Abstract
Abbreviations: RFLP, restriction fragment length polymorphism; SNP, single-nucleotide polymorphism
Four supplementary figures are available with the online version of this paper.
An optical map is an assemblage of a number of partial restriction fragment maps into a single complete genome restriction map. To generate an optical map, whole chromosomes are spread and immobilized onto treated glass surfaces. The DNA is digested with a restriction enzyme, and across 20–100 long chromosome reads, automated contiguous restriction fragment size measurements are made. Each contig read is up to one-third of the whole chromosome. These overlapping partial chromosome contigs are assembled by alignment software similar to that used to align nucleotide sequences, using contiguous fragment sizes instead of contiguous bases. The BamHI optical map of a typical E. coli O157 : H7 isolate contains 500–600 fragments ranging from 1 to 50 kb spanning the 5 Mbp genome. The contiguous fragments of one optical map can be aligned and compared to the BamHI in silico chromosome map of a sequenced reference strain, or to the optical maps of different strains. Changes as small as 2 kb can be mapped (Lim et al., 2001; Chen et al., 2006; Kotewicz et al., 2007).
In the two similar sequenced E. coli O157 : H7 genomes, many differences were found in unique segments not found in the E. coli K-12 genome that have been called O-islands (EDL933, Perna et al., 2001) or S-islands (Sakai strain, Hayashi et al., 2001). Studies have shown that the diversity among individual E. coli O157 : H7 strains is due, in large part, to variation within prophages (Kudva et al., 2002a, b; Brüssow et al., 2004). Variations among dozens of prophage integrations and excisions, as well as prophage deletions and substitutions, have changed restriction sites and PFGE and PCR profiles for otherwise similar E. coli O157 : H7 isolates. Notably, large, and often double, chromosomal inversions are prevalent in E. coli O157 : H7 isolates (Iguchi et al., 2006; Shima et al., 2006; Kotewicz et al., 2007) and the inversions have occurred within resident prophages.
In the United States, E. coli O157 : H7 causes approximately 75 000 cases of infection annually (Griffin & Tauxe, 1991). In previous outbreaks of E. coli O157 : H7, an estimated 15–20 % of people infected presented with indications severe enough to require hospitalization, and typically about 2–7 % of cases progress from haemorrhagic colitis to haemolytic-uraemic syndrome (HUS) with kidney failure complications (Su & Brandt, 1995). The 2006 outbreak of E. coli O157 : H7 in the United States associated with the consumption of fresh spinach occurred across a large multi-state area. The outbreak presented a particularly virulent pathology in which 51 % of the patients were hospitalized and 16 % developed HUS (CDC, 2006).
What characteristics defined the E. coli O157 : H7 strain responsible for the 2006 spinach-associated outbreak in the United States? Here, a set of chromosomal markers including stx prophages was used to characterize this highly pathogenic outbreak strain; these markers have medical, epidemiological and forensic implications. The optical maps of five representative food-borne, clinical and bovine isolates from the 2006 spinach-associated outbreak delineated 14 distinct chromosomal markers. Partial genomic 454 DNA sequencing was used to identify each of these chromosomal changes and to define the outbreak strain in molecular detail.
Bacterial strains.Sources of the E. coli O157 : H7 strains used in this study are listed in Table 1. Two completely sequenced strains, EDL933 (GenBank AE005174), isolated from ground hamburger associated with a 1982 outbreak in the United States, and Sakai RIMD 0509952 (GenBank BA00007), a clinical sample isolated during a 1996 outbreak in Japan, were used as reference strains (Table 2). Two hundred and eight bovine, food-borne and clinical E. coli O157 : H7 isolates linked to the 2006 spinach outbreak were examined. Most of the isolates were clinical, obtained from 24 of the 26 states affected by the outbreak; these included isolates provided by State Health Laboratories from 178 of 206 patients most probably sickened from consumption of fresh spinach. In addition, 19 food-borne isolates derived from spinach samples implicated in the outbreak were examined. Eleven bovine isolates, obtained from cattle in the Salinas valley, in an area of spinach production implicated in the outbreak, were generously provided by the California Department of Health (USA). The bovine isolates had PFGE patterns similar to food-borne and clinical outbreak isolates associated with the outbreak (Cooley et al., 2007). Isolates were encoded and designated EC4000 to EC4208 to ensure patient confidentiality and compliance with Institutional Review Board (IRB) guidelines. Selection of E. coli O157 : H7 strains for optical mapping was based on preliminary characterization of the 208 isolates by DNA microarray chip analysis, using the Affymetrix E. coli Genome version 2.0 expression array.
Table 1. Spinach outbreak E. coli O157 : H7 isolates investigated
Table 2. Reference E. coli O157 : H7 strains
Microarray selection of strains for optical mapping.
The Affymetrix E. coli Genome 2.0 array, which consisted of over 10 000 probe sets for genic and intergenic sequences of four sequenced strains of E. coli, was used to determine gene profiles for all the isolates. As the isolate-to-isolate variation in gene content was very low, a clinical and a spinach (food-borne) isolate from the same state were selected as representative isolates for optical mapping. In addition, a single isolate representative of the bovine set and two clinical isolates that displayed array variations were optically mapped. One array variant showed pattern differences in the rRNA gene signals, while another clinical isolate showed the absence of nearly 20 genes, part of the EDL933 cryptic prophage T.
Optical mapping.
Optical maps were prepared by OpGen, Madison WI, USA. In brief, following gentle lysis and dilution, high-molecular-mass genomic DNA molecules were spread and immobilized onto derivatized glass slides and digested with BamHI. The DNA digests were stained with YOYO-1 fluorescent dye, and photographed using a fluorescent microscope interfaced with a digital camera. Automated image-analysis software located and sized fragments, and assembled multiple scans into whole-chromosome optical maps. More detail is presented in Zhou et al. (2004).
454 DNA sequencing.
Partial genomic sequences of the five representative optically mapped isolates were obtained in collaboration with the National Bioforensics Analysis Center (NBFAC). Assembly of sequencing reads into contigs and subsequent ordering of these contigs into scaffolds was performed with GS De novo Assembler Software. For partial genome sequencing, five 454 runs were typical, and yielded, on average, five million bases in 277 to 450 contigs.
Other genomic DNA sequences.
In addition to the 454 sequencing, in collaboration with TIGR, the nearly complete genomic sequence for spinach isolate EC4045 was used to analyse the structure of the stx-containing prophages. This sequence work was supported in part with Federal funds from the National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health, Department of Health and Human Services, under NIAID Contract N01-AI-30071. Whole-genome shotgun partial genome sequences for a number of outbreak isolates are available at .
An examination of the optical maps of a dozen representative E. coli O157 : H7 strains shows chromosomal variation at 31 sites (Table 3, A–AE). Fourteen sites in the spinach-associated outbreak strain were different from the sequenced reference strains, EDL933 and Sakai (Table 4), though individual spinach chromosome site markers were found in other strains (Table 3). They were annotated based on their consecutive positions on the chromosome (Fig. 1). The largest chromosomal changes, markers 3–12, are shown in Fig. 2. The figure also illustrates a 429 kb inversion that occurred in the chromosome of EDL933 within cryptic prophages CP933-O and CP933-P relative to the spinach and Sakai chromosomes. This inversion is distinguished by a crossoverlike X of the alignment score lines in the maps (Fig. 2). Changes seen in the chromosomes of outbreak strains were the same whether their optical maps were aligned either to sequence-based in silico or to de novo optical maps of EDL933 and Sakai. The small drop-out fragments from 21 bp to 1.5 kb lost in optical maps lower the ability to detect differences only slightly (Kotewicz et al., 2007).
Table 3. Summary of variations at 31 chromosomal polymorphisms optically mapped in 12 E. coli O157 : H7 strains Numbers represent kb of DNA inserted at each site. ·, Polymorphism same as Sakai; e, EDL933 variant; s, Sakai variant; sp, spinach variant; cp, cryptic prophage; ins, insertion; r, replacement of several fragments with different sized fragments; IS, insertion sequence; RFLP, restriction fragment length polymorphism; inv, chromosomal inversions – the origins within phages are indicated, L left and R right (the boxed cells indicate the extent of the inversions); ( ), most probable determination; indel, insertion or deletion.
Table 4. Summary of 14 variant chromosomal sites in the 2006 spinach-associated E. coli O157 : H7 outbreak relative to EDL933 and Sakai reference strains
|
|
The 14 outbreak-associated chromosomal markers were further characterized by 454 partial genomic sequencing of the five optically mapped isolates and six additional outbreak isolates. Twelve of the chromosomal markers were in prophages. A summary overview of the larger chromosome changes found in the spinach-associated outbreak strain, markers 3–12, is shown in Fig. 2.
Phage and Shiga toxin gene profiles
Initial PCR and DNA microarray data showed that all the 208 clinical, spinach and bovine isolates were negative for the stx1 genes and were positive for the stx2 genes. However, 454 sequencing data indicated that two sets of stx2 genes were present in all the spinach-associated isolates, stx2 and a known variant, stx2c. The spinach-associated isolates were all stx1– stx2+ stx2c+.
EDL933 and Sakai are stx1+ stx2+ stx2c–. The stx1 genes are found within the cryptic prophage V at the yehV chromosomal locus. The optical maps of the stx1– spinach-associated outbreak isolates showed a variant insertion corresponding to the EDL933 stx1+ prophage V at yehV, which more closely resembles the stx1+ prophage found in Sakai at yehV. However, the optical map of the Sakai-like stx1– prophage found in the spinach isolates at the yehV locus cannot be distinguished from the stx1+ Sakai prophage. This is because the resolution of optical maps would not detect small (1–4 kb) DNA deletions or substitutions within larger (20–50 kb) fragments. In this case, the optical maps could not detect the difference in the status of the stx1 genes within this prophage locus (Fig. 3a).
|
In EDL933 and Sakai, the stx2 genes are found in a 62 kb non-cryptic prophage W at the wrbA locus. For the stx2+ stx2c+ spinach isolates, no corresponding prophage insertion at the wrbA site was found (Fig. 3b, wrbA locus). Note that for EDL933 and Sakai, the optical maps distinguish two different stx2+ phages. 454 DNA sequences from six outbreak-linked isolates confirmed that the wrbA chromosomal attachment site contained no remnant, or prophage scar sequences in the bacterial chromosome. Instead, the optical maps of the spinach isolates showed three large potential prophage insertions: 56 kb at 2.829 Mbp (at sbcB), 33 kb at 2.915 Mbp (at yegQ) and 58 kb at 3.276 Mbp near argW (Fig. 2, Table 4). The 454 sequence data were sufficient to partially characterize each of these insertions as a prophage.
The 56 kb prophage integration (Fig. 4, marker 10) was bracketed by a 13 bp duplication of the sequence TTTCACGATTACG, and the prophage was integrated at the sbcB chromosomal locus. The 454 sequences only allowed the determination of 1 kb of prophage at attL and 2 kb of prophage from attR. This sequence was sufficient to characterize the integrase proximal to the attR site as 98 % homologous to the integrase of an insertion found near sbcB in Shigella flexneri 2a and S. flexneri 5 strains.
|
The 33 kb insertion near yegQ is a prophage flanked by an 18 bp duplication of the sequence TACACGGGCTTATTTTTT. The spinach outbreak prophage resembled a prophage found at 2.281 Mbp in the chromosome of an avian pathogenic E. coli, APEC O1; the integrase of the outbreak phage was 99 % similar to the integrase of this APEC P2 type phage.
The 58 kb insertion near argW (Fig. 4, marker 12), represents an entirely new prophage in the outbreak isolates, next to a truncat intC prophage. Twenty-five base-pair attL and attR sequences, TGTCCTCTTAGTTAAATGGATATAA, bracket the new prophage. The integrase of the new prophage is 99 % (1168/1169 bp) homologous to the integrase of the stx2 converting phage 86 isolated from a pathogenic E. coli of the O86 serogroup (GenBank AB255436).
Overall, the map and 454 sequence data demonstrated that the outbreak strains carried variant lambdoid prophages at the yehV, sbcB and argW loci. Because of extensive homologies among the multiple lambdoid phages found in E. coli O157 : H7, optical mapping and partial 454 genome sequencing were not sufficient to allow the complete resolution of phage sequences, nor were they sufficient for the complete assembly of the bacterial genome sequence around these similar and uncompleted prophage sequences. There were also too many gaps in the contigs of the phages to resolve the Shiga toxin gene arrangements in the 454 sequences. In collaboration with TIGR, however, the partially completed genome sequence of isolate EC4045 demonstrated the absence of stx1 genes in the V prophage at yehV, the presence of stx2c genes in the sbcB prophage, and the stx2 genes in the argW prophage (see ). This configuration was very distinct from the sequenced EDL933 and Sakai strains, although components of the sbcB prophage described here have been observed in other E. coli O157 : H7 isolates (Ohnishi et al., 2002).
Other prophage chromosomal markers
Marker 2 was a simple restriction fragment length polymorphism (RFLP) at 0.310 Mbp (Table 4; see also Supplementary Fig. S1, available with the online version of this paper). The 454 sequencing revealed that this new BamHI site was a C→G transversion creating a new BamHI site in the spinach isolates within the cryptic H/I prophage complex (Table 4).
The optical maps indicated three chromosomal markers that appear to be the simple gain or loss of a complete prophage relative to the EDL933 or Sakai strains. The first two, markers 3 and 9, are a P4-like prophage and a prophage designated R in EDL933 (Table 4); both were missing in the spinach isolate (Fig. S2). The third, a Mu-like prophage, marker 13, is not found in the spinach isolate; it is found only in Sakai (Tables 3 and 4, Fig. S3).
Marker 14 was a phage sequence scar (Fig. S3). An 11 kb insertion found in the spinach isolate represented a small piece of a phage and contained sequences homologous to several phage tail genes. There were three additional chromosomal markers found in the optical maps, markers 5, 6, and 7, which were sequence scars within prophages C, X, and O (Fig. 5) in the spinach outbreak strain relative to EDL933. Both the optical maps and preliminary sequence analysis suggested that some of these prophage substitutions are complex.
|
Non-prophage chromosomal markers
The optical maps revealed two chromosomal markers in the outbreak isolates that were not associated with prophages. The first, marker 1, was a simple RFLP at 0.264 Mbp (Table 4, Fig. S1). 454 sequencing showed that this simple change was a complex rearrangement associated with insertion sequences. The second was a 15.1 kb deletion at 1.782 Mbp (Fig. 5, marker 7). 454 DNA sequencing showed that 15 147 bp found between the two 22 bp sequences ATTCTtgCcatctgaAcCGCCC and ATTCTacCgccgctgAgCGCCC in EDL933 are deleted in the outbreak isolates, leaving a hybrid of the duplicated 22 bp sequence, ATTCTtgCgccgctgAgCGCCC, at the deletion site. Bases that were the same in both 22 bp sequences on the EDL933 chromosome are capitalized. The 15 kb deletion included 13 EDL933 genes from Z1957, encoding an IS629 transposase, to Z1972, encoding a partial putative adhesion protein. The other genes within the deleted region included ones encoding five hypothetical proteins of unknown function, a putative outer-membrane receptor, a molybdenum transport protein, two putative iron compound ABC transporters, an ATP-binding protein and transporter permease, a trehalase, a putative PTS system enzyme I and a putative dihydroxyacetone kinase.
Variant clinical isolates; two single prophage changes
Because their microarray profiles differed from the typical outbreak profile, two spinach-associated clinical isolates were analysed in further detail by optical mapping and 454 sequencing. The microarray profile of isolate EC4076 indicated the probable deletion of a set of genes associated with cryptic prophage CP933-T, and the optical map showed the absence of two BamHI restriction fragments (total deletion of 20 kb) associated with the annotated prophage T in the in silico map of EDL933 (Fig. S4). In collaboration with TIGR, the whole-genome shotgun sequence data for this isolate revealed that the 121 bp tandem duplication (AAAAAAACCA CCCGAAGGTG GTTTCACGAC ACTGCTTATT GCTTTGATTT TATTCTTATC TTTCCCATGG TACCCGGAGC GGGACTTGAA CCCGCACAGC GCGAACGCCG AGGGATTTTA A) flanking prophage T in the reference EDL933 sequence has been reduced to a single 121 bp repeat in EC4076, completely eliminating the 21 118 bp prophage T sequence in this clinical isolate (see ). From microarray analysis of 208 outbreak-associated isolates only the clinical isolate EC4076 carried the prophage T deletion. EC4076 had all the other outbreak-specific chromosomal markers characterized here and did not have any other differences relative to the archetypal outbreak optical map.
Another clinical isolate, EC4115, showed elevated signals for several rRNA targets in its microarray profile. As was the case with EC4076, the optical map of EC4115 showed the same 14 chromosomal markers characteristic of the spinach outbreak strain. The optical map of EC4115 did not show any other chromosomal abnormalities as had been suggested by the microarray data at rRNA loci. However, the optical map of EC4115 did show one additional chromosomal change. A 41 kb insertion was found in EC4115 at the chromosomal locus yehV, at the site of the V-like prophage lacking stx1 in the outbreak isolates (Fig. S4). Analysis of the whole-genome shotgun sequence data at the NCBI/TIGR website confirmed that identical left and right att sites to those of the EDL933 prophage CP933 V were found in the outbreak isolate EC4115. A gap in the sequence contigs in the centre of the prophage prevented the characterization of the 41 kb insertion.
Fourteen distinctive chromosome markers were optically mapped in the 2006 spinach-associated US E. coli O157 : H7 outbreak strain relative to reference EDL933 and Sakai strains. Genomic variability of E. coli O157 : H7 strains is mainly due to differences within prophages and in chromosomal inversions (Kudva et al., 2002a, b; Brüssow et al., 2004; Iguchi et al., 2006; Kotewicz et al., 2007). Most of the chromosomal markers demonstrated by optical mapping would not have been detected by microarray and simple sequence-based techniques such as SNP analysis. Microarray determinations of the presence/absence of multicopy genes are not simple; the modular nature of these prophages, with similar genes in multiple different chromosomal sites, precludes a simple gene present/absent call. Table 3 shows highly variable sites in E. coli O157 : H7 strains, which show evidence of repeated integrations and deletions as well as sites of chromosomal inversions. Other prophage sites, more highly deleted and degenerate, represent smaller targets for recombination and appear to be more stable genetic markers.The stx phages represent some of the most important, and yet most variable chromosomal markers (Johansen et al., 2001; Herold et al., 2004; Bielaszewska et al., 2007a). Variation in highly similar toxin genes contributes to strain toxicity (Friedrich et al., 2002; Orth et al., 2007; Manning et al., 2008; Bielaszewska et al., 2007b). The virulence of a particular E. coli O157 : H7 strain might depend in part on the kind, placement, and/or rearrangement of specific phage sequences (Kohler et al., 2000; Eklund et al., 2002; Ritchie et al., 2003; Karch et al., 2006), all of which affect Shiga toxin gene expression, most notably the anti-terminator Q gene product (Zhang et al., 2005; Koitabashi et al., 2006).
However, as best illustrated by the stx prophages, neither optical mapping alone, nor optical mapping in conjunction with partial genomic 454 sequencing, was able to determine the exact location of the stx genes. As the limit of resolution of optical mapping restricts the determination of novel insertions to the size of an average gene, 1–2 kb, further Sanger sequencing and PCR determinations were required to unequivocally locate the stx genes within different prophages. The two lambdoid prophages in the outbreak strain EC4045 that contained the Shiga toxin genes, stx2c at sbcB and stx2 at argW, were both chimeric. Most notably, each was homologous to EDL933 prophages, but contained a non-homologous integrase gene. Recombinant phages carrying assorted integrase genes (integrase cassettes) and different (or null) stx cassettes produce different configurations of the toxin genes and the critical phage Q gene regulators, and can be found at different chromosomal insertions sites in different E. coli O157 : H7 strains (Serra-Moreno et al., 2007).
Instead of recombination assorting genes and modules among phages, the gain or loss of stx genes might occur on the chromosome, in prophages, as illustrated by the V-like prophage at yehV. In the spinach outbreak strain, phage genes have replaced the stx1 genes found in EDL933 (or vice versa). A pathway for replacement of phage and stx1 genes has been substantiated by phylogenetic studies (Shaikh & Tarr, 2003).
As opposed to the highly variable stx prophages, small prophages (the probable results of large deletions) appear to be stable markers. The spinach outbreak strain contained five prophage sequence scars, including markers 2, 5, 6 and 8, modified relative to the cryptic EDL933 prophages H/I, C, X and O, respectively, as well as marker 14 (Table 4). Marker 2 is a single base change in the H/I cryptic prophage which created a new BamHI site in the outbreak strain. The optical mapping of nine other E. coli O157 : H7 strains revealed a possible progenitor to this 23 kb H/I prophage scar, a 28 kb insertion in strains EC869 and EC536 (Table 3 and Kotewicz et al., 2007). Similarly, a 47 kb insertion found in strain EC1231 (5.173 Mbp, Table 3) could be the progenitor of the 11 kb sequence scar found in the spinach outbreak.
Outbreak marker 12, near yegQ, was a 33 kb prophage which resembled a P2 prophage found in the sequenced avian pathogenic E. coli APEC O1. This prophage has not been previously identified in sequences or optical maps of over a dozen E. coli O157 : H7 isolates. Sequence analysis of marker 12 strongly suggested that the scar found at yegQ in E. coli K-12 is the result of the degradation of a similar prophage. In E. coli K-12, this left a 629 bp scar with a flanking pair of 18 bp attachment sites (ACACGGGCTTATTTTTT). The analysis of sequence data from prophages and flanking regions has begun to clarify how some of these prophages have become potentially long-lived, stable sequence scars and how others are undergoing multiple insertions and deletions.
Between the highly variable prophages and the stable prophage scars was a set of markers with an intermediate level of variation. Some prophage scars may reflect the emergence of this pathogen from E. coli O55 : H7 progenitors (Feng et al., 2007). Other markers are useful for tracking changes in E. coli O157 : H7 between different outbreaks and potentially even within outbreaks. These markers can define specific temporal and geographical changes in the progression of an outbreak; they have important implications for forensic identification and source tracking in outbreak investigations. For example, a deletion has removed prophage T in EC4076, and a new insertion has occurred near prophage V in EC4115. Each of these changes defines a different strain, allowing the subsequent tracing of each variant. We hypothesize that these variants might have arisen during the infection process in the patients. Alternatively, though less likely, they could have been rare isolates co-contaminating the food matrix.
The combination of optical mapping and 454 sequencing accomplished a number of goals: it allowed a broad view of chromosomal variation in E. coli O157 : H7 (31 optically mapped sites among 20 representative strains); it allowed closure of sequencing contigs across multiple phage repeats (in collaboration with TIGR); and it mapped and detailed the distinctive chromosomal markers that were archetypal for the 2006 US spinach-associated outbreak strain. The increasing amount of information available on chromosome variations in E. coli O157 : H7 from a number of laboratories allows the design of simple PCR-based assays for complex chromosomal markers. These can be implemented in a number of high-throughput assay formats to determine the strain, gene sets, prophage and stx configurations that would fully profile strains and their virulence potential (Manning et al., 2008).
Chromosomal profiles have been used to identify outbreak strains of pathogens such as E. coli O157 : H7, as evidenced by the use of PFGE for deployment of CDC's PulseNet system since 1996. For more detailed analysis, DNA microarray profiles can be used to characterize outbreak strains by nearly complete genic content. With a resolution of 2 kb across each of the 500–600 contiguous restriction fragments of an enteric bacterial genome, optical mapping provides yet more insights into chromosomal changes and gene acquisitions that neither PFGE nor microarray analysis allows.
We acknowledge the National Bioforensics Analysis Center (NBFAC) of the Department of Homeland Security for supporting work on optical mapping and 454 partial genome sequencing of E. coli O157 : H7 strains reported here under the Interagency Agreement Grant no. 224-04-2806. We thank Jonathan Hnath, Kathleen Verratti and Alexander Domingo of NBFAC for 454 sequencing. We wish to particularly thank the California Department of Public Health for the bovine samples, as well as other spinach and clinical isolates, and the 24 State Health Laboratories that generously provided outbreak isolates. We thank FDA colleagues David Lacher, Amit Mukherjee and Scott Jackson for valuable discussions.Edited by: S. D. Bentley
References
Bielaszewska, M., Prager, R., Köck, R., Mellmann, A., Zhang, W., Tschäpe, H., Tarr, P. I. & Karch, H. (2007b). Shiga toxin gene loss and transfer in vitro and in vivo during enterohemorrhagic Escherichia coli O26 infection in humans. Appl Environ Microbiol 73, 3144–3150.
Brüssow, H., Canchaya, C. & Hardt, W.-D. (2004). Phages and the evolution of bacterial pathogens: from genomic rearrangements to lysogenic conversion. Microbiol Mol Biol Rev 68, 560–602.
CDC (2006). Ongoing multistate outbreak of Escherichia coli serotype O157 : H7 infections associated with consumption of fresh spinach – United States, September 2006. MMWR Morb Mortal Wkly Rep 55, 1045–1046.[Medline]
Chen, Q., Savarino, S. J. & Venkatesan, M. M. (2006). Subtractive hybridization and optical mapping of the enterotoxigenic Escherichia coli H10407 chromosome: isolation of unique sequences and demonstration of significant similarity to the chromosome of E. coli K-12. Microbiology 152, 1041–1054.
Cooley, M., Carychao, D., Crawford-Miksza, L., Jay, M. T., Myers, C., Rose, C., Keys, C., Farrar, J. & Mandrell, R. E. (2007). Incidence and tracking of Escherichia coli O157 : H7 in a major produce production region in California. PLoS ONE 14, e1159
Eklund, M., Leino, K. & Siitonen, A. (2002). Clinical Escherichia coli strains carrying stx genes: stx variants and stx-positive virulence profiles. J Clin Microbiol 40, 4585–4593.
Feng, P. C., Monday, S. R., Lacher, D. W., Allison, L., Siitonen, A., Keys, C., Eklund, M., Nagano, H., Karch, H. & other authors (2007). Genetic diversity among clonal lineages within Escherichia coli O157 : H7 stepwise evolutionary model. Emerg Infect Dis 13, 1701–1706.[Medline]
Friedrich, A. W., Bielaszewska, M., Zhang, W. L., Pulz, M., Kuczius, T., Ammon, A. & Karch, H. (2002). Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J Infect Dis 185, 74–84.[CrossRef][Medline]
Fukiya, S., Mizoguchi, H., Tobe, T. & Mori, H. (2004). Extensive genomic diversity in pathogenic Escherichia coli and Shigella strains revealed by comparative genomic hybridization microarray. J Bacteriol 186, 3911–3921.
Griffin, P. M. & Tauxe, R. V. (1991). The epidemiology of infections caused by Escherichia coli O157 : H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol Rev 13, 60–98.
Hayashi, T., Makino, K., Ohnishi, M., Kurokawa, K., Ishii, K., Yokoyama, K., Han, C. G., Ohtsubo, E., Nakayama, K. & other authors (2001). Complete genome sequence of enterohemorrhagic Escherichia coli O157 : H7 and genomic comparison with a laboratory strain K-12. DNA Res 8, 11–22.[Abstract]
Herold, S., Karch, H. & Schmidt, H. (2004). Shiga toxin-encoding bacteriophages – genomes in motion. Int J Med Microbiol 294, 115–121.[CrossRef][Medline]
Iguchi, A., Iyoda, S., Terajima, J., Watanabe, H. & Osawa, R. (2006). Spontaneous recombination between homologous prophage regions causes large-scale inversions within the Escherichia coli O157 : H7 chromosome. Gene 372, 199–207.[CrossRef][Medline]
Jackson, S. A., Mammel, M. K., Patel, I. R., Mays, T., Albert, T. J., LeClerc, J. E. & Cebula, T. A. (2007). Interrogating genomic diversity of Escherichia coli O157 : H7 using DNA tiling arrays. Forensic Sci Int 168, 183–199.[CrossRef][Medline]
Johansen, B. K., Wasteson, Y., Granum, P. E. & Brynestad, S. (2001). Mosaic structure of Shiga-toxin-2-encoding phages isolated from Escherichia coli O157 : H7 indicates frequent gene exchange between lambdoid phage genomes. Microbiology 147, 1929–1936.
Karch, H., Friedrich, A. W., Gerber, A., Zimmerhackl, L. B., Schmidt, M. A. & Bielaszewska, M. (2006). New aspects in the pathogenesis of enteropathic hemolytic uremic syndrome. Semin Thromb Hemost 32, 105–112.[CrossRef][Medline]
Kohler, B., Karch, H. & Schmidt, H. (2000). Antibacterials that are used as growth promoters in animal husbandry can affect the release of Shiga-toxin-2-converting bacteriophages and Shiga toxin 2 from Escherichia coli strains. Microbiology 146, 1085–1090.
Koitabashi, T., Vuddhakul, V., Radu, S., Morigaki, T., Asai, N., Nakaguchi, Y. & Nishibuchi, M. (2006). Genetic characterization of Escherichia coli O157 : H7 strains carrying the stx2 gene but not producing Shiga toxin 2. Microbiol Immunol 50, 135–148.[Medline]
Kotewicz, M. L., Jackson, S. A., LeClerc, J. E. & Cebula, T. A. (2007). Optical maps distinguish individual strains of Escherichia coli O157 : H7. Microbiology 153, 1720–1733.
Kudva, I. T., Evans, P. S., Perna, N. T., Barrett, T. J., DeCastro, G. J., Ausubel, F. M., Blattner, F. R. & Calderwood, S. B. (2002a). Polymorphic amplified typing sequences provide a novel approach to Escherichia coli O157 : H7 strain typing. J Clin Microbiol 40, 1152–1159.
Kudva, I. T., Evans, P. S., Perna, N. T., Barrett, T. J., Ausubel, F. M., Blattner, F. R. & Calderwood, S. B. (2002b). Strains of Escherichia coli O157 : H7 differ primarily by insertions or deletions, not single-nucleotide polymorphisms. J Bacteriol 184, 1873–1879.
Lim, A., Dimalanta, E. T., Potamousis, K. D., Yen, G., Apodoca, J., Tao, C., Lin, J., Qi, R., Skiadas, J. & other authors (2001). Shotgun optical maps of the whole Escherichia coli O157 : H7 genome. Genome Res 11, 1584–1593.
Manning, S. D., Motiwala, A. S., Springman, A. C., Qi, W., Lacher, D. W., Ouellette, L. M., Mladonicky, J. M., Somsel, P., Rudrik, J. T. & other authors (2008). Variation in virulence among clades of Escherichia coli O157 : H7 associated with disease outbreaks. Proc Natl Acad Sci U S A 105, 4868–4873.
Ogura, Y., Kurokawa, K., Ooka, T., Tashiro, K., Tobe, T., Ohnishi, M., Nakayama, K., Morimoto, T., Terajima, J. & other authors (2006). Complexity of the genomic diversity in enterohemorrhagic Escherichia coli O157 revealed by the combinational use of the O157 Sakai oligo DNA microarray and the whole genome PCR scanning. DNA Res 13, 3–14.
Ohnishi, M., Terajima, J., Kurokawa, K., Nakayama, K., Murata, T., Tamura, K., Ogura, Y., Watanabe, H. & Hayashi, T. (2002). Genomic diversity of enterohemorrhagic Escherichia coli O157 revealed by whole genome PCR scanning. Proc Natl Acad Sci U S A 99, 17043–17048.
Orth, D., Grif, K., Khan, A. B., Naim, A., Dierich, M. P. & Würzner, R. (2007). The Shiga toxin genotype rather than the amount of Shiga toxin or the cytotoxicity of Shiga toxin in vitro correlates with the appearance of the hemolytic uremic syndrome. Diagn Microbiol Infect Dis 59, 235–242.[CrossRef][Medline]
Perna, N. T., Plunkett, G., III, Burland, V., Mau, B., Glasner, J. D., Rose, D. J., Mayhew, G. F., Evans, P. S., Gregor, J. & other authors (2001). Genome sequence of enterohaemorrhagic Escherichia coli O157 : H7. Nature 409, 529–533 (Erratum in Nature 410, 240).[CrossRef][Medline]
Ribot, E. M., Fair, M. A., Gautom, R., Cameron, D. N., Hunter, S. B., Swaminathan, B. & Barrett, T. J. (2006). Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157 : H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog Dis 3, 59–67.[CrossRef][Medline]
Ritchie, J. M., Wagner, P. L., Acheson, D. W. & Waldor, M. K. (2003). Comparison of Shiga toxin production by hemolytic-uremic syndrome-associated and bovine-associated Shiga toxin-producing Escherichia coli isolates. Appl Environ Microbiol 69, 1059–1066.
Serra-Moreno, R., Jofre, J. & Muniesa, M. (2007). Insertion site occupancy by stx2 bacteriophages depends on the locus availability of the host strain chromosome. J Bacteriol 189, 6645–6654.
Shaikh, N. & Tarr, P. I. (2003). Escherichia coli O157 : H7 Shiga toxin-encoding bacteriophages: integrations, excisions, truncations, and evolutionary implications. J Bacteriol 185, 3596–3605.
Shima, K., Wu, Y., Sugimoto, N., Asakura, M., Nishimura, K. & Yamasaki, S. (2006). Comparison of a PCR-restriction fragment length polymorphism (PCR-RFLP) assay to pulsed-field gel electrophoresis to determine the effect of repeated subculture and prolonged storage on RFLP patterns of Shiga toxin-producing Escherichia coli O157 : H7. J Clin Microbiol 44, 3963–3968.
Su, C. & Brandt, L. J. (1995). Escherichia coli O157 : H7 infection in humans. Ann Intern Med 123, 698–714.
Wick, L. M., Qi, W., Lacher, D. W. & Whittam, T. S. (2005). Evolution of genomic content in the stepwise emergence of Escherichia coli O157 : H7. J Bacteriol 187, 1783–1791.
Zhang, W., Bielaszewska, M., Friedrich, A. W., Kuczius, T. & Karch, H. (2005). Transcriptional analysis of genes encoding Shiga toxin 2 and its variants in Escherichia coli. Appl Environ Microbiol 71, 558–561.
Zhang, W., Qi, W., Albert, T. J., Motiwala, A. S., Alland, D., Hyytia-Trees, E. K., Ribot, E. M., Fields, P. I., Whittam, T. S. & Swaminathan, B. (2006). Probing genomic diversity and evolution of Escherichia coli O157 by single-nucleotide polymorphisms. Genome Res 16, 757–767.
Zhou, S., Kile, A., Bechner, M., Place, M., Kvikstad, E., Deng, W., Wei, J., Severin, J., Runnheim, R. & other authors (2004). Single-molecule approach to bacterial genomic comparisons via optical mapping. J Bacteriol 186, 7773–7782.
Received 7 April 2008; revised 24 June 2008; accepted 2 July 2008.