ENVIRONMENTAL MICROBIOLOGY

Transcriptional profiling of Legionella pneumophila biofilm cells and the influence of iron on biofilm formation

  • 1Laboratoire de Chimie de l'Eau et de l'Environnement, UMR 6008, Université de Poitiers, 40 Avenue du Recteur Pineau, 86022 Poitiers Cedex, France
  • 2Unité de Génomique des Microorganismes Pathogènes and CNRS URA 2171, Institut Pasteur, 28 Rue du Dr Roux, 75724 Paris, France
  • Correspondence
    Yann Héchard
    yann.hechard{at}univ-poitiers.fr
  • Microbiology 2008; 154(1):30–41 · https://doi.org/10.1099/mic.0.2007/008698-0

    View at publisher PubMed

    With thanks to our partners for supporting this archive.

    Abstract

    In aquatic environments, biofilms constitute an ecological niche where Legionella pneumophila persists as sessile cells. However, very little information on the sessile mode of life of L. pneumophila is currently available. We report here the development of a model biofilm of L. pneumophila strain Lens and the first transcriptome analysis of L. pneumophila biofilm cells. Global gene expression analysis of sessile cells as compared to two distinct populations of planktonic cells revealed that a substantial proportion of L. pneumophila genes is differentially expressed, as 2.3 % of the 2932 predicted genes exhibited at least a twofold change in gene expression. Comparison with previous results defining the gene expression profile of replicative- and transmissive-phase Legionella suggests that sessile cells resemble bacteria in the replicative phase. Further analysis of the most strongly regulated genes in sessile cells identified two induced gene clusters. One contains genes that encode alkyl hydroperoxide reductases known to act against oxidative stress. The second encodes proteins similar to PvcA and PvcB that are involved in siderophore biosynthesis in Pseudomonas aeruginosa. Since iron has been reported to modify biofilm formation in other species, we further focused on iron control of gene expression and biofilm formation. Among the genes showing the greatest differences in expression between planktonic cells and biofilm, only pvcA and pvcB were regulated by iron concentration. A ΔpvcA L. pneumophila mutant showed no changes in biofilm formation compared to the wild-type, suggesting that the pvcA product is not mandatory for biofilm formation. However, biofilm formation by L. pneumophila wild-type and a ΔpvcA strain was clearly inhibited in iron-rich conditions.

    • Present address: Institut National de Recherches Agronomiques, Laboratoire de Microbiologie, Centre de Recherche INRA de Clermont Ferrand Theix, 63122 Saint-Genes Champanelle, France.

    • The microarray results for these experiments are accessible on the website (see text for details).

    • Two supplementary tables showing genes with significant differences in expression in sessile and planktonic cells and the expression fold change of genes associated with iron homeostasis are available with the online version of this paper.

    Edited by: S. C. Andrews

    INTRODUCTION

    Legionella pneumophila is the causative agent of a severe pneumonia known as Legionnaires' disease. When infected aerosols are inhaled by humans, bacteria can infect and multiply within alveolar macrophages. In the environment, L. pneumophila is ubiquitously found in natural freshwater as well as in man-made water systems (Steinert et al., 2002), where free-living amoebae constitute an ecological niche allowing bacterial replication (Abu Kwaik et al., 1998). In amoebae, as well as in alveolar macrophages, L. pneumophila is able to inhibit phagosome maturation, giving rise to a specific vacuole where bacteria replicate actively. As nutrients become limiting, L. pneumophila exits from this replicative phase to enter the transmissive phase, resulting in host cell lysis and dispersion of bacteria (Molofsky & Swanson, 2003). While some of these cells re-establish a replicative niche within a new host cell, others survive in the aqueous environment as planktonic cells and/or within biofilms as sessile cells (Molofsky & Swanson, 2004). Biofilms are microbially derived sessile communities irreversibly attached to a substratum, embedded in a secreted extracellular matrix and exhibiting a specific phenotype (Donlan & Costerton, 2002). In the environment, biofilms are the prevalent microbial lifestyle, probably because matrix-embedded microbes enjoy a number of advantages over their planktonic counterparts (Watnick & Kolter, 2000). Indeed, polymeric matrix not only helps to capture and concentrate environmental nutrients, but also acts as a protective barrier against environmental challenges or antimicrobial factors. In addition, specific phenotypes inherent to the sessile mode of growth reduce susceptibility of biofilm cells to antimicrobial agents (Shirtliff et al., 2002; Hall-Stoodley et al., 2004). Legionella biofilm studies that have been conducted on naturally occurring microbial communities in tap water systems have suggested that biofilms allow persistence of L. pneumophila whereas its proliferation most likely requires the presence of amoebae for intracellular growth (Murga et al., 2001; Kuiper et al., 2004; Declerck et al., 2007). Recently, two different studies have investigated the ability of L. pneumophila to form monospecies biofilms. Piao et al. (2006) tested different materials and temperatures for biofilm formation, reporting that on glass and polystyrene biofilms were formed more slowly at 25 °C than at 37 or 42 °C but that they remained more stably attached at 25 °C. At 25 °C biofilms possessed structural features typical of biofilms reported previously (i.e. pillar- and mushroom-like structures) whereas at 37 °C, filamentous, mycelial-mat-like biofilms were the structures observed. Mampel et al. (2006) reported that biofilm formation by L. pneumophila in complex nutrient-rich media most likely relies on adhesion of bacteria grown in the planktonic phase. Also, the Tat secretion pathway has been shown to be involved in the biofilm formation ability of L. pneumophila (De Buck et al., 2005).

    Numerous disinfection methods directed against Legionella have been described in the literature (Kim et al., 2002). Unfortunately, these treatments generally do not lead to a total eradication of the bacterium, and recolonization occurs as soon as the treatments are interrupted (Thomas et al., 2004). Resistance of L. pneumophila to disinfection is due not only to its capacity to enter amoebae, where bacteria could be protected from biocides, but also to its association with biofilms (Abu Kwaik et al., 1998; Thomas et al., 2004; Saby et al., 2005). However, only very little information regarding the physiological state and gene expression of L. pneumophila within biofilms is currently available. A better knowledge of the L. pneumophila sessile lifestyle may help to reduce the presence of L. pneumophila within biofilms and, consequently, decrease its spread in the environment.

    The aim of our work was to design a model biofilm for L. pneumophila and to study gene expression of sessile and planktonic L. pneumophila cells, to learn about the changes occurring in L. pneumophila biofilm. Our results give new insights into L. pneumophila biofilm formation and point to several genes that may be important for biofilm formation and maintenance.

    METHODS

    Bacterial strain and growth conditions.

    L. pneumophila Lens was grown without agitation in filter-sterilized BYE (5 g ACES l−1, 10 g yeast extract l−1; pH 6.9) supplemented with l-cysteine (0.4 g l−1) and ferric pyrophosphate (0.25 g l−1). Solid medium was obtained by adding charcoal (2 g l−1) and agar (15 g l−1) to non-sterilized BYE. The resulting medium (BCYE-agar) was autoclaved and then supplemented with l-cysteine and ferric pyrophosphate prior to use.

    Microtitre plate assays of biofilm formation.

    L. pneumophila biofilm formation was monitored using polystyrene 96-well microtitre plates (Nunclon MicroWell Plates, Nunc). Three distinct procedures were used in this study. (1) Biofilm formation at different temperatures was assayed using cells grown on BCYE plates at 37 °C, 5 % CO2 for 3–4 days. Cells were resuspended in BYE at OD600 0.15 and then aliquoted (150 μl) into eight wells of a 96-well microtitre plate, which was incubated at 20, 37 or 42 °C until late stationary phase. Medium and non-adherent cells were then removed by aspiration and the wells were rinsed with BYE (200 μl). Cells that had adhered to the wells were stained with 200 μl 0.3 % crystal violet (CV) at room temperature for 15 min. Excess CV was then removed and the wells were washed three times with water (400 μl). Fixed CV was solubilized in 200 μl 100 % ethanol, 15 min at room temperature. Biofilm formation was estimated by measuring the A595 of each well using a microtitre plate reader (Sunrise, Tecan) and calculating the mean from the eight wells. (2) Assays for adhesion were performed using cells grown at 20 °C in BYE liquid cultures, harvested at different growth phases (48, 120 and 192 h of growth for exponential, stationary and late stationary phase, respectively) and resuspended in BYE at OD600 2.0. Cell suspensions were then aliquoted (150 μl) into eight wells of a 96-well microtitre plate, which was incubated at 20 °C for 6 h. Adhesion was estimated by CV staining of adherent cells, as described above. (3) Assays for biofilm growth were done in a similar way using cells grown in BYE at 20 °C until late stationary phase. After 6 h incubation at 20 °C, medium and non-adherent cells were removed and 150 μl BYE were added to the wells. Incubation was continued for 7–14 days. Where indicated, medium and non-adherent cells were removed and replaced by sterile BYE on day 7. After incubation, biofilm formation was quantified by CV staining, as described above.

    Biofilm conditions for transcriptome analyses.

    L. pneumophila Lens biofilms were grown at 20 °C in 75 cm2 cell culture treated flasks (BD-Falcon). BYE (30 ml) was inoculated at an initial OD600 of 0.15 with cells from a preculture grown in BYE at 20 °C. The flask was incubated at 20 °C until growth reached late stationary phase. The cell suspension was then removed from the flask and planktonic cells (termed inoculation cells) were recovered by centrifugation (2 min, 3000 g, 4 °C) and immediately stored at −80 °C. Cells that had adhered to the bottom of the flask were covered with 100 ml fresh BYE and the flask was incubated at 20 °C. To avoid cell sedimentation onto the adhered cells, the flask was placed vertically. After 7 days, the culture medium was replaced by sterile BYE and incubation was continued for 7 days. The culture medium containing planktonic cells was then removed and cells (termed suspension cells) were recovered by centrifugation (2 min, 3000 g, 4 °C) and immediately stored at −80 °C. The flask was rinsed twice with BYE, and 1 ml cold BYE was added to the flask. Cells that had adhered to the walls of the flask were detached using a sterile cell scraper and resuspended in cold BYE. The resulting cell suspension was removed and biofilm cells (termed sessile cells) were recovered by centrifugation (2 min, 3000 g, 4 °C) and immediately stored at −80 °C.

    Microscopic analyses of L. pneumophila biofilm.

    Two distinct procedures were used for microscopic analyses of L. pneumophila biofilms. For electron microscopy, biofilms grown in cell culture flasks were fixed with 2 % glutaraldehyde in phosphate buffer (0.1 M, pH 7.2) for 1 h. Fixed biofilms were scraped from the culture flasks and transferred onto polylysine-coated glass slides. Subsequent dehydration was performed stepwise using 50, 70, 90 and 100 % acetone in water, 50 % ethanol : 50 % acetone, 100 % ethanol, 50 % ethanol : 50 % trichlorotrifluoroethane and finally 100 % trichlorotrifluoroethane. The samples were coated with gold and examined using a SEM JEOL JSM 840 electron microscope. Analysis of biofilm formation at various iron concentrations was performed using phase-contrast microscopy. L. pneumophila Lens was diluted in BYE medium containing 0, 0.25 or 1.25 g l−1 iron pyrophosphate to approximately 106 c.f.u. ml−1. Then 6 ml of this dilution was used to fill a six-well microtitre plate (Nunclon Delta Surface), to which microscope glass cover slides (18 mm × 18 mm) had been previously added. Biofilms were allowed to form for 2 weeks at 20 °C. The medium was changed after 1 week. At the end of the incubation, medium and non-adherent cells were removed and cells that had adhered to the glass slides were stained with 0.3 % CV at room temperature for 15 min. Glass slides with biofilms on both sides were rinsed with water and cleaned on the bottom side with an alcohol swab. The biofilm attached to the top side was examined by phase-contrast microscopy.

    Total RNA isolation, cDNA synthesis and labelling.

    The FastProtein Blue kit was used with a Fast Prep apparatus (Q-biogene) in order to lyse cells. Total RNA was extracted as described by Milohanic et al. (2003). RNA was quantified by A260 and A280 and its integrity was confirmed on 1 % agarose gels. The total preparation was divided into 10 μg aliquots that were stored at −80 °C until use. Absence of genomic DNA contamination was assayed by PCR amplification using two primers complementary to the mip gene (mipF, AGCATTGGTGCCGATTTG; and mipR, TCTGTCCATCCAGGGATAAC). Total RNA (10 μg) was used for cDNA synthesis with the Atlas Powerscript Fluorescent labelling kit (BD-Bioscience) and pd(N)6 primers (Roche), according to the manufacturer's recommendations. Two distinct cDNA syntheses were made for each cell sample and obtained cDNA were pooled. One half was then labelled with Cy3 and the other with Cy5.

    Array hybridization and data analysis.

    Hybridizations were performed using 250 pmol Cy3- and Cy5-labelled cDNA following the manufacturer's recommendations (Corning) and using slides described by Brüggemann et al. (2006). The cDNA of each cell sample was compared to that of the two others using two distinct hybridizations on slides, including a dye-swap. In addition, a biological replicate was carried out giving a total of 12 slides for the overall experiment. Slides were scanned on a GenePix 4000A scanner (Axon Instruments). Laser power and/or photomultiplier tubes (PMT) were adjusted to balance the two channels. The resulting files were analysed using Genepix Pro 4.0 software. Spots were excluded from analysis in cases of high local background fluorescence, slide abnormalities, or weak intensity. Data normalization and differential analysis were conducted using the R software (Brüggemann et al., 2006; ). A Loess normalization (Yang et al., 2002) was performed on a slide-by-slide basis (BioConductor package marray; ). Differential analysis was carried out separately for each comparison between two cell samples, using the VM method [VarMixt package (Delmar et al., 2005)], together with the Benjamini and Yekutieli (Reiner et al., 2003) P-value adjustment method. Only genes with significant (P<0.05) fold changes in expression were taken into consideration. Empty and flagged spots were excluded, and only genes with no missing values were analysed.

    Quantitative RT-PCR.

    cDNA templates were obtained from 10 μg total RNA using pd(N)6 primer (Roche) and M-MLV, RNase H Minus, Point Mutant reverse transcriptase (Promega) according to the manufacturer's instructions. Quantitative RT-PCR was performed on a LightCycler (Roche) using the LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche) according to the manufacturer's instructions. The 16S rRNA gene was used as a reference gene to normalize gene expression, using primers 16SF (ACCTGGCCTAATACTGAC) and 16SR (TACGGGACTTAACCCAAC). The level of gene expression was assessed by determining the cycle at which the amplification curve crossed the detection threshold. This is defined as the crossing point (Cp). The relative changes in gene expression were calculated as commonly described (Livak & Schmittgen, 2001) by calculating the 2−ΔΔCp, where ΔCp=Cp target gene−Cp reference gene (16S) and ΔΔCp=ΔCp sample 1−ΔCp sample 2.

    Mutant construction.

    Electro-competent cells of L. pneumophila Lens were prepared as follows. A bacterial suspension (100 μl, OD600 2) was plated on BCYE and incubated for 24 h at 37 °C. The cells were harvested from the plate surface and suspended in 40 ml 10 % (v/v) glycerol at 4 °C. Bacteria were centrifuged (4000 g, 10 min) and washed twice in 20 ml and 10 ml 10 % glycerol. Finally, cells were resuspended in 10 % glycerol at OD600 100, divided into 50 μl aliquots and frozen at −80 °C. Competent cells were electroporated with the pJS5 plasmid (Allard et al., 2006), which contains a fragment carrying the pvcA gene inactivated by the insertion of a kanamycin-resistance gene. The transformants were plated on BCYE with kanamycin and tested by PCR using the PVCA9 F and PVCB6-R primers described previously (Allard et al., 2006). The resulting mutant strain was used to test its ability to form biofilm as described above.

    RESULTS

    Physiological studies of biofilm formation

    The ability of L. pneumophila strain Lens to form a monospecies biofilm was investigated at different growth temperatures in order to determine the most favourable conditions for biofilm establishment. Microtitre plates were inoculated with L. pneumophila Lens and incubated at 20, 37 or 42 °C. Culture growth was monitored as OD595 and the number of sessile cells within the obtained biofilms was estimated by measurement of A595 after CV staining, 12–16 h after entry into stationary phase (Fig. 1a). It clearly appeared that biofilm formation by the Lens strain was favoured at 20 °C since A595 was at least sixfold higher at this temperature as compared to 37 and 42 °C. This result was not due to growth differences between L. pneumophila at the various temperatures as the A595 divided by the final OD595 of each culture gave similar results (data not shown). We also observed that biofilms formed at 20 °C were more stably attached than those formed at 37 and 42 °C, which became detached during the washing steps prior to CV staining. Accordingly, biofilm formation experiments with the L. pneumophila Lens strain were conducted at 20 °C.

    Figure image not available in archive
    Fig. 1.

    Biofilm formation by L. pneumophila Lens. (a) Effect of temperature on biofilm formation. Cell suspension (initial OD600 0.15) was aliquoted into eight wells of a microtitre plate, which was incubated until late stationary phase. Biofilm formation was then estimated by CV staining assessed by A595. (b) Influence of growth phase on adhesion. Cell suspensions containing equivalent numbers (OD600 2) of cells, harvested at the indicated growth phase, were aliquoted into 96-well microtitre plates and incubated at 20 °C for 6 h prior to CV staining. (c) Effect of incubation time on biofilm formation. Adhered cells from the initial adhesion step were further incubated in fresh BYE for 7 and 14 days. Biofilm formation was then estimated by CV staining. All the A595 values presented are mean±sd of eight wells from two distinct experiments. (d) Scanning electron micrograph of a L. pneumophila Lens biofilm. A biofilm formed after 14 days in culture flasks was fixed and detached before staining for electron microscopy.

    In order to optimize biofilm formation, we tested the influence of growth phase on adhesion of L. pneumophila Lens. Bacteria were grown at 20 °C, and equivalent numbers of cells from exponential, stationary and late stationary phase were used to inoculate 96-well microtitre plates. After 6 h of incubation at 20 °C, the number of adhered cells was estimated by CV staining (Fig. 1b). The resulting A595 values for cells from exponential, stationary and late stationary phase were 0.16, 0.37 and 0.59, respectively. This clearly showed that the adhesion ability increases during growth and that, consequently, cells in late stationary phase exhibit the highest capacity for adhesion. Furthermore, wells inoculated with late stationary phase cells were washed after the initial 6 h adhesion step and filled with fresh BYE medium. Growth of the adhered cell community was then followed for 14 days at 20 °C, with or without growth medium replacement on day 7. As estimated by CV staining, the number of adhered cells increased during the first 7  days and medium replacement allowed a further increase of cell density until 14 days (Fig. 1c). Whereas microtitre plate assays are useful for biofilm formation studies, they are not suitable for recovery of large amounts of sessile cells for transcriptome analyses. We therefore decided to use 75 cm2 cell culture flasks, which offer a larger surface for biofilm development. Based on the above results, biofilm formation was initiated using L. pneumophila Lens cells grown until late stationary phase, which were then incubated at 20 °C for 14 days, with medium replacement on day 7. These growth conditions allowed the development of a consistent biofilm where bacteria are embedded in an extracellular matrix (Fig. 1d), as described for other monospecies biofilms. Cells harvested from the walls of the flasks were defined as ‘sessile cells’. The two planktonic cell samples used as references were the non-adherent cells from the initial adhesion step, termed ‘inoculation cells’ and the planktonic cells present in the flask at the end of the 14 day incubation period, were termed ‘suspension cells’ (see Methods).

    Transcriptome analyses

    Total RNA of the three different cell samples, namely ‘sessile cells’, ‘suspension cells’ and ‘inoculation cells’ was used for cDNA synthesis, labelling and subsequent hybridization to a DNA oligonucleotide array containing 3823 gene-specific oligonucleotides (Brüggemann et al., 2006). These probes were designed to match every predicted ORF in the three sequenced L. pneumophila genomes, of strains Lens, Paris and Philadelphia (Cazalet et al. 2004, Chien et al., 2004). Gene expression changes in the three different cell samples were recorded in a two-way comparison, i.e. sessile cells vs inoculation cells, sessile cells vs suspension cells and suspension cells vs inoculation cells. The full results are accessible on the website (choose ‘Public area’, then ‘Legionella’). Taking a twofold difference in gene expression between sessile and inoculation cells as a threshold, over 15.5 % of the L. pneumophila genes (457 out of 2932 predicted) were altered in their expression (see Supplementary Table S1, available with the online version of this paper). In addition, 11.2 % of the L. pneumophila genes (329 out of 2932 predicted) showed at least a twofold change in expression in comparisons of sessile and suspension cells (Table S1). Together, these results clearly indicate major changes between the sessile and planktonic forms. However, it is highly unlikely that all these changes are associated with the sessile mode of life per se. In order to focus our analysis on biofilm-specific genes, we selected genes with at least a twofold altered expression in biofilm cells relative to both planktonic cell populations. This revealed a total of 69 genes (2.3 % of the genome), among which 52 were upregulated and 17 downregulated (Table 1). Searching for gene clusters or genes involved in the same biological pathway highlighted several genes. Five gene clusters with induced expression were identified within this group: lpl0236–0237, whose predicted products are similar to pyoverdine synthesis proteins; lpl0628–0629, which includes a gene encoding a putative aminochorismate lyase; lpl2213–2214, which encodes phosphatase and pseudouridine synthase; lpl2271–2272, which encodes alkyl hydroperoxide reductases; and lpl2916–2917, which probably encodes ATP synthase subunits. Moreover, virulence-related genes such as lpl0820, encoding the global regulator CsrA and lpl0497, encoding IcmJ/DotN, which is part of the type IV secretion system of L. pneumophila, are also induced in sessile cells. Two other induced genes (lpl2576 and lpl2686) encode ribosomal proteins. Finally a gene cluster showing reduced expression in sessile cells was identified: lpl1059–1060 that encodes proteins similar to EnhC involved in the entry into host cells and a major facilitator protein. To learn about the global physiological state of sessile cells, genes previously identified as good markers for the transmissive and replicative phases of the L. pneumophila life cycle during growth in Acanthamoeba castellanii (Bruggemann et al., 2006) (Table 2) were examined for their expression fold change in the sessile cells as compared to the inoculation cells. Actually, inoculation cells constitute a bacterial population in the late stationary phase of growth, whose gene expression profile resembles that of transmissive L. pneumophila cells (Bruggemann et al., 2006). Interestingly, sessile cells appeared more related to bacteria in the replicative phase since flagellar genes (flaA, fliA and fliS), genes of the type IV secretion system substrates and their homologues (ralF, sdeA, sdcA and sidC) and enhA, encoding the enhanced entry protein A, were downregulated in the sessile cells. Accordingly, the key regulator csrA, known to repress the expression of transmissive traits, was clearly induced (4.29-fold) in sessile cells as compared to inoculation cells. However, when the more heterogeneous planktonic population constituted by suspension cells was used as reference, the flagellar genes, sdeA and sdcA, as well as csrA, appeared to be upregulated in sessile cells (Table 2).

    Table 1.

    Genes whose mRNA level was significantly changed at least twofold in sessile cells with respect to both inoculation and suspension cells

    Table 2.

    Expression profiles of marker genes of the L. pneumophila biphasic life cycle in sessile cells

    In order to identify the main pathways involved in the L. pneumophila sessile mode of life, we further focused our study on genes with the highest alteration in expression in sessile cells with respect to both planktonic cell samples. Thus, regulated genes showing a significant threefold or higher expression change between biofilm cells and the two planktonic cell samples were selected (i.e. lpl0660, lpl1853, lpl0236, lpl0237, lpl0482, lpl1129, lpl2032, lpl2271, lpl2272, lpl2462, lpl2719, lpl2728, lpl2780 and lpl2916). To confirm their differential regulation, the expression of these 14 genes was measured by qRT-PCR. Genes with at least a threefold change in expression, as revealed by both microarray and qRT-PCR, were further analysed (Table 3). This high-stringency selection was performed to reveal genes whose altered expression is truly specific for the sessile mode of life.

    Table 3.

    Genes whose mRNA level was changed at least threefold in sessile cells with respect to both inoculation and suspension cells

    Analysis of biofilm-regulated genes

    Among the genes with the most significantly altered expression in sessile cells, seven genes were shown to be 3–80-fold induced in biofilm cells by quantitative RT-PCR (Table 3) and so can be referred to as biofilm-regulated genes. The deduced protein sequences of three of these genes (lpl0482, lpl2462 and lpl2780) show no similarity with proteins present in public databases and thus do not allow assignment of a putative function. The remaining four genes with induced expression in the biofilm comprise two distinct clusters. lpl2271 and lpl2272, the most highly induced genes in sessile cells, encode AhpD and AhpC2. These alkyl hydroperoxide reductases have been shown to protect L. pneumophila from peroxide challenge (Le Blanc et al., 2006). The second cluster whose gene expression was induced in the sessile cells consists of two genes, lpl0236 and lpl0237. Lpl0236 contains the conserved domain of pyoverdine/dityrosine biosynthesis protein (pfam05141) and is 61 % homologous with PvcA from Pseudomonas aeruginosa. Lpl0237 is 66 % homologous with PvcB from P. aeruginosa and contains the conserved domain of the TauD, TfdA oxygenase family (pfam02668). In the P. aeruginosa genome, pvcA and pvcB are the first two genes of an operon of four genes (pvcABCD), encoding proteins required for the synthesis of the siderophore pyoverdine (Stintzi et al., 1996, 1999). In L. pneumophila, the genes downstream of lpl0237 show no similarity to pvcC and pvcD. Since it has been shown for P. aeruginosa (Musk et al., 2005; Banin et al., 2005) and for Staphylococcus aureus (Johnson et al., 2005) that biofilm formation is linked to iron availability, we investigated a probable influence of iron on biofilm formation of L. pneumophila as well as the influence of iron on the expression of the putative siderophore-encoding genes (lpl0236 and lpl0237) and the remaining five highly regulated genes within the biofilm.

    Effect of iron availability on biofilm-regulated gene expression

    In order to determine whether iron availability constitutes a signal regulating gene expression in sessile cells, expression of the seven genes, here identified as biofilm-regulated, was measured by quantitative RT-PCR after growth in BYE broth supplemented with different iron concentrations. The pvc genes were positively regulated by iron since their expression under iron-rich conditions was 6–10-fold induced, compared to conditions without iron (Fig. 2a). However, expression of other biofilm-regulated genes did not appear to be significantly altered by iron availability. These results underline a likely involvement of pvc gene products in iron homeostasis but suggest that iron does not constitute the only signal triggering biofilm-regulated gene induction in sessile cells. Accordingly, iron-regulated genes in L. pneumophila such as fur, frgA, iraAB or lbtAB (Cianciotto, 2007) did not appear significantly regulated in our microarray data, except feoA (see Supplementary Table S2, available with the online version of this paper). The latter is involved in a ferrous-uptake system (Robey & Cianciotto, 2002), whose expression was 1.99-fold induced (P=0.003) in sessile cells as compared to suspension cells.

    Figure image not available in archive
    Fig. 2.

    Effect of iron pyrophosphate on expression of biofilm-regulated genes and biofilm formation by L. pneumophila Lens. (a) Bacteria were grown at 20 °C in BYE containing 0, 0.25 or 1.25 g iron pyrophosphate l−1 until stationary phase. Expression of biofilm-regulated genes is presented as expression fold change at 0.25 or 1.25 g l−1 as compared to expression at 0 g l−1 iron pyrophosphate. Values are means±sd from two experiments. (b) Influence of iron concentration on biofilm formation of L. pneumophila Lens wild-type and ΔpvcA mutant. Bars, 10 μm.

    Iron availability influences biofilm formation

    To further examine a possible link between the induction of pvcA in sessile cells, iron availability and biofilm formation, the pvcA-like gene of L. pneumophila Lens was inactivated by insertion of a kanamycin cassette, as described previously (Allard et al., 2006). Biofilm formation by the ΔpvcA mutant and the wild-type strain was then compared in BYE supplemented with various iron concentrations. As estimated by our standard microtitre plate assay, high iron pyrophosphate concentration (1.25 vs 0.25 g l−1) was detrimental to biofilm formation by wild-type L. pneumophila Lens, with a 6.5-fold reduction in CV binding (data not shown). This result was confirmed by microscopic analysis of biofilms formed on glass slides at various iron concentrations (Fig. 2b) since wild-type L. pneumophila Lens established a consistent biofilm with 0 or 0.25 g iron pyrophosphate l−1 whereas only a few adhered cells could be observed at higher iron concentrations. Also, biofilms formed by the L. pneumophila Lens ΔpvcA mutant did not appear significantly different from those of the wild-type strain whatever the conditions tested. The product of pvcA alone thus did not appear necessary for biofilm establishment by L. pneumophila Lens in standard BYE containing 0.25 g iron pyrophosphate l−1. In addition, disruption of pvcA did not modify biofilm formation under iron-rich conditions, suggesting that the deleterious effect of iron on biofilm formation is neither mediated nor counterbalanced by pvcA induction in sessile cells.

    DISCUSSION

    We report here the development of a monospecies model biofilm for L. pneumophila, a bacterium known to form biofilms in nature, which affects its distribution and spread. Although these models do not reflect the complexity found in natural environmental biofilms, monospecies biofilms were the first step towards understanding adaptation to the sessile lifestyle for many bacteria, including two recent studies on L. pneumophila (Mampel et al., 2006; Piao et al., 2006). These models pave the way for the study of complicated microbial interactions and have proven to be useful for assessing the gene expression profile of sessile cells even if the different cell types present within a biofilm cannot be analysed independently by this approach (Schembri et al., 2003; Beloin et al., 2004; Waite et al., 2005; Whiteley et al., 2001).

    Our study has revealed that biofilm formed by L. pneumophila is more consistent at 20 °C than at 37 or 42 °C. Piao et al. (2006) also reported that the L. pneumophila biofilms with structural features typical of biofilms (i.e. pillar- and mushroom-like structures) formed at 25 °C remained more stably attached than filamentous, mycelial-mat-like biofilms formed at 37 and 42 °C. Also, Mampel et al. (2006) reported that biofilm formation at 37 °C was 30 % lower than at 23 and 30 °C. Furthermore, we have shown that adhesion is highest for late stationary phase cells. This is expected, as L. pneumophila shows increased expression of the flagellum and of type IV pili, both of which have been described in other bacteria to be involved in adhesion (O'Toole & Kolter, 1998; Pratt & Kolter, 1998; Watnick & Kolter, 1999), in stationary phase during low-temperature growth (Heuner et al., 1999; Soderberg et al., 2004). Because stationary phase mimics the transmissive phase in which bacteria are released from amoebae (Molofsky & Swanson, 2004), our observations suggest that bacteria that exit host cells in natural low-temperature environments are in an optimal physiological state to adhere to biofilms.

    We report here the first transcriptome analysis of L. pneumophila biofilm cells. It reveals that expression of 2.3 % (69 genes) out of the 2932 predicted genes was changed at least twofold in biofilm cells with respect to two distinct planktonic cell populations. This is consistent with two previous reports on Escherichia coli biofilms that stated that genes whose expression is regulated in the same way when biofilm cells are compared to both exponential and stationary phase cells represent about 1 % of the predicted E. coli genes (Schembri et al., 2003; Beloin et al., 2004). The global physiological state of sessile L. pneumophila cells was judged by comparing the gene expression pattern with those determined for transmissive- and replicative-phase L. pneumophila during growth in A. castellanii (Bruggemann et al., 2006). Interestingly, the gene encoding the global regulator, CsrA, involved in repression of transmission and survival traits (Molofsky & Swanson, 2003), was induced in sessile cells. In our study, sessile cells thus seem to more closely resemble replicative- than transmissive-phase bacteria, suggesting that biofilm constitutes a favourable environment for L. pneumophila. Surprisingly, the flagellar genes whose expression is induced in the transmissive phase in A. castellanii were induced in the sessile cells as compared to the suspension cells. Since CsrA is known to downregulate flagellar gene expression in L. pneumophila (Fettes et al., 2001), this observation suggests that the regulatory networks are modified in the biofilm as compared to planktonic life. Such modification may allow expression of L. pneumophila traits required for the biofilm lifestyle such as the flagella although CsrA is induced. This observation is in line with a recent report that expression of flagella is maintained throughout all stages of E. coli biofilm development (Domka et al., 2007). Searching for genes predicted to encode proteins involved in extracellular matrix generation revealed lpl2186 encoding a putative poly-β-hydroxyalkanoate (PHA) synthase that is repressed in L. pneumophila sessile cells with respect to the planktonic populations. Interestingly, Pham et al. (2004) have suggested that PHA accumulation in P. aeruginosa is in competition with alginate biosynthesis and that the PHA-negative mutant formed a stable biofilm with large, distinct and differentiated microcolonies characteristic of alginate-overproducing strains of P. aeruginosa.

    A stringent analysis of the biofilm-regulated genes highlighted seven genes whose expression was at least threefold altered in sessile cells with respect to both planktonic cell populations. Among these genes were the clusters pvcAB and ahpC2D. The first encodes proteins homologous to PvcA and PvcB that are required for production of the siderophore pyoverdine in P. aeruginosa. However, there are differences between L. pneumophila and P. aeruginosa regarding the pvc genes. First, we demonstrated that their expression in L. pneumophila increases in response to high iron concentrations in broth culture, while they are repressed under these conditions in P. aeruginosa. Second, the pvc locus of P. aeruginosa contains four genes, pvcABCD, whereas only pvcA and pvcB are present in the L. pneumophila genome (Stintzi et al., 1999). Third, pvc-like genes of L. pneumophila might not be involved in siderophore activity, since pvc mutants showed no difference as compared to the wild-type strain in chrome azurol S assays (Allard et al., 2006). It is thus likely that the function of the pvcA and pvcB products in L. pneumophila is different from that in P. aeruginosa. The second gene cluster, including ahpC2 and ahpD, whose products are alkyl hydroperoxide reductases, displayed the highest induction in biofilm cells. These proteins are known to play a role in protection against oxidative stress (Rocha & Smith, 1999; Le Blanc et al., 2006).

    Interestingly, iron is known to participate in the production of reactive oxygen intermediates (Andrews et al., 2003). In its soluble, reduced state (Fe2+) iron is toxic; its oxidation by oxygen to Fe3+ induces production of hazardous intermediate reactive species. Oxidative stress and iron metabolism are often related. In Neisseria meningitidis, an iron-induced operon is required for protection against hydrogen peroxide-mediated killing (Grifantini et al., 2004) and in Campylobacter jejuni, induced expression of ahpC under iron limitation is believed to counterbalance the intracellular accumulation of iron due to active acquisition systems induced under these conditions (Baillon et al., 1999). Induction of both pvcAB and ahpC2D genes in sessile cells could thus be related and reflect the need for protection against oxidative stress resulting from high iron concentrations. A possible explanation is that the pvc genes, encoding proteins putatively involved in synthesis of siderophore-like molecules, may contribute to iron sequestration and/or uptake in order to maintain iron concentration below a toxic level. Interestingly, proteomic studies on a P. aeruginosa biofilm revealed the induction of AhpC, together with l-ornithine 5-monooxygenase, whose gene is located within the pvd locus involved in pyoverdine synthesis (Visca et al., 1994; Sauer et al., 2002). In contrast, transcriptome analyses of P. aeruginosa biofilms (Whiteley et al., 2001; Waite et al., 2005) revealed no induction of the pyoverdine genes, except when the gene expression profile of biofilm cells was compared to that of cells released from the biofilm (Sauer et al., 2004). However, only pvcAB appeared to be iron-regulated during the planktonic lifestyle, suggesting that iron does not constitute the only signal inducing expression of the biofilm-regulated genes. Accordingly, the expression of other iron-regulated genes, as described by Cianciotto (2007), was not significantly altered in sessile cells. In addition, except the ahp genes, no other gene encoding proteins related to resistance to oxidative stress (Table S1) was induced in the sessile cells, suggesting that sessile cells undergo a moderate oxidative stress. Nevertheless, high iron concentrations (a fivefold increase in iron pyrophosphate concentration) appear detrimental to the sessile mode of life since our experiments revealed a strong inhibition of biofilm formation under these conditions. Interestingly, it has already been shown that iron salts perturb biofilm formation of P. aeruginosa (Musk et al., 2005). It has also been proposed that a critical level of intracellular iron serves as the signal for biofilm development (Singh, 2004; Banin et al., 2005). The L. pneumophila pvcA mutant showed no significant difference in biofilm formation whatever the tested iron concentration. The product of pvcA alone is thus not essential either for biofilm formation by L. pneumophila or for protection of sessile cells against high iron concentrations. Its induction in sessile cells might therefore be triggered by an unknown signal rather than by an iron-rich environment. Alternatively, pvcA inactivation may be compensated for by another L. pneumophila gene.

    In conclusion, these first results on in vitro biofilm formation of L. pneumophila and the characterization of its transcriptional profile provide the basis for a better understanding of the sessile mode of life of L. pneumophila. It will be challenging to explore the fine interactions between iron, oxidative stress and biofilm formation.

    Acknowledgments

    Financial support was received from the Institut Pasteur, the Centre National de la Recherche Scientifique (CNRS), the Consortium National de Recherche en Génomique (CNRG) du Réseau National des Genopoles (RNG), and the Centre National de Référence des Legionella (directed by J. Etienne), France. This work is supported by the Agence Française de Sécurité Sanitaire de l'Environnement et du Travail (AFSSET; ARCL-2005-002). T. H. was holder of a post-doctoral fellowship from the CNRS. H. B. is holder of a fellowship of the German Academy of Natural Scientists Leopoldina (funding number BMBF-LPD9901/8-101). The authors would like to acknowledge N. Cianciotto for kindly providing the pJS5 plasmid. We thank the ‘Service de pathologie ultrastructurale et expérimentale’, Centre Hospitalier Universitaire (CHU) Poitiers, for their technical help in electron microscopic analysis; Sandrine Moreira-Rousseau and Mathieu Barthelemy for setting up the MIAME database, and Marie-Agnès Dillies for initial help in data analysis.

    References