Animal: RNA Viruses

Isolation and phylogeny of endogenous retrovirus sequences belonging to the HERV-W family in primates

  • POWIC, Department of Psychiatry, Warneford Hospital, University of Oxford, Oxford OX3 7JX, UK1
  • Department of Cellular and Molecular Biology, Primate Research Institute, Kyoto University, Inuyama, Aichi 484, Japan 2
  • Author for correspondence: Timothy J. Crow.Fax +44 1865 244990. e-mail tim.crow{at}psychiatry.oxford.ac.uk
  • Journal of General Virology 1999; 80(10):2613–2619

    PubMed

    With thanks to our partners for supporting this archive.

    Abstract

    An investigation was undertaken of primate pol gene sequences from a novel endogenous retrovirus family, ERV-W, related to a new human endogenous retrovirus family (HERV-W) that includes multiple sclerosis-associated retrovirus (MSRV) sequences identified in particles recovered from monocyte cultures from patients with multiple sclerosis. The pol gene sequences of the ERV-W family were detected in hominoids and Old World monkeys, but not in New World monkeys, whereas ERV-W long terminal repeat-like elements were detected in all primates (hominoids, Old World monkeys and New World monkeys). Thirty-two pol gene sequences from hominoids and Old World monkeys showed a high degree of sequence identity to MSRV and other HERV-W sequences. Phylogenetic analysis indicated close relationships of pol gene sequences across primate species. The analysis suggests that the ERV-W family has evolved independently but in constrained patterns (‘parallel evolution’) in different primate species, including man. The ratio of synonymous to non- synonymous substitutions indicated that negative selective pressure is acting on CHW1-1 from chimpanzee, HBW6-6 from baboon and HWX5 from man, sequences that have no disruption by point mutation or insertions/deletions. Therefore, these pol gene sequences could be associated with an active provirus in primates. The findings indicate that the ERV-W family has continued to evolve in the course of the primate radiation and may include members with a capacity to influence gene function and possibly cause disease.

    Introduction

    The potential of retroviruses as agents of genomic change and as pathogens became apparent with the discovery of the activity of the enzyme reverse transcriptase by Baltimore (1970) and Temin & Mizutani (1970) . Approximately 1% of the human genome is represented by human endogenous retroviruses (HERVs) and a much larger proportion by long and short interspersed nucleotide elements (LINE, SINE), some of which have evolved from retrovirus sequences (Sverdlov, 1998 ). Full-length retrovirus sequences may interact with cellular oncogenes (Varmus, 1982 ) and retrovirus long terminal repeat (LTR) sequences have the capacity to exert a regulatory influence as promoters and enhancers of cellular genes.

    Pathogenic influences of retroviruses may occur as a result of exogenous infection, as in the case of human immunodeficiency virus, but may also occur from activation of endogenous elements as in the case of mouse mammary tumour virus and murine leukaemia virus. Such models in the mouse raise the possibility that endogenous sequences play a role in human disease. A series of different types of HERV has been described (Martin et al., 1981 ; Mager & Henthorn, 1984 ; Steele et al., 1986 ) and classified as HERV-H, HERV-R, ERV-9 and HERV-K on the basis of their homologies (Löwer et al., 1996 ). In general, there are homologues of these viruses in non-human primates and each class is likely to have a different evolutionary origin (Steinhuber et al., 1995 ; Zs ı́ros et al., 1998 ). In the great majority of cases, the sequences are defective, although in a number of instances expression has been detected, e.g. HERV-E in placenta and various tumour cell lines, HERV- H, HERV-K and ERV-9 in teratocarcinoma cell lines and HERV-K in testicular tumours and at low levels in placenta and some normal tissues (for review see Löwer et al. , 1996 ).

    A retrovirus superantigen has been suggested as a candidate autoimmune gene in type I diabetes (Conrad et al., 1997 ; although see Lan et al., 1998 ; L öwer et al., 1998 ; Murphy et al., 1998 ), and a general role for endogenous viral proteins in the aetiology of autoimmune disease has been discussed (Perron & Seigneurin, 1999 ). Retroviral particles have been recovered from monocyte cultures from patients with multiple sclerosis (Perron et al., 1997 ) and virion-associated RNA of multiple sclerosis-associated retrovirus (MSRV) has been reported in serum of patients with the disease (Garson et al., 1998 ). Expression of MSRV sequences in normal placenta allowed the reconstruction of a 7·6 kb putative genomic retroviral RNA with RU5–gagpolenv–U3R organization, with a polypurine- binding site (PBS) showing similarity with avian retrovirus PBS used by tRNATrp (Blond et al., 1999 ). This new family of endogenous retrovirus sequences has been named HERV-W. The gag and pol open reading frames (ORFs) were interrupted by frame-shifts and stop codons, whereas a complete ORF encoding an envelope was found. Homologies within the pol and env genes with murine type C and simian type D retroviruses, respectively, suggest a chimeric genome structure. In terms of its phylogenetic relationships, the HERV-W family is considered to be related to the ERV-9 and RTLV-H families and to belong to endogenous retrovirus class 1 (Boeke & Stoye, 1997 ). From the sequence divergence of 3′ and 5′ LTRs, an integration event has been estimated at approximately 6 million years ago (Blond et al., 1999 ).

    The HERV-W family may have relevance to the MSRV particles associated with multiple sclerosis, with which the genomic mRNA sequences so far described share 82–88% identity (Blond et al. , 1999 ). The possibility that they have relevance to other neuropsychiatric conditions is raised by the finding of sequences homologous to HERV-W in a representational difference analysis of DNA from monozygotic twins discordant for schizophrenia (Deb et al. , 1998 ), for which an endogenous retrovirus aetiology has previously been proposed (Crow, 1984 ). Our objective is to identify endogenous virus sequences that have relevance to psychotic illness (including schizophrenia). We hypothesize that, if such sequences have a pathogenic role, they will have been subject to change in recent primate evolution and will be associated with variations between individuals and with gene expression. Here, we report an investigation of endogenous retrovirus W family (ERV-W) from hominoids, Old World monkeys and New World monkeys.

    Methods

    ▪ Sample DNA and PCR.

    DNA was isolated from heparinized blood samples following a standard protocol (Sambrook et al., 1989 ) from the following species: the hominoid primates chimpanzee (Pan troglodytes ), gorilla (Gorilla gorilla), orangutan (Pongo pygmaeus) and agile gibbon (Hylobates agilis); the Old World monkeys Japanese monkey (Macaca fuscata), hamadryas baboon (Papio hamadryas), rhesus monkey (Macaca mulatta ) and African green monkey (Cercopithecus aethiops); and the New World monkeys squirrel monkey (Saimiri sciureus), night monkey (Aotus trivirgatus) and common marmoset (Callithrix jacchus). The genomic DNA samples were subjected to PCR amplification. New pol genes of the ERV-W family were amplified by the primer pair HS43 (5′ GGCTCTATTACTTGAAGAGCC 3′, bases 1679–1699) and DS12 (5′ CTAATGGCTTCCTGATGGTTG 3′, bases 2129–2149) from MSRV (GenBank accession no. AF009668). ERV-W LTR elements were amplified by the primer pair HS47 (5′ TGGTCCATGTTTCTTACGGCT 3′, bases 127–147) and DS16 (5′ AAGATGGTGGTGAACCACTTC 3′, bases 521–541) from HERV-W (GenBank accession no. AF072500). The PCR conditions were those of Kim et al. (1996) with an annealing temperature of 58 °C.

    ▪ Cloning of PCR products.

    PCR products were separated on a 1·8% agarose gel, purified with the QIAEX II gel extraction kit (Qiagen) and cloned into the T- khs307 vector (Kim et al., 1998 ). The cloned DNA was isolated by the alkaline lysis method by using the High Pure plasmid isolation kit (Boehringer Mannheim).

    ▪ DNA sequencing and data analyses.

    Individual plasmid DNAs were screened for inserts by PCR. Positive samples were subjected to sequence analyses on both strands with T7 and M13 reverse primers by using an automated DNA sequencer (model 373A) and the Dye Deoxy terminator kit (Applied Biosystems). DNA and deduced amino acid sequence analyses were performed by using the GAP, TRANSLATE, PILEUP and PRETTY programs from the GCG software (Genetics Computer Group, University of Wisconsin). The extents of synonymous and non-synonymous divergence were calculated by the method of Li et al. (1985) . A correction for superimposed substitutions at single sites was made by the two-parameter method of Kimura (1980) . The neighbour-joining phylogenetic analysis (Saitou & Nei, 1987 ) was performed with the MEGA program (Kumar et al., 1993 ). Statistical significance evaluation of the branching pattern was performed with 100 replications. DNA sequences of the HERV-W family were retrieved from the GenBank database with the aid of the BLAST network server (Altschul et al., 1997 ).

    ▪ Nucleotide sequence accession numbers.

    The accession numbers of HERV-W sequences from human were obtained from the GenBank database by using the BLAST network server (Altschul et al., 1997 ): MSRV (AF009668), HWX1 (AB021919), HWX3 (AB021920), HWX5 (AB021921), Pi5T (AF072502), 7A16 (AF072501), 45I4 (AL023581), B353C18 (AC004066), B153K6 (AC005187), U134E6 (Z83850), Q11M15 (AF045450), RG083M05 (AC000064) and BAC378 (U85196).

    Results and Discussion

    Identification and phylogeny of the HERV-W family

    We identified 32 pol gene sequences belonging to the ERV-W family from hominoid primates and Old World monkeys by using a PCR approach. The PCR products gave single bands on agarose gels (see Fig. 3). Five colonies from chimpanzee, five from gorilla, six from orangutan, eight from gibbon, two from Japanese monkey and six from baboon were identified as ERV-W sequences when 15 colonies from the cloned products were selected randomly from each species. These sequences are thus likely to represent a larger number in each of these primate species. The ERV-W pol gene sequences from primates had approximately 70% sequence identity to ERV-9 (La Mantia et al., 1991 ) and were analysed phylogenetically with those of the HERV-W family, MSRV and related sequences (B153K6, B353C18, Q11M15, U134E6, BAC378, RG083M05, 45I4, 7A16, Pi5T, HWX1, HWX3 and HWX5) identified from the GenBank database ( Fig. 1). We used the pol gene sequence of ERV-9 as an outgroup.

    Figure image not available in archive

    Fig. 1. Phylogenetic tree for the pol genes of the ERV-W family in primates obtained by the neighbour-joining method. Species names are abbreviated as follows: CHW, chimpanzee; GOW, gorilla; ORW, orangutan; GIW, gibbon; JMW, Japanese monkey; HBW, hamadryas baboon. The same nomenclature is used in Tables 1 and 2 and Fig. 2

    Figure image not available in archive

    Fig. 2. Amino acid sequence alignment of pol fragments. Dots indicate residues identical to the consensus sequence; dashes indicate gaps introduced to maximize the alignment.

    . Branch lengths are proportional to the distances between the taxa. The values at branch-points indicate the percentage support for a particular node after 100 bootstrap replicates. ERV-9 was used as the outgroup.

    The salient feature of the phylogeny in Fig. 1 is that the HERV-W pol sequences form a dense network that is clearly separated from the ERV-9 outgroup but which shows close relationships between sequences that are present in different primate species. Thus, clone GIW4-4 from gibbon is closely related to HWX1 and HWX3, which were identified from the human X chromosome in a previous study (H.-S. Kim & T. J. Crow, unpublished results), MSRV is classified with clone HBW6-2 from baboon and clone GIW4-3 from gibbon, and human clone B153K6 is grouped with CHW1-2 and CHW1-4 from chimpanzee and GOW2-2 and GOW2-3 from gorilla, while the other human clone, Q11M15, is closely related to GIW4-6 from gibbon. Some pairs of neighbouring sequences have come from the same primate (e.g. HWX1 and HWX3 from human, CHW1-2 and CHIW1-4 from chimpanzee and GOW2-2 and GOW2- 3 from gorilla, and RG083M05 is related by 1 bp deletion to PI5T), but the general pattern is one of a spread of sequences that crosses primate species boundaries. The scatter of sequence relationships suggests that some of the separations between branches are old and that, within branches, the ERV-W family has continued to evolve independently in the different primate species, including humans.

    Sequence analysis and synonymous/non-synonymous substitutions

    Among 32 pol gene sequences of ERV-W from primates, no disruption by point mutations or insertions/deletions that inactivated the ORF by a frame-shift or termination codon appeared in six sequences, CHW1-1 from chimpanzee, GOW2-1 from gorilla, GIW4-1 and GIW4- 2 from gibbon and HBW6-5 and HBW6-6 from baboon, whereas the sequences of each of the clones identified from the pol gene of Japanese monkey and the orangutan were disrupted by several point mutations or insertions/deletions. This kind of phenomenon has been found in other HERV sequences, e.g. HC2, HC2-10, HC2-16, pCRTK1 and pCRTK6 (Haltmeier et al., 1995 ; Kabá t et al., 1996 ; Kim & Crow, 1999 ). We aligned the amino acid sequences of pol genes of ERV-W from the uninterrupted primate clones with human clones (HWX5, MSRV, Q11M15, RG083M05 and BAC378) (Fig. 2). They had 87–92% sequence identity with humans. Amongst primates, 88–92% sequence identity has been shown (Table 1). Notable substitutions were seen at positions 5 and 68. The variation at position 5 includes a cysteine residue; this is likely to have functional significance. Synonymous and non-synonymous substitutions within the pol gene of the HERV-W family in humans and primates were analysed to discover the evolutionary forces at work. As shown in Table 2, the mean synonymous substitutions (K s) ranged from 3·3 to 12·1%, whereas mean non- synonymous substitutions (Ka) ranged from 5·5 to 11·7%, and the value of Ka/Ks ranged from 0·67 to 2·38. In terms of the Ka/Ks ratio, 62% showed higher values for non-synonymous substitutions than for synonymous substitutions in each of the comparisons. We suggest that the sequences of CHW1-1 from chimpanzee, HBW6-6 from baboon and HWX5 from the human X chromosome are under negative selective pressure, since at least 70% of Ka/Ks values in pairwise comparisons were <1·0. These pol gene sequences could therefore be associated with an active provirus in primates.

    Table 1. Percentage identity of 142-amino-acid sequences of pol fragments

    Table 2. Synonymous and non-synonymous substitutions in pol fragments

    Evolution of the HERV-W family

    The pol gene sequences of the HERV-W family were detected in hominoids and Old World monkeys, but not in New World monkeys, by PCR amplification (Fig. 3). HERV-K and S71 sequences have also been detected in hominoids and Old World monkeys, but not in New World monkeys, by Southern blot with conserved regions of the pol or env genes as probes or by PCR analyses of such regions (Brack- Werner et al., 1989 ; Zhu et al., 1994 ; Steinhuber et al., 1995 ). With the S71 HERV-K LTR probe, strong hybridizing bands were detected in DNA from the orangutan but not in DNA from the marmoset. Therefore, it was suggested that HERV-K LTRs have inserted in the primate genome after the split of New World monkeys in the Oligocene era, approximately 33 million years ago (Leib-Mösch et al. , 1993 ). However, we found HERV-K LTR-like elements in New World monkeys (squirrel monkey and night monkey) by a PCR approach (Kim et al., 1999b ). Likewise, HERV-W LTR- like elements were detected in all primates, including hominoids, Old and New World monkeys, as examined by PCR (Fig. 4). This finding suggests that HERV-W LTR-like elements exist in humans and other primates, as has already been shown for HERV-K and HERV-H LTRs, although detailed mapping of the HERV-W genome is required to establish this.

    Figure image not available in archive

    Fig. 3. PCR analysis of genomic DNA for the presence of the pol gene of the HERV-W family in primates. Lane M, marker (ϕX174/HaeIII); 1, chimpanzee; 2, gorilla; 3, orangutan; 4, gibbon; 5, Japanese monkey; 6, hamadryas baboon; 7, rhesus monkey; 8, African green monkey; 9, squirrel monkey; 10, night monkey; and 11, common marmoset.

    Figure image not available in archive

    Fig. 4. PCR analysis of genomic DNA for the presence of LTR- like elements of the HERV-W family in primates. Lane 1, human; 2, chimpanzee; 3, gorilla; 4, orangutan; 5, gibbon; 6, Japanese monkey; 7, hamadryas baboon; 8, rhesus monkey; 9, African green monkey; 10, squirrel monkey; 11, night monkey; and 12, common marmoset.

    An endogenous retrovirus element, ERV-9, of low repeat number has been integrated after the split of orangutan from the great apes, but before the divergence of the gorilla lineage, according to library screening and PCR analysis (Di Cristofano et al., 1995 ). As shown in Fig. 5, other HERV families, HC2 (Kim et al., 1999d ), HERV-R (Cohen & Larsson, 1988 ), the HERV-H pol gene (Mager & Freeman, 1995 ) and HERV-H LTR types Ia and II (Anderssen et al., 1997 ), have been found in hominoids, Old World monkeys and New World monkeys, whereas HERV-H LTR type I has been found in the even-earlier prosimians by using a PCR approach (Anderssen et al., 1997 ). A retroposon, SINE-R.C2, has been shown to be a human-specific retroposon by Southern blot analysis (Zhu et al., 1994 ), and some HERV-K LTR elements (e.g. AC002350, AC002400 and AC002508) have been identified as human-specific by PCR and phylogenetic analyses (Medstrand & Mager, 1998 ), whereas by PCR analysis, SINE-R-type retroposons have been shown to be hominoid-specific (Kim et al., 1999a , c ).

    Figure image not available in archive

    Fig. 5. Evolutionary tree for the putative integration times of endogenous retroviruses/retroposons in primates. The branching times of the phylogeny should be considered as approximate, and the tree was modified from Steinhuber et al. (1995) , Anderssen et al. (1997) and Medstrand & Mager (1998) .

    Implications for human disease

    LTR elements are implicated in various diseases. For example, a solitary LTR element (DQ-LTR3) of the HERV-K family at the HLA-DQB1 locus has been associated with rheumatoid arthritis (Seidl et al. , 1999 ). An element described as almost identical to SINE-R.C2 that is derived from the HERV-K LTR element is a cause of Fukuyama-type muscular dystrophy (Kobayashi et al., 1998 ). Interestingly, HERV-L LTRs bind host-cell nuclear proteins and have the potential to activate neighbouring genes (Akopov et al., 1998 ). An HERV-K LTR element has inserted in the antisense orientation between the gag and pol genes of the human endogenous retrovirus S71 and has also been found to be co-expressed with cellular sequences (Leib-Mösch et al., 1993 ). Recently, it has been demonstrated that solitary LTR elements are still being amplified in the human and chimpanzee genomes (Medstrand & Mager, 1998 ). They are an agent of genome change and a potential source of genetic variation associated with disease. HERV-W was originally found from patients with multiple sclerosis (Perron et al., 1997 ). A virion-associated MSRV RNA has been detected in serum of patients with the disease (Garson et al., 1998 ). We consider that the evidence we have presented for activity in the course of primate evolution justifies further investigation of HERV-W sequences as potential pathogens. The next stage in such an investigation will be to identify genome locations of such putative virogenes.

    In summary, 32 members of a novel ERV-W family were identified from hominoids and Old World monkeys by PCR amplification. In their pol genes, they showed a high degree of sequence identity to the HERV- W family. In six sequences, CHW1-1 from chimpanzee, GOW2-1 from gorilla, GIW4-1 and GIW4-2 from gibbon and HBW6-5 and HBW6-6 from baboon, as in MSRV and HWX5, there was no disruption of the pol gene by point mutation or insertions/deletions. Phylogenetic analysis by the neighbour-joining method of nucleotide sequences of pol fragments of the ERV-W family from humans and primates showed that MSRV is closely related to GIW4-3 and HBW6-2, suggesting that the ERV-W family has evolved independently in a number of different branches in humans and primates. The ratio of synonymous to non-synonymous substitutions showed that negative selection is acting on CHW1-1, HBW6- 6 and HWX5. This suggests that these sequences may represent an active provirus in primates. Our study of the ERV-W family during primate evolution contributes to the understanding of their biological roles in primate genomes.

    Acknowledgments

    We thank Rekha V. Wadekar for her technical assistance. This work was supported by grants from the UK Medical Research Council and the Stanley Foundation.

    Footnotes

    References