and importance of horizontal gene transfer within this important, naturally competent organism.
N. meningitidis strains can be differentiated by multi-locus enzyme electrophoresis (MLEE) patterns and multi-locus sequence typing (MLST) (Achtman, 1995; Maiden et al., 1998). We used mCGH to examine many diverse meningococcal strains, comparing genomes and assessing large insertion/deletion events. We found that meningococci can be placed into groups based on their mCGH profiles that significantly overlap with clonal complexes. Other significant insights into pathogenicity genes, invasive strains and the emerging W135 epidemic strains are discussed.
Bacterial strains.The strains used are listed in Table 1. The spatial and temporal distribution, the extensive phenotypic and genetic typing, and the characterization of most of these N. meningitidis strains have been previously reported (Grifantini et al., 2002; Maiden et al., 1998; Parkhill et al., 2000; Pizza et al., 2000; Seiler et al., 1996; Tettelin et al., 2000; Wang et al., 1993). The strains represent the population of N. meningitidis, making them ideal candidates for drawing biological conclusions from a whole-genome study.
Table 1. Strain information NA, not applicable; ND, not described; NG, not a groupable serogroup; CDC, from the CDC collection with no associated publication.
Microarray construction.
Primers were designed from the unique predicted genes annotated in MC58, as previously described (Grifantini et al., 2002). Subsequently, primers were designed to unique regions of Z2491, FAM18 and FA1090. Amplicons of an average size of 495 bp were produced using AmpliTaq (Applied Biosystems), purified using filtration plates (Millipore), and analysed on agarose gels. The purified amplicons were diluted 1 : 1 with DMSO, spotted in triplicate onto Corning UltraGap slides with a Lucidea printing robot (GE Healthcare), and irradiated with ultraviolet light. The microarray slide type has been deposited in ArrayExpress (A-TIGR-22).
Hybridizations.
Cy3 and Cy5 probes were synthesized from genomic DNAs as previously described (Tettelin et al., 2001). Briefly, amino-allyl-dUTP-labelled probes were synthesized from 4 µg genomic DNA using Klenow Fragment (3'→5' exo-) (New England Biolabs). The reactions were purified using the QIAquick PCR purification kit (Qiagen) with modified phosphate buffers. Cy3 or Cy5 dyes (GE Healthcare) were chemically coupled to the incorporated amino-allyl-dUTP in carbonate buffer. Cy3- and/or Cy5-labelled probes were synthesized at least twice from each genomic preparation. Probe pairs were resuspended in 5 % SSC, 50 % formamide and 0.1 % SDS, and hybridized to slides overnight at 42 °C. The hybridized slides were washed in 2x SSC, 0.1 % SDS at 55 °C; 0.1x SSC, 0.1 % SDS at room temperature; 0.1x SSC at room temperature; and MilliQ water at room temperature. They were then dried, and scanned using a GenePix4000B scanner (Molecular Devices). The corresponding images were analysed using TIGR Spotfinder (Saeed et al., 2003). The microarray study has been deposited in ArrayExpress (E-TIGR-129).
Data analysis and bioinformatics.
Ratios (Cy5/Cy3) were normalized using iterative log-mode centring, whereby the mode of the log2(Ratio) histogram with bin size 0.1 was centred at zero (Lindroos et al., 2005; Read et al., 2003). The mean normalized log2(Ratio) and standard deviation was then calculated from all replicates (at least two slides each with three spotted replicates) with good Spotfinder flags (B or C). The program GACK (Kim et al., 2002), which uses dynamic thresholds and has been used in other Neisseria mCGH studies (Snyder et al., 2004; Stabler et al., 2005), was explored as an alternative to normalization. However, between closely related species (e.g. H44/76) or in self/self hybridizations a sharp histogram resulted which led to GACK erroneously picking genes as divergent. Therefore GACK was not further explored.
Prediction of absent/present genes.
Since the microarray contains four organisms and MC58 (reference) DNA will not hybridize to Z2491-, FA1090- and FAM18-specific amplicons, nucleotide similarity results between spotted amplicons and genome sequences were used in combination with the observed ratios to predict absence/presence when presenting microarray data in the context of the four genomes (e.g. in Fig. 7). An amplicon from the other three strains was considered present in the MC58 genome if it was >70 % identical to MC58 over >90 % of the length of the amplicon. When an amplicon was present in MC58, a ratio >3 predicted absence or significant divergence, a ratio <2 predicted presence, and a ratio between 2 and 3 was determined to not be predictive. In correspondence, when an amplicon was absent from MC58, a ratio >0.5 predicted absence, a ratio <0.33 predicted presence, and a ratio between 0.5 and 0.33 was determined to not be predictive. When fluorescence was undetected in either channel, no prediction was made. The reliability of this correspondence analysis is evident on the FA1090 circle in Fig. 7, where the rim is nearly empty compared to the N. meningitidis rims. Further support for this analysis is evident in the results and subsequent PCR verification presented in Fig. 3.
Table 1. The ratios [(MC58 normalized intensity)/(query normalized intensity)] were divided into three categories: ratio <2, most likely present in the test strain (not shown); ratio >3, mostly likely absent or divergent in the test strain (red); ratio 23, not predicted (blue); regions where no prediction can be made (grey). The previously described MC58 islands of horizontal gene transfer (IHT-B, IHT-C) and the putative prophage are found to be variable across the species/strains tested. Taken together, six of these islands (MuMenB/PNM2, PNM1, IHT-B, IHT-C, IHT-D and IHT-E) differentiate the meningococcal isolates into five different groups also identified by hierarchical clustering (see Fig. 6), which are colour coded (Table 1).
|
Clustering analysis.
The mCGH data were clustered using various algorithms in the TIGR MeV software available in the TM4 software package (Saeed et al., 2003). Support trees were constructed using a Euclidean distance and average linkage. Experiment trees were resampled by bootstrapping genes.
K-means clustering was carried out using Euclidean distance and calculated means. Fifteen clusters were selected and the solution converged after 22 iterations. The number of clusters selected was determined by running figures of merit on the dataset 10 times with a maximum number of clusters of 50 and with 100 iterations. Consistently, 20 seemed to be an appropriate number of clusters.
Confirmation of variable regions by amplification.
Amplicons were generated using High Fidelity Taq (Invitrogen) according to the manufacturer's suggestions with 1.0 µM of each primer. Reactions were initiated with a 2 min incubation at 95 °C followed by 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 68 °C for 10 min and with a final elongation at 72 °C for 10 min. Primers were designed using the MC58 genome: NMB_0895F, ATTTTAATTACGAAGGCTACGCATT; NMB_0901R, GGGACACCCGCGAAGTTTTGGAAGC; NMB_0910F, CTGTCAGTTGTCTCGTGCATTGTCA; NMB_0912R, GTTGCGGGCTGTTGCGTCGGAAACC; NMB_0917F, ATGGATAAGCGCGACCAGTTCGCCG; NMB_0919F, GATGTGTTTGGCAATCATGGCTTG; NMB_0920R, CACAAGTGATGCGTCCGAGCGTAA.
To delineate absent and divergent genes from present genes, two hybridization ratio thresholds were defined. An excessively high ratio threshold fails to identify all variation present; an excessively low ratio threshold fails to identify all conservation present. Numerous ratio thresholds and types of thresholds have been reported previously; they vary depending on the organism and microarray. Two ratio thresholds were used in this study that minimized the noise-to-data ratio.
After comparing ratios to nucleotide percentage identity for sequenced Neisseria species, 70 % nucleotide identity was chosen to delineate presence from absence/divergence (Fig. 1, Fig. 2). A ratio greater than 3 predicted absence or divergence (<70 % sequence identity); a ratio less than 2 predicted conservation (>70 % sequence identity); and a ratio between 2 and 3 was not predictive. PCR amplification of one variable region from selected strains confirmed the significance of these predictions (Fig. 3).
|
|
These thresholds minimized the false positives, since incorrectly calling a locus conserved is preferable to incorrectly calling a locus absent. Indeed, gene absence underlies most of the critical conclusions in this study. Additionally, the false negative results were nonrandom and occurred in amplicons spotted on the microarray that gave lower than average fluorescence intensity. When hybridization of the reference DNA yielded low fluorescence for an amplicon, a large ratio was less likely to be obtained (Fig. 4). Indeed, the highest ratios correlated with more fluorescent amplicons [those with higher log10(Product) values].
|
Capsule region
The hybridization results at the meningococcal capsule locus for the strains examined were consistent with their known serogroup assignments, further verifying the significance of the mCGH predictions (Fig. 5; Supplementary Fig. S1). For example, all the serogroup A strains had ratios consistent with presence of sacABCD and absence of synABCD (Fig. S1). Likewise, all the serogroup C strains had a ratio consistent with presence of synE (NMC_0050). However, the predicted serogroup C capsule O-acetyltransferase gene (oatC; NMC_0049) (Claus et al., 2004) was variable across the serogroup C strains (Fig. S1). In addition, strain 528, which has previously been shown to be serogroup B, now contains unique deletions of the capsule region possibly due to routine passaging in vitro (Fig. 5).
|
Three previously characterized non-groupable strains were examined. Strain M5016 is known to be non-groupable due to a point mutation in a Y-like capsule region (Dolan-Livengood et al., 2003); the array results were consistent with the presence of a Y-like capsule, but the point mutation could not be assayed with this method. Strain M4950 is known to have lost the synABC genes (Dolan-Livengood et al., 2003), which was also detected by mCGH. Lastly, M5020 has been shown to be missing the entire capsule locus between galE and tex, similar to N. gonorrhoeae (Dolan-Livengood et al., 2003). The microarray indicated extensive loss of this region, with the greatest similarity in configuration to N. lactamica NL19, which may suggest horizontal transfer of this region from N. lactamica.
Other novel variations are seen across the capsule region that will require further characterization: (a) serogroup B gene NMB_0065 displayed a variable distribution in diverse strains across all the serogroups and (b) groups of strains were identified that have absence/divergence of lipAB (Fig. S1). The lipAB genes are predicted to encode phospholipid lipidation genes that provide the diacylglycerol anchor for the polymer in the outer membrane; but they may encode capsule chaperones, as deletion of lipAB leads to intracellular capsule accumulation of lipidated capsule polymers (Tzeng et al., 2005).
Hierarchical clustering and islands of horizontal transfer
A support tree (Graur & Li, 2000) generated using mCGH ratios grouped meningococcal isolates of similar MLST clusters together, but could not differentiate the specific sequence types (e.g. ST-32/ET-5 complex and ST-269) (Fig. 6; Supplementary Table S1). However, various groups of strains were identified that had very similar profiles and were defined as mCGH groups (Table 1). This clustering should not be mistaken as a phylogenetic analysis. These strains are closely related and the large islands of horizontal transfer will lead to stochastic effects in conducting a phylogenetic analysis with these CGH analysis. Such an analysis has been successfully conducted with more divergent Neisseria species (Stabler et al., 2005).
Table 1). Although similar to MLST clusters, this grouping could not differentiate the specific sequence types. Six islands are predominantly responsible for differentiating the meningococcal isolates into five different mCGH groups (see also Fig. 7).
In addition, using the ratio-thresholds described above, genes were categorized and plotted according to the corresponding amplicon location in each sequenced genome (Fig. 7). The previously described MC58 islands of horizontal gene transfer (IHT) (Tettelin et al., 2000) and putative prophage regions (Masignani et al., 2001; Parkhill et al., 2000; Tettelin et al., 2000) were found to be variable across the Neisseria species and meningococcal strains tested (Table 1). Except for the expected changes in the capsule region according to serogroup, most of IHT-A appeared to be present in all of the N. meningitidis strains although not in N. gonorrhoeae or N. lactamica. In addition to these large IHT elements, smaller variable regions of a single or a few genes exist with atypical nucleotide content (Tettelin et al., 2000). These often corresponded to genes that were absent/divergent in a variety of strains in the mCGH results, lending further evidence to these being smaller potential IHTs (Fig. 7). While variable regions are often associated with atypical nucleotide content, there were several variable regions that had nucleotide content typical of the meningococcus, suggesting transfer between species of similar nucleotide content (e.g. IHT-D in MC58 Fig. 7).
Taken together, six of these islands (MuMenB/PNM2, PNM1, IHT-B, IHT-C, IHT-D, IHT-E) differentiated N. meningitidis into the five groups (Fig. 6, Fig. 7, Table 1) also identified by hierarchical clustering. The two N. gonorrhoeae strains were missing all of these islands while the two N. lactamica strains had IHT-D. The only other set of strains to contain IHT-D were those in the mCGH-5 group (Table 1), which includes MC58, a result that supports the idea that genes can be transferred between pathogenic and commensal Neisseria species (Feil et al., 1996; Linz et al., 2000). In addition to IHT-D, mCGH-5 isolates also contained MuMenB/PNM2 and had variable presence of IHT-B/IHT-C. MuMenB and PNM2 are distinct phage regions in Z2491 and MC58 but have overall high nucleotide similarity (Supplementary Table S2); no attempts were made to differentiate them in this analysis. Examination of individual prophage-specific genes may allow for identification of the presence of MuMenB or PNM2, but that is beyond the scope of this paper. However, careful analysis is required, as some prophage genes have been duplicated in the sequenced N. meningitidis genomes; alternative duplications are likely in unsequenced genomes.
The mCGH-4 strains had IHT-B/IHT-C as well as MuMenB/PNM2. The mCGH-2 strains, which contain Z2491 and the well-studied clonal serogroup A strains, had both prophage regions (MuMenB/PNM2 and PNM1) but none of the other IHT elements. Strains from the mCGH-1 group were the most similar of all the N. meningitidis strains to N. gonorrhoeae and N. lactamica as they lacked all six islands except for some variation in the presence of MuMenB/PNM2. However, they were distinctly N. meningitidis strains as they possess all or portions of IHT-A (capsule region) and were lacking the N. gonorrhoeae islands. The mCGH-1 strains are likely to have their own IHT element(s) that could not be interrogated by mCGH since there are no sequenced meningococci from this group.
Lastly, the mCGH-3 group was differentiated by the absence of all islands except IHT-E. In FAM18 and the other mCGH-3 strains, the 44 kB IHT-E region encoded an intact prophage (NMC_0836-NMC_0883) and an adjacent transposon (NMC_0884-NMC_0894) (Fig. 3). In N. gonorrhoeae, N. lactamica and N. meningitidis mCGH-1 and mCGH-2 strains, the prophage and transposon were completely absent. In mCGH-4 and mCGH-5 strains, the two plasmid/prophage addiction modules were retained (for a review see Engelberg-Kulka & Glaser, 1999), but an internal portion of the prophage, including the head and tail morphogenesis genes, was replaced with an IS30 transposase homologue (NMB_0911). The loss of this portion may have occurred when a second transposase inserted into the prophage, followed by homologous recombination excising the internal region. The right flank of the excision appeared to be maintained in all mCGH-4 and mCGH-5 strains. In strains 1000, 528, NG E28, NG E311 and M2436, additional genes from this region appeared to be absent or divergent (Fig. 3).
The adjacent transposon appeared to be a separate mobile element, as it has variable presence in all mCGH groups. This transposon contained genes that likely encode the MFP (NMC_0887) and ABC (NMC_0888) components of a type I secretion system.
Genes linked to IHTs
K-means clustering (Soukas et al., 2000) was employed to further elucidate the relationship between gene complement and phenotype. Most of the clusters contained N. lactamica- or N. gonorrhoeae-specific genes or the IHT elements previously discussed. However, two interesting clusters comprised genes clustering with the IHTs. For mCGH-3 strains, 13 smaller islands were unique to these isolates in addition to IHT-E (Table 2). These islands were scattered throughout the FAM18 genome and include restriction/modification systems, a fimbrial protein precursor, a putative TonB-dependent receptor, a transcription regulator, a putative phage protein, a transferrin-binding protein precursor, and numerous uncharacterized hypothetical, conserved hypothetical, and outer-membrane proteins. Seven small islands were unique to mCGH-2 strains besides the previously described IHTs (Table 3) including capsule genes, putative phage genes, a putative DNA-binding protein and numerous hypothetical proteins. The conservation of these smaller islands in these groups of strains suggests that either the strains within these mCGH groups evolved from a single common ancestor, or the islands were acquired at one time and have been moved around the genomes that have been sequenced.
Table 2. Genes clustering with IHT-E in mCGH-3 strains
Table 3. Genes clustering with PNM1 in the mCGH-2 strains
Core genome
The core N. meningitidis genome consisted of genes present and highly conserved in nucleotide sequence across a wide diversity of strains (ratio <3 in all 49 N. meningitidis strains) (Table S2). This core gene list included 1706 genes [79 % of MC58 genes similar to the previously reported 78 % (Perrin et al., 2002)] and was consistent with a map of metabolic pathways constructed from the genome sequencing data of MC58 (Fig. 8). Of these core genes, 624 (36.6 %) were hypothetical proteins with no known function.
|
N. meningitidis- and pathogen-specific genes
By comparing the subsets of genes absent in N. lactamica and N. gonorrhoeae, potential N. meningitidis-specific genes and pathogen-specific genes were identified. This list should not be considered an exhaustive one, considering the small number of non-meningococcal isolates examined. A total of 122 potential N. meningitidis-specific genes were identified based on their mCGH ratios, indicating that they were absent/divergent only in N. lactamica NL17, N. lactamica NL19, N. gonorrhoeae FA1090 and N. gonorrhoeae F62 (Table S2). More than half of these N. meningitidis-specific genes (64 genes) are hypothetical proteins. The remaining functionally annotated N. meningitidis-specific genes include genes for capsule biosynthesis, secretion proteins, haemolysins, transcriptional regulators and iron uptake, as well as numerous genes in a previously identified prophage region (Masignani et al., 2001).
Of the N. meningitidis-specific genes, 18 were found in all the N. meningitidis strains and might be considered core N. meningitidis-specific genes (Table 4). Half of these genes were hypothetical proteins. The remaining core N. meningitidis-specific genes include three FrpA/C proteins, two putative secretion proteins, a putative transporter, a putative TonB-dependent receptor, a Cu-Zn superoxide dismutase, and a thiol : disulfide interchange protein, DsbA. Although these core N. meningitidis genes are important and include some known pathogenicity factors, the selection of N. meningitidis strains includes numerous strains not known to cause disease. Therefore, not all N. meningitidis-specific pathogenicity factors are likely to be identified.
Table 4. Core N. meningitidis genes absent/divergent in N. lactamica and N. gonorrhoeae but present in all N. meningitidis strains
A total of 60 potential core pathogen-specific genes were absent/divergent in the commensal organisms, N. lactamica NL17 and N. lactamica NL19 (Table S2) but found in all the pathogenic strains tested. These potential core pathogen-specific genes include known pathogenicity factors and genes identified as differentially regulated upon contact with host cells (Table S2).
Some genes and gene clusters from metabolic pathways were identified as being absent/divergent in commensal Neisseria species. These include a gluconate permease and gluconokinase; a D-amino acid dehydrogenase and putative sodium/alanine symporter; a putative 2-methylcitrate pathway; and an arginine decarboxylase, agmatinase and C4-dicarboxylate transporter. These include four distinct genomic loci (NMB_2027-NMB_2028, NMB_0176-NMB_0177, NMB_0430-NMB_0431 and NMB_0433, NMB_0468-0470, respectively).
Invasive and carriage isolates
The strains were selected to include invasive and carriage isolates. No genes were identified by either K-means clustering or hierarchical clustering that were over-represented in either hypervirulent isolates (from ST-8/Cluster A4, ST-32/ET-5 and ST-44/Lineage 3) or invasive isolates.
Meningococcal isolates of similar MLST profiles (Maiden et al., 1998) could be grouped together using hierarchical clustering, but the specific sequence types (e.g. ST-32/ET-5 complex and ST-269) could not be resolved. The similarity of mCGH and MLST results is likely due to both methods examining sequences throughout the genome, as opposed to a single sequence. This similarity suggests that although naturally competent, Neisseria species inherit/lose foreign genes at a low enough frequency that overall genome content can be predicted based on MLST, and it further validates the use of MLST for meningococcal population studies.
As an example, W135 strains have two distinctly different placements on the hierarchical support tree. Two W135 strains isolated from Hajj pilgrims were located with another ST-11/ET-37 isolate (NG P165) and with isolates in the ST-8/Cluster A4. Two W135 strains isolated from sporadic cases in North America prior to the W135 outbreaks of the Hajj pilgrimage were found clustered in mCGH-1 next to the serogroup A strains of mCGH-2. The close relationship of the mCGH-3 W135 Hajj strains to the other ST-11/ET-37 strains is suggestive that the ancestor to these strains was an ST-11/ET-37 isolate that acquired the W135 capsule locus. This may not have been a recent event, but the organism may have had a recent selective advantage and emerged possibly from the usage of the serogroup A and C meningococcal polysaccharide vaccine in Hajj pilgrims prior to 2002. A similar vaccine-induced pressure has been observed in Streptococcus pneumoniae, with an increase in serotype 19A-associated disease after use of a vaccine that does not include this serotype (Kyaw et al., 2006).
Pathogenesis and horizontal gene transfer
The N. meningitidis genome is characterized by the horizontal acquisition of multiple genetic islands that contain pathogenicity factors as well as numerous hypothetical proteins. These genetic islands appear to be acquired both from within N. meningitidis strains as well as from N. gonorrhoeae and/or N. lactamica. Examples of the latter may include (a) replacement of the N. meningitidis capsule locus in strain M5020 with that of N. gonorrhoeae or N. lactamica and (b) transfer of IHT-D between N. lactamica and mCGH-5 N. meningitidis strains. MuMenB, PNM2, PNM1 and IHT-E seem to all be intact prophages. IHT-D and IHT-C encode proteins with homology to prophage elements. Likewise, IHT-B encodes proteins with homology to plasmid replication genes. This suggests that these may be less characterized mobile elements. Mobile elements are often associated with moving pathogenicity islands between strains and this continues to be the case with N. meningitidis.
For example, a genetic island containing a chromosomally integrated bacteriophage was found previously to be associated with 100 % of hypervirulent lineages and absent from 90 % of noninvasive isolates (Bille et al., 2005). In the current study, this island was present in 60 % of the virulent strains and 42 % of the carriage strains examined, suggesting that this phage may be a marker for certain hypervirulent clonal groups (e.g. ST-11), but is not a characteristic of all invasive meningococcal strains.
Islands may also be transferred to/from other respiratory colonizers. The transposon adjacent to IHT-E, which varies across all mCGH groups, contained genes that likely encode two of three components of a type I secretion system (the MFP and ABC components). These proteins are most similar (41 % and 55 % amino acid identity) to uncharacterized proteins encoded on a Moraxella catarrhalis plasmid. M. catarrhalis can cause otitis media, sinusitis, bronchitis and pneumonia, and was once thought to be closely related to Neisseria species (Janda & Knapp, 2003). This highest similarity to a γ-proteobacterial protein suggests possible ancient horizontal transfer between these respiratory colonizers. Type I secretion systems are often involved in pathogenicity as they secrete toxins, degradative enzymes and antibiotics. In Moraxella species and N. meningitidis, other type I secretion systems have been shown to be involved in secretion of RTX toxin-like exoproteins (Angelos et al., 2003; Wooldridge et al., 2005). In N. meningitidis, the function of these RTX toxin-like exoproteins has remained elusive, but in Moraxella bovis and other γ-proteobacteria, they appear to be functional haemolysins (Angelos et al., 2003; Wooldridge et al., 2005). The MFP and ABC components of the type I secretion system are often genetically linked to the exported substrate/toxin. A third large open reading frame in the transposon (NMC_0891 and a conserved hypothetical protein with significant matches only to N. meningitidis strains) should be examined as a potential substrate for this type I secretion system. The third component necessary for a functional secretion system (TolC) has been identified in N. meningitidis strains (Wooldridge et al., 2005) and is typically not genetically linked to the MFP and ABC components.
While many of the islands are in defined subsets of closely related strains, others, like IHT-B and IHT-C, vary in their presence within diverse mCGH groups (Table 1). Despite this variable presence across strains of the different mCGH groups, strains containing IHT-B always contained IHT-C. IHT-B and IHT-C contain genes for numerous hypothetical proteins and large (>5 kb) genes for haemagglutinin/haemolysin-related proteins. Upon comparing the genomes of FA1090 and Z2491, IHT-B and IHT-C are the sites for a synteny break with MC58. This raises the possibility that they were once a single inheritable island that was broken by a genome rearrangement in MC58. The variability of the IHT-B/IHT-C islands across the mCGH groups suggests that these islands have been gained and lost on multiple occasions, possibly owing to the recombinant nature and transformability of Neisseria species (Feil et al., 2001). However, these events occur infrequently, such that the genomic-level relationship between strains, apparent from the presence of more characteristic islands, appears to remain intact.
Restriction/modification systems
One class of genes that is found to vary extensively across the different clusters is composed of restriction/modification systems (RMSs). It has been proposed that in N. meningitidis, RMSs could be used to restrict DNA uptake to only organisms within its clonal complex or sequence type (Claus et al., 2000). This conclusion is supported in this study by the clustering of genes by sequence types with RMSs. For example, three intact genes of an RMS are present in the N. gonorrhoeae capsule locus, while the endonuclease is absent from all N. meningitidis strains examined (Fig. S1). The modification enzymes are truncated and frame-shifted in the sequenced N. meningitidis strains, making their functional presence difficult to assess with mCGH. But loss of this system in all the N. meningitidis strains may prevent transfer of the N. meningitidis capsule genes into N. gonorrhoeae strains.
Comparisons with other genome-based studies
Some of the N. meningitidis-specific genes, core genes and pathogen-specific genes have been described previously (Bille et al., 2005; Perrin et al., 1999, 2002; Snyder et al., 2004, 2005; Snyder & Saunders, 2006; Stabler & Hinds, 2006; Stabler et al., 2005). However, the alternative methods, different microarray platforms, the breadth of strains examined, and dissimilar analysis methods lead to some differences (Table S2). The interpretation of mCGH hybridizations is highly dependent on platform and analysis methods. Despite these differences, this study together with the series of CGH studies with Neisseria spp. recently presented in the literature with their unique emphases on (1) cross-species comparisons, (2) particular islands of horizontal transfer, (3) phylogeny, (4) particular regions of biological interest, and/or (5) total genomic content each identify important gene sets that may be important for virulence. Because of the diverse emphases between the studies, we have limited a comparison to a tabular format that enables researchers to identify common and differing results of interest in a relatively straightforward manner. This includes select genomic results from genome sequencing (Parkhill et al., 2000; Tettelin et al., 2000), mCGH (Bille et al., 2005; Perrin et al., 1999, 2002; Snyder et al., 2004, 2005; Snyder & Saunders, 2006; Stabler & Hinds, 2006; Stabler et al., 2005), expression microarray (Dietrich et al., 2003; Grifantini et al., 2002) and signature-tagged mutagenesis results (Sun et al., 2000) (Table S2).
Absence/divergence of metabolic genes
Some genes and gene clusters from metabolic pathways were identified as being absent/divergent in commensal Neisseria species. Several of these constitute the absence/divergence of an entire pathway in the commensal organisms (Fig. 8). The D-amino acid dehydrogenase and the putative sodium/alanine symporter were found to be differentially regulated upon contact with host cells (Dietrich et al., 2003; Grifantini et al., 2002). Both gluconate and methylcitrate utilization have been shown in other pathogens to be involved in intracellular growth within macrophage cells (Brämer & Steinbüchel, 2001; Eriksson et al., 2003; Stone et al., 1999). N. meningitidis and N. gonorrhoeae are both internalized by epithelial cells, where they survive and grow in the process of epithelial cell traversal (Merz & So, 2000; Nassif et al., 1999). Gluconate and/or methylcitrate utilization may thus be important for growth/survival in epithelial cells and may be novel antimicrobial targets.
Concluding remarks
mCGH experiments allow for rapid parallel comparison of the gene content of a wide variety of strains. This facilitates understanding of genomic differences between diverse species and strains, and provides insights into their pathogenic potential. In the case of the Neisseriaceae, organisms as distantly related as N. lactamica and N. gonorrhoeae could be examined reliably owing to the representation of four genomes on the microarray platform. This allowed the detection of a set of genes transferred between N. meningitidis and N. lactamica, as well as the identification of insertion/deletion events specific to groups of strains, identification of the core N. meningitidis genome, and insights into horizontal gene transfer in N. meningitidis. Acquisition of some genetic islands appears to have occurred in multiple lineages, and their study revealed important sets of genes related to pathogenicity. Acquisition of islands does not occur so frequently as to obscure the genomic-level relationship within the Neisseria population. Genomic changes parallel the MLST profiles of the strains examined, suggesting that subsequent sequencing of genomes based on their MLST profiles would provide additional clues regarding pathogenicity and may identify unique vaccine or antimicrobial targets.
Footnotes
†Present address: Departments of Structural Biology and Microbiology and Immunology, Stanford University, School of Medicine, Stanford, CA 94305, USA.References
Aguilera, J.-F., Perrocheau, A., Meffre, C., Hahné, S. & Group, T. W. W. (2002). Outbreak of the serogroup W135 meningococcal disease after the Hajj pilgrimage, Europe, 2000. Emerg Infect Dis 8, 761767.[Medline]
Angelos, J. A., Hess, J. F. & George, L. W. (2003). An RTX operon in hemolytic Moraxella bovis is absent from nonhemolytic strains. Vet Microbiol 92, 363377.[CrossRef][Medline]
Bille, E., Zahar, J. R., Perrin, A. & 7 other authors (2005). A chromosomally integrated bacteriophage in invasive meningococci. J Exp Med 201, 19051913.
Bovre, K. (1984). Family VIII. Neisseriaceae. In Bergey's Manual of Systematic Bacteriology, pp. 288296. Edited by N. R. Krieg & J. G. Holt. Baltimore: Williams & Wilkins.
Brämer, C. O. & Steinbüchel, A. (2001). The methylcitric acid pathway in Ralstonia eutropha: new genes identified involved in propionate metabolism. Microbiology 147, 22032214.
Claus, H., Friedrich, A., Frosch, M. & Vogel, U. (2000). Differential distribution of novel restriction-modification systems in clonal lineages of Neisseria meningitidis. J Bacteriol 182, 12961303.
Claus, H., Borrow, R., Achtman, M., Morelli, G., Kantelberg, C., Longworth, E., Frosch, M. & Vogel, U. (2004). Genetics of capsule O-acetylation in serogroup C, W-135 and Y meningococci. Mol Microbiol 51, 227239.[CrossRef][Medline]
Comanducci, M., Bambini, S., Brunelli, B. & 12 other authors (2002). NadA, a novel vaccine candidate of Neisseria meningitidis. J Exp Med 195, 14451454.
Dempsey, J. A., Litaker, W., Madhure, A., Snodgrass, T. L. & Cannon, J. G. (1991). Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes. J Bacteriol 173, 54765486.
Dietrich, G., Kurz, S., Hübner, C., Aepinus, C., Theiss, S., Guckenberger, M., Panzner, U., Weber, J. & Frosch, M. (2003). Transcriptome analysis of Neisseria meningitidis during infection. J Bacteriol 185, 155164.
Dolan-Livengood, J. M., Miller, Y. K., Martin, L. E., Urwin, R. & Stephens, D. S. (2003). Genetic basis for nongroupable Neisseria meningitidis. J Infect Dis 187, 16161628.[CrossRef][Medline]
Engelberg-Kulka, H. & Glaser, G. (1999). Addiction modules and programmed cell death and antideath in bacterial cultures. Annu Rev Microbiol 53, 4370.[CrossRef][Medline]
Eriksson, S., Lucchini, S., Thompson, A., Rhen, M. & Hinton, J. C. D. (2003). Unraveling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol Microbiol 47, 103118.[CrossRef][Medline]
Feil, E., Zhou, J., Maynard Smith, J. & Spratt, B. G. (1996). A comparison of the nucleotide sequences of the adk and recA genes of pathogenic and commensal Neisseria species: evidence for extensive interspecies recombination within adk. J Mol Evol 43, 631640.[CrossRef][Medline]
Feil, E. J., Holmes, E. C., Bessen, D. E. & 9 other authors (2001). Recombination within natural populations of pathogenic bacteria: short-term empirical estimates and long-term phylogenetic consequences. Proc Natl Acad Sci U S A 98, 182187.
Graur, D. & Li, W.-H. (2000). In Fundamentals of Molecular Evolution, 2nd edn, pp. 209210. Sunderland, MA: Sinauer Associates.
Grifantini, R., Bartolini, E., Muzzi, A. & 14 other authors (2002). Previously unrecognized vaccine candidates against group B meningococcus identified by DNA microarrays. Nat Biotechnol 20, 914921.[CrossRef][Medline]
Janda, W. M. & Knapp, J. S. (2003). Neisseria and Moraxella catarrhalis. In Manual of Clinical Microbiology, pp. 585608. Edited by P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller & R. H. Yolken. Washington, DC: American Society for Microbiology.
Kahler, C. M., Blum, E., Miller, Y. K., Ryan, D., Popovic, T. & Stephens, D. S. (2001). exl, an exchangeable genetic island in Neisseria meningitidis. Infect Immun 69, 16871696.
Kim, C. C., Joyce, E. A., Chan, K. & Falkow, S. (2002). Improved analytical methods for microarray-base genome-composition analysis. Genome Biol 3, research0065.00610065.0017.
Kyaw, M. H., Lynfield, R., Schaffner, W. & 14 other authors (2006). Effect of introduction of the pneumococcal conjugate vaccine on drug-resistant Streptococcus pneumoniae. N Engl J Med 354, 14551463.
Lindroos, H. L., Mira, A., Repsilber, D., Vinnere, O., Naslund, K., Dehio, M., Dehio, C. & Andersson, S. G. (2005). Characterization of the genome composition of Bartonella koehlerae by microarray comparative genomic hybridization profiling. J Bacteriol 187, 61556165.
Linz, B., Schenker, M., Zhu, P. & Achtman, M. (2000). Frequent interspecific genetic exchange between commensal Neisseriae and Neisseria meningitidis. Mol Microbiol 36, 10491058.[CrossRef][Medline]
Maiden, M. C. J., Bygraves, J. A., Feil, E. & 10 other authors (1998). Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A 95, 31403145.
Masignani, V., Giuliani, M. M., Tettelin, H., Comanducci, M., Rappuoli, R. & Scarlato, V. (2001). Mu-like prophage in serogroup B Neisseria meningitidis coding for surface-exposed antigens. Infect Immun 69, 25802588.
McAllister, C. F. & Stephens, D. S. (1993). Analysis in Neisseria meningitidis and other Neisseria species of genes homologous to the FKBP immunophilin family. Mol Microbiol 10, 1323.[Medline]
McGuinness, B. T., Clarke, I. N., Lambden, P. R., Barlow, A. K., Poolman, J. T., Jones, D. M. & Heckels, J. E. (1991). Point mutation in meningococcal Por-A gene associated with increased endemic disease. Lancet 337, 514517.[CrossRef][Medline]
Merz, A. J. & So, M. (2000). Interactions of pathogenic neisseriae with epithelial cell membranes. Annu Rev Cell Dev Biol 16, 423457.[CrossRef][Medline]
Nassif, X., Pujol, C., Morand, P. & Eugène, E. (1999). Interactions of pathogenic Neisseria with host cells. Is it possible to assemble the puzzle? Mol Microbiol 32, 11241132.[CrossRef][Medline]
Nelson, K. E., Paulsen, I. T. & Fraser, C. M. (2001). Microbial genome sequencing: a window into evolution and physiology. ASM News 67, 310317.
Oster, P., Lennon, D., O'Hallahan, J., Mulholland, K., Reid, S. & Martin, D. (2005). MeNZB: a safe and highly immunogenic tailor-made vaccine against the New Zealand Neisseria meningitidis serogroup B disease epidemic strain. Vaccine 23, 21912196.[CrossRef][Medline]
Parkhill, J., Achtman, M., James, K. D. & 25 other authors (2000). Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature 404, 502506.[CrossRef][Medline]
Perrin, A., Nassif, X. & Tinsley, C. (1999). Identification of regions of the chromosome of Neisseria meningitidis and Neisseria gonorrhoeae which are specific to the pathogenic Neisseria species. Infect Immun 67, 61196129.
Perrin, A., Bonacorsi, S., Carbonnelle, E., Talibi, D., Dessen, P., Nassif, X. & Tinsley, C. (2002). Comparative genomics identifies the genetic islands that distinguish Neisseria meningitidis, the agent of cerebrospinal meningitis, from other Neisseria species. Infect Immun 70, 70637072.
Pinner, R. W., Onyango, F., Perkins, B. A. & 7 other authors (1992). Epidemic meningococcal disease in Nairobi, Kenya, 1989. The Kenya/Centers for Disease Control (CDC) Meningitis Study Group. J Infect Dis 166, 359364.[Medline]
Pizza, M., Scarlato, V., Masignani, V. & 33 other authors (2000). Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science 287, 18161820.
Raymond, N. J., Reeves, M., Ajello, G., Baughman, W., Gheesling, L. L., Carlone, G. M., Wenger, J. D. & Stephens, D. S. (1997). Molecular epidemiology of sporadic (endemic) serogroup C meningococcal disease. J Infect Dis 176, 12771284.[Medline]
Read, T. D., Peterson, S. N., Tourasse, N. & 49 other authors (2003). The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria. Nature 423, 8186.[CrossRef][Medline]
Saeed, A. I., Sharove, V., White, J. & 18 other authors (2003). TM4: a free, open-source system for microarray data management and analysis. BioTechniques 34, 374378.[Medline]
Seiler, A., Reinhardt, R., Sarkari, J., Caugant, D. A. & Achtman, M. (1996). Allelic polymorphism and site-specific recombination in the opc locus of Neisseria meningitidis. Mol Microbiol 19, 841856.[CrossRef][Medline]
Snyder, L. A. & Saunders, N. J. (2006). The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as virulence genes. BMC Genomics 7, 128.[CrossRef][Medline]
Snyder, L. A., Davies, J. K. & Saunders, N. J. (2004). Microarray genomotyping of key experimental strains of Neisseria gonorrhoeae reveals gene complement diversity and five new neisserial genes associated with Minimal Mobile Elements. BMC Genomics 5, 23.[CrossRef][Medline]
Snyder, L. A., Jarvis, S. A. & Saunders, N. J. (2005). Complete and variant forms of the gonococcal genetic island in Neisseria meningitidis. Microbiology 151, 40054013.
Soukas, A., Cohen, P., Socci, N. D. & Friedman, J. M. (2000). Leptin-specific patterns of gene expression in white adipose tissue. Genes Dev 14, 963980.
Stabler, R. & Hinds, J. (2006). The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as virulence genes: response. BMC Genomics 7, 129.[CrossRef][Medline]
Stabler, R. A., Marsden, G. L., Witney, A. A., Li, Y., Bentley, S. D., Tang, C. M. & Hinds, J. (2005). Identification of pathogen-specific genes through microarray analysis of pathogenic and commensal Neisseria species. Microbiology 151, 29072922.
Stephens, D. S. (1999). Uncloaking the meningococcus: dynamics of carriage and disease. Lancet 353, 941942.[CrossRef][Medline]
Stone, B. J., Brier, A. & Kwaik, Y. A. (1999). The Legionella pneumophila prp locus; required during infection of macrophages and amoebae. Microb Pathog 27, 368376.
Sun, Y.-H., Bakshi, S., Chalmers, R. & Tang, C. M. (2000). Functional genomics of Neisseria meningitidis pathogenesis. Nat Med 6, 12691273.[CrossRef][Medline]
Swartley, J. S., Marfin, A. A., Edupuganti, S., Liu, L. J., Cieslak, P., Perkins, B., Wenger, J. D. & Stephens, D. S. (1997). Capsule switching of Neisseria meningitidis. Proc Natl Acad Sci U S A 94, 271276.
Tettelin, H., Saunders, N. J., Heidelberg, J. & 39 other authors (2000). Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science 287, 18091815.
Tettelin, H., Nelson, K. E., Paulsen, I. T. & 36 other authors (2001). Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293, 498506.
Tzeng, Y. L., Datta, A. K., Strole, C. A., Lobritz, M. A., Carlson, R. W. & Stephens, D. S. (2005). Translocation and surface expression of lipidated serogroup B capsular polysaccharide in Neisseria meningitidis. Infect Immun 73, 14911505.
van der Ley, P. & Poolman, J. T. (1992). Construction of a multivalent meningococcal vaccine strain based on the class-1 outer-membrane protein. Infect Immun 60, 31563161.
Wang, J. F., Caugant, D. A., Li, X., Hu, X., Poolman, J. T., Crowe, B. A. & Achtman, M. (1992). Clonal and antigenic analysis of serogroup A Neisseria meningitidis with particular reference to epidemiological features of epidemic meningitis in the People's Republic of China. Infect Immun 60, 52675282.
Wang, J. F., Caugant, D. A., Morelli, G., Koumare, B. & Achtman, M. (1993). Antigenic and epidemiologic properties of the ET-37 complex of Neisseria meningitidis. J Infect Dis 167, 13201329.[Medline]
Wooldridge, K. G., Kizil, M., Wells, D. B. & Ala'aldeen, D. A. (2005). Unusual genetic organization of a functional type I protein secretion system in Neisseria meningitidis. Infect Immun 73, 55545567.
Received 28 June 2006; revised 17 August 2006; accepted 18 August 2006.