Research Article

Tomato chlorotic dwarf viroid: an evolutionary link in the origin of pospiviroids

Journal of General Virology 1999; 80(11):2823

PubMed

Abstract

Over 40 isolates of potato spindle tuber viroid (PSTVd) have been reported from potato, other Solanum species and greenhouse tomato. These isolates have sequence similarities in the range 9599%. A viroid which caused chlorotic leaves and severe dwarfing of plants in greenhouse tomato crops was detected. The viroid was found to hybridize readily with PSTVd probes. It migrated faster than PSTVd in return-polyacrylamide gel electrophoresis and was not amplified in RTPCR by a primer pair based on the lower strand of the central conserved region of PSTVd. Nucleotide sequencing of the viroid indicated that it is a circular RNA of 360 nt, with less than 90% sequence similarities with PSTVd isolates. The Variable domain (V) has less than 60% and the Terminal Right domain less than 90% sequence similarity, while the remainder of the molecule has greater than 97% similarity with PSTVd. Because of its less-than 90% sequence similarities, unique V domain, lack of seed-transmission and lack of cross-protection by PSTVd, the viroid from tomato is proposed to be a distinct viroid species (tomato chlorotic dwarf viroid; TCDVd) which also differs from two viroids infecting tomato in nature. TCDVd may be an evolutionary link in the development of crop viroids, with Mexican papita viroid as the ancestral viroid.
The low-molecular-mass plant pathogens, the viroids, are 246399 nt circular RNA molecules (Singh, 1998 ). Over 25 plant maladies have now been ascribed to viroids in agricultural, horticultural and ornamental plants (Diener, 1987 ; Singh & Dhar, 1998 ). Nucleotide sequences of almost all viroids are known along with their many sequence variants. In some cases, these sequences have been correlated with symptom severity and have been assigned to viroid strains (Visvader & Symons, 1985 ; Schnö lzer et al., 1985 ; Herold et al., 1992 ; Gora et al., 1994 ). Isolates with higher than 90% sequence similarities are generally considered as variants of a particular viroid, while a viroid is generally considered a distinct species if similarities are less than 90% (Flores et al ., 1998 ).

Potato spindle tuber viroid (PSTVd), with its numerous, well- characterized strains and isolates, was the first viroid to be discovered (Diener, 1971 ; Singh & Clark, 1971 ), structurally characterized (Sänger et al., 1976 ) and sequenced (Gross et al ., 1978 ). It is the type species of the genus Pospiviroid (Flores et al., 1998 ). About 40 PSTVd variant sequences are found in the GenBank and EMBL nucleotide databases. The potato (Solanum tuberosum) isolates represent the natural source of infection in the field (Schnö lzer et al., 1985 ; Owens et al., 1992 ; Herold et al., 1992 ; Lakshman & Tavantzis, 1993 ; Singh et al., 1993 ; Gora et al., 1994 ; Gora-Sochacka et al., 1997 ). Other isolates are in vitro-generated PSTVd mutants (Hammond, 1992 , 1994 ; Lakshman & Tavantzis, 1992 ; Qu et al., 1993 ; Wassenegger et al., 1994 , 1996 ; Owens et al., 1995 ; Hu et al., 1996 ). Except for one isolate of 341 nt (Wassenegger et al., 1994 ), such isolates are very similar in size and vary by 17 nt from the prototype strain (Gross et al., 1978 ). Naturally occurring PSTVd isolates from greenhouse tomato ( Lycopersicon esculentum) and Solanum species (including S. muricatum) have also been reported (Puchta et al., 1990 ; Owens et al., 1992 ; Behjatnia et al., 1996 ; Shamloul et al., 1997 ). These isolates have sequence similarity of 9598% with PSTVd. Greenhouse tomato and pepino (S. muricatum) isolates are 35 nt shorter than the 359 nt PSTVd. It has been assumed that accidental transfers of PSTVd from symptomless pepino could have caused symptoms in greenhouse tomatoes, since pepino seed is generally infected with PSTVd (Puchta et al., 1990 ).

In Canada, PSTVd has been eradicated (Singh, 1988 ) and has not been detected in potato fields since 1980. Thus, when approximately 2000 greenhouse tomato seedlings of cv. Trust, grown from seed imported from The Netherlands, suddenly developed chlorotic leaves and grew to become severely dwarfed and bunchy plants, i.e. symptomology typical of PSTVd in tomato (Singh & O'Brien, 1970 ), a viroid aetiology was suspected. We report here identification of a viroid from these plants, designated tomato chlorotic dwarf viroid (TCDVd), which has sequence similarities of 8688% with PSTVd potato isolates and 8589% with other (greenhouse tomato, pepino, Solanum species) isolates. Considering that Mexican papita viroid (MPVd) (Martinez-Soriano et al., 1996 ), which has 7880% sequence identity to PSTVd, has been proposed as an ancestor of crop viroids, TCDVd may represent an evolutionary link between MPVd and PSTVd.

Disease material, transmission, host-range and cross-protection.
Diseased plants of tomato cv. Trust with severely reduced leaves and fruits were received from a greenhouse tomato producer (Carman, Manitoba, Canada). A few symptomatic leaves were ground in buffer (50 mM glycine, 30 mM phosphate, pH 9·2) and sap was manually inoculated to tomato cvs Sheyenne and Trust by rubbing onto leaves dusted with 350 mesh Carborundum. Graft inoculation was performed by inserting stem scions from diseased tomato plants into a downward cut in the stem of stock plants, and the two were bound together with a Parafilm strip. These plants served as the disease source from which to inoculate other plants by graft or manual inoculation. Twelve commonly used indicator plants and ten potato cultivars were used in host-range studies. Seeds from infected indicator plants and two potato cultivars were used for seed transmission tests. R-PAGE (see below) was used to confirm the presence of TCDVd in subsequent plant inoculations. Cross-protection (Khoury et al., 1988 ) was performed by pre-inoculating with PSTVd, followed by challenge inoculation with viroid from tomato.

Viroid isolation, RTPCR, cloning and sequencing.
Total leaf nucleic acids were extracted and return-polyacrylamide gel electrophoresis (R-PAGE) was carried out (Singh, 1991 ). About 1·5 µg (6 µl) of nucleic acid was loaded on a 5% gel and the first cycle carried out under non-denaturing conditions in TBE buffer (89 mM Tris, 89 mM boric acid, 2·5 mM EDTA; pH 8·3) at 25 °C. The reverse cycle was carried out under denaturing conditions (1:8 diluted buffer, at 71 °C). RNA bands were visualized by silver staining.

An RTPCR for preliminary characterization of viroids was carried out using three primer pairs, based on the sequences of PSTVd isolates. Primers 2A (5' TGTTTCCACCGGTAGTAGC 3'; complementary to nt 254273) and 1S (5' ACTCGTGGTTCCTGTGGTTC 3'; identical to nt 1029) were designed for use with isolate FM (Herold et al., 1992 ). P1 (complementary to nt 256273) and P2 (identical to nt 274295) were from PSTVd (Gross et al., 1978 ); P3 (complementary to nt 6893) and P4 (identical to nt 87110), for use with the Darwin isolate of PSTVd, were the primers used by Behjatnia et al. (1996) .

For purification of viroid, total leaf nucleic acids from TCDVd- infected Nicandra, potato, Scopolia and tomato were separated in R-PAGE and unstained viroid bands (Singh et al., 1988 ) were cut out and incubated overnight at 37 °C in eluting buffer (0·5 M ammonium acetate, 0·1% SDS, 10 mM EDTA; pH 8·0). Eluted viroid RNA was precipitated with ethanol and suspended in TE (10 mM TrisHCl, pH 8·0, 1 mM EDTA). cDNA was synthesized and amplified with uracil-containing primers for subsequent cloning as in Rashtchian et al. (1992) . Briefly, CUACUACUACUA was added onto primer P3 and CAUCAUCAUCAU onto P4 at the 5' end (Singh & Singh, 1995 ). Amplification was carried out for 35 cycles (1 min each of denaturation at 94 °C, annealing at 55 °C and extension at 72 °C, with a final extension for 7 min). PCR products were separated by 2% agarose gel electrophoresis and stained with ethidium bromide. Bands of approximately 400 bp were excised, extracted with TE, purified with Glass MAX spin cartridges (Gibco BRL) and then cloned into competent Escherichia coli DHα using the clone Amp 1 system (Gibco BRL). Viroid inserts were confirmed by PCR and agarose gel electrophoresis.

Two viroid clones, each of which infected Nicandra, potato, Scopolia and tomato, were initially sequenced in both directions by the dideoxy chain-termination method (Sanger et al ., 1977 ) using modified T7 DNA polymerase (Sequenase version 2.0, US Biochemical). Later, the sequencing was done using a PE/ABI 377 DNA sequencer and the PE/ABI-ABI PRISM BigDye Terminator cycle sequencing Ready Reaction Kit (PE Applied Biosystems). In order to confirm the sequence in the P3+P4 priming region, a second pair of primers (P5, P6) was designed. P5 is complementary to nt 342360 and P6 is identical to nt 120 of TCDVd (this study); these primers were synthesized with uracil NTPs, and amplification products were cloned and sequenced as before. Again, eight clones (two from each host) were sequenced as above. Sequence analysis by pair-wise comparison and multiple alignment, as well as calculation of secondary structures, were carried out using the Genetics Computer Group suite of programs, version 8.1 (University of Wisconsin, Madison, WI, USA).

Symptoms, host-range, seed transmission and cross protection
Sheyenne tomato plants grafted or manually inoculated with diseased samples developed symptoms. The symptoms included leaf chlorosis, veinal and petiolar necrosis, reduction of leaf size and overall bunchiness and dwarfing of the plant, a symptomology mimicking that of PSTVd in this host (Singh & O'Brien, 1970 ). A more severe but similar symptomology was observed in tomato cv. Trust. Total nucleic acids extracted from original diseased Trust tomato and further multiplied in Sheyenne tomato plants displayed a band migrating slightly faster than PSTVd FM in R-PAGE (Fig. 1 , lane 15). This viroid band was tentatively designated tomato chlorotic dwarf viroid (TCDVd).



(94K):

Fig. 1. Replication of PSTVd FM and TCDVd in singly and doubly infected tomato plants. Lane 1, nucleic acid extract form healthy plants; lanes 25, extracts from plants singly infected with PSTVd FM; lanes 69, extracts from plants doubly infected with PSTVd+TCDVd; lanes 1013, extracts form plants singly infected with TCDVd; lane 14, PSTVd FM; and lane 15, TCDVd. Arrows indicate PSTVd and TCDVd bands.

Plants of Nicandra physaloides, Nicotiana debneyi, Nicotiana glutinosa, Physalis angulata, P. floridana, Scopolia sinensis, Solanum demissum , S. tuberosum cvs Alpha, Atlantic, Chieftain, Chipeta, Niska, Red Pontiac, Russet Burbank, Superior and Yukon Gold were found to be susceptible to TCDVd. Symptoms of leaf and petiole necrosis were observed in N. physaloides and S . sinensis plants, while severe dwarfing and upright growth of all potato cultivars were the dominating symptoms. Variegated flower petals (colour break) were characteristically observed in N . physaloides and N. glutinosa. Severe cracking of potato tubers without noticeable elongation of the tuber size was also observed with TCDVd infection. Plants of Datura metel , Gomphrena globosa and Nicotiana tabacum were not susceptible.

PSTVd is seed-transmitted and can persist in true potato seed for over 20 years (Singh et al., 1988 , 1991 ). The possibility that TCDVd is seed-borne was tested by R-PAGE using 100 seeds of each indicator plant and two potato cultivars: a total of 700 seeds and 400 seedlings of N. physaloides, N . debneyi, P. angulata, P. floridana, tomato and potato cvs Atlantic and Superior were tested for seed-borne infection of TCDVd. No infection was detected by R-PAGE either in the seeds or plants generated from seeds. In parallel experiments, PSTVd infection of 7-year-old true potato seed was routinely detected by R-PAGE.

Because the differential migration pattern of TCDVd and PSTVd in R- PAGE allows the two species to be differentiated, cross-protection for viroid replication could be tested (Khoury et al., 1988 ). Ten tomato plants pre-infected with PSTVd FM (Herold et al., 1992 ) and challenged with TCDVd supported replication of both viroids (Fig. 1, lanes 69) similar to the singly infected plants (Fig. 1, lanes 25 and 1013). The mild symptoms of PSTVd FM were replaced with the severe symptoms characteristic of TCDVd in doubly infected plants. We concluded that there was no interference by PSTVd in the multiplication and symptom expression of TCDVd in doubly infected plants.

RTPCR, cloning and sequence determination
Primer pair 2A+1S amplified two bands of different sizes from TCDVd and PSTVd. The main PSTVd band had a counterpart of similar mobility from the TCDVd-infected sources (Fig. 2 , upper panel). P1+P2 amplified PSTVd but not TCDVd (Fig. 2, middle panel) and P3+P4 amplified a single band in both viroid infections (Fig. 2, lower panel). These observations indicated that TCDVd might differ in sequence in the lower strand of the central conserved region, a difference which the primers P1+P2 were designed to detect. Since the P3+P4 primer pair, based upon the upper strand of the central conserved region (CCR), gave a full-length PCR product for both PSTVd and TCDVd, we suspected that there would be similarities of sequences in the upper strand of the CCR.



(73K):

Fig. 2. RTPCR amplification of TCDVd and PSTVd by three pairs of primers. Primers 2A+1S, upper panel; P1+P2, middle panel; and P3+P4, lower panel. Left lane contained size markers. Three samples were used for each viroid.

Analysis of 16 clones sequenced in both directions showed that TCDVd consists of 360 nt (Fig. 3 ). There was minimal variation between sequences of clones and from different hosts. Of the 16 clones only two (one each from N. physaloides and S. sinensis) showed one nucleotide change, in N. physaloides U165→C, and in S. sinensis U311→to A. The DNA inserts were infectious in tomato and S. sinensis plants when removed from plasmids by BamHI excision, indicating the accuracy of the predominant nucleotide sequence.



(9K):

Fig. 3. Primary and secondary structure of TCDVd. The approximate location of various domains are indicated. TL, Terminal Left; P, Pathogenicity; C, Central Conserved Region; V, Variable; and TR, Terminal Right.

TCDVd assumes a thermodynamically stable rod-like secondary structure similar to other members of the family Pospiviroidae (Fig. 3). Sequence comparison showed that TCDVd is more closely related to PSTVd isolates than to any other viroids. TCDVd has nucleotide sequence similarities of 86·5% with PSTVd `type' strain (Gross et al., 1978 ), 86·8% with PSTVd-Darwin (Behjatnia et al., 1996 ), 89·6% with PSTVd-N (Puchta et al., 1990 ), 85·5% with the published 354 nt PSTVd-Chile sequence (Shamloul et al., 1997 ) and 80·3% with MPVd (Martinez-Soriano et al., 1996 ). A multiple sequence alignment using the GrowTree phylogram showed that TCDVd is related to PSTVd, but formed a separate branch (Fig. 4 ). Tomato has been reported to be the natural host of two viroids, tomato apical stunt (TASVd) and tomato planta macho (TPMVd) (Kiefer et al., 1983 ). TCDVd has 73% and 83% sequence identity to these viroids, respectively and was not grouped with them (Fig. 4).



(7K):

Fig. 4. GrowTree phylogram of members of the genus Pospiviroid, indicating the distinct position of the TCDVd in comparison to PSTVd. Distances are estimated number of substitutions per 100 bases. MPVd, Mexican papita viroid; TPMVd, tomato planta macho viroid; CEVd, Citrus exocortis viroid; TASVd, tomato apical stunt viroid; CSVd, Chrysanthemum stunt viroid; CLVd, Columnea latent viroid; and IrVd, Iresine viroid.

When compared to PSTVd, TCDVd has nucleotide changes in all five domains (Keese & Symons, 1985 ) of the viroid molecule. However, the Variable (V) and Terminal Right (TR) domains of TCDVd have 59% and 89% sequence identities, respectively, while the remaining molecule has over 97% identity to PSTVd. Since the V domain of PSTVd is known to contain both sequences that are important for replication and accumulation of viroid as well as the `premelting region 3', which is involved in the control of breakdown of the native structure in vitro (Riesner, 1991 ; Hu et al., 1996 ), TCDVd, with its drastically different V domain, provides an alternative structure for experimentation.

When the TR sequences of TCDVd are compared with members of the genus Pospiviroid, various PSTVd isolates exhibit less than 90% identities, and TASVd, MPVd and Columnea latent viroid exhibit 93% identities. This indicates that the TR in TCDVd could have been derived from viroids other than PSTVd.

In addition to the extensive changes in the V and TR domains when compared to PSTVd, TCDVd has a nucleotide transition of A 45→U45 in the Terminal Left (TL) domain, which is also found in PSTVd-N (Puchta et al., 1990 ). The addition of U63 in the upper strand of the Pathogenicity (P) domain, the substitution of G311 in the lower strand of P domain and the transition U258→A 258 in the lower strand of the CCR are other changes in TCDVd. Nucleotide 258 is part of an ultraviolet light-sensitive structural element that is present in RNA molecules of hepatitis delta virus RNA, host 5S ribosomal RNA and 7SL signal recognition particle RNAs and PSTVd (Branch et al., 1990 ). It is noteworthy that the transition of nt 258 was responsible for the failure of RTPCR amplification by primer pair P1+P2, based on the PSTVd sequence (Fig. 2, middle panel). The single nucleotide mismatch at the 3' end of primer P1 prevented reverse transcription.

From this study it is concluded that TCDVd is a new viroid species, which has similarity to various members of the genus Pospiviroid but differs drastically in its Variable domain from other members. Infection of potato with this viroid may cause symptoms indistinguishable from those caused by PSTVd and could create plant quarantine problems. The origin of TCDVd in greenhouse tomato crops has been hard to determine. The tomato seeds were produced in The Netherlands and were exported to the USA, from where the seeds were imported into Canada. Extensive efforts to demonstrate seed transmission or presence of viroid in the seed have failed. Subsequent batches of tomato seeds from the same sources have produced healthy crops.

We would like to thank Vanderveens' Greenhouses, Carman, Manitoba, for providing the diseased samples and discussion of the occurrence of the disease; Mr Dennis Lidgett, Manitoba, for providing the slides of disease symptoms; and Ms Helena Weilguny, Slovenia, for carrying out some of the initial experiments at the Potato Research Centre, Fredericton.

Footnotes

The GenBank accession number of the sequence reported in this paper is AF162131.

References

Behjatnia, S. A. A. , Dry, I. B. , Krake, L. R. , Condé, B. D. , Connelly, M. I. , Randles, J. W. & Rezaian, M. A. (1996). New potato spindle tuber viroid and tomato leaf curl geminivirus strains from a wild Solanum sp. Phytopathology 86, 880-886.

Branch, A. D. , Levine, B. J. & Robertson, H. D. (1990). The brotherhood of circular RNA pathogens: viroids, circular satellites and the hepatitis delta virus. Seminars in Virology 1, 143-152.

Diener, T. O. (1971). Potato spindle tuber `virus'. IV. A replicating, low molecular weight RNA. Virology 45, 411-428.[Medline]

Diener, T. O. (editor) (1987). The Viroids. New York: Plenum Press.

Flores, R. , Randles, J. W. , Bar-Joseph, M. & Diener, T. O. (1998). A proposed scheme for viroid classification and nomenclature. Archives of Virology 143, 623-629.[Medline]

Gora, A. , Candresse, T. & Zagorski, W. (1994). Analysis of the population structure of three phenotypically distinct PSTVd isolates. Archives of Virology 138, 233-245.[Medline]

Gora-Sochacka, A. , Kierzek, A. , Candresse, T. & Zagorski, W. (1997). The genetic stability of potato spindle tuber viroid (PSTVd) molecular variants. RNA 3, 68-74.[Abstract]

Gross, H. J. , Domdey, H. , Lossow, C. , Jank, P. , Raba, M. , Alberty, H. & Sänger, H. L. (1978). Nucleotide sequence and secondary structure of potato spindle tuber viroid. Nature 273, 203-208.[Medline]

Hammond, R. W. (1992). Analysis of the virulence modulating region of potato spindle tuber viroid (PSTVd) by site-directed mutagenesis. Virology 187, 654-662.[Medline]

Hammond, R. W. (1994). Agrobacterium- mediated inoculation of PSTVd cDNA onto tomato reveals the biological effect of apparently lethal mutations. Virology 201, 36-45.[Medline]

Herold, T. , Haas, B. , Singh, R. P. , Boucher, A. & Sänger, H. L. (1992). Sequence analysis of five new field isolates demonstrates that the chain length of potato spindle tuber viroid (PSTVd) is not strictly conserved but as variable as in other viroids. Plant Molecular Biology 19, 329-333.[Medline]

Hu, Y. , Fieldstein, P. A. , Bottino, P. J. & Owens, R. A. (1996). Role of the variable domain in modulating potato spindle tuber viroid replication. Virology 219, 45-56.[Medline]

Keese, P. & Symons, R. H. (1985). Domains in viroids: evidence of intermolecular RNA rearrangements and their contribution to viroid evolution. Proceedings of the National Academy of Sciences, USA 82, 4582-4586 .[Abstract/Free Full Text]

Khoury, J. , Singh, R. P. , Boucher, A. & Coombs, D. H. (1988). Concentration and distribution of mild and severe strains of potato spindle tuber viroid in cross-protected tomato plants. Phytopathology 78, 1331-1336 .

Kiefer, M. C. , Owens, R. A. & Diener, T. O. (1983). Structural similarities between viroids and transposable genetic elements. Proceedings of the National Academy of Sciences, USA 80, 6234-6238 .[Abstract/Free Full Text]

Lakshman, K. D. & Tavantzis, S. M. (1992). RNA progeny of an infectious two-base deletion cDNA mutant of potato spindle tuber viroid (PSTV) acquire two nucleotides in planta. Virology 187, 565-572.[Medline]

Lakshman, K. D. & Tavantzis, S. M. (1993). Primary and secondary structure of a 360 nucleotide isolate of potato spindle tuber viroid. Archives of Virology 128, 319-331.[Medline]

Martinez-Soriano, J. P. , Galindo-Alonso, J. , Maroon, C. J. M. , Yucel, I. , Smith, D. R. & Diener, T. O. (1996). Mexican papita viroid: putative ancestor of crop viroids. Proceedings of the National Academy of Sciences, USA 93, 9397-9401 .[Abstract/Free Full Text]

Owens, R. A. , Khurana, S. M. P. , Smith, D. R. , Singh, M. N. & Garg, I. D. (1992). A new mild strain of potato spindle tuber viroid isolated from wild Solanum spp. in India. Plant Disease 76, 527-529.

Owens, R. A. , Chen, W. , Hu, Y. & Hsu, Y.-H. (1995). Suppression of potato spindle tuber viroid replication and symptom expression by mutations which stabilize the pathogenicity region. Virology 208, 554-564.[Medline]

Puchta, H. , Herold, T. , Verhoeven, K. , Roenhorst, A. , Ramm, K. , Schmidt-Puchta, W. & Sänger, H. L. (1990). A new strain of potato spindle tuber viroid (PSTVd-N) exhibits major sequence differences as compared to all other PSTVd strains sequenced so far. Plant Molecular Biology 15, 509-511.[Medline]

Qu, F. , Heinrich, C. , Loss, P. , Steger, G. , Tien, P. & Riesner, D. (1993). Multiple pathways of reversion in viroids for conservation of structural elements. EMBO Journal 12, 2129-2139 .[Medline]

Rashtchian, A. , Buchman, G. W. , Shuster, D. M. & Berninger, M. (1992). Uracil DNA glycosylase-mediated cloning of polymerase chain reaction-amplified DNA: application to genomic and cDNA cloning. Analytical Biochemistry 206, 91-97.[Medline]

Riesner, D. (1991). Viroids: from thermodynamic to cellular structure and function. Molecular PlantMicrobe Interactions 4, 122-131.

Sanger, F. , Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74, 5463-5467 .[Abstract/Free Full Text]

Sänger, H. L. , Klotz, G. , Riesner, D. , Gross, H. J. & Kleinschmidt, A. K. (1976). Viroids are single-stranded covalently closed circular RNA molecules existing as a highly base-paired structure. Proceedings of the National Academy of Sciences, USA 73, 3852-3856 .[Abstract/Free Full Text]

Schnölzer, M. , Haas, B. , Ramm, K. , Hofmann, H. & Sänger, H. L. (1985). Correlation between structure and pathogenicity of potato spindle tuber viroid (PSTV). EMBO Journal 4, 2181-2190.[Medline]

Shamloul, A. M. , Hadidi, A. , Zhu, S. F. , Singh, R. P. & Sagredo, B. (1997). Sensitive detection of potato spindle tuber viroid using RTPCR and identification of a viroid variant naturally infecting pepino plants. Canadian Journal of Plant Pathology 19, 89-96.

Singh, R. P. (1988). Occurrence, diagnosis and eradication of the potato spindle tuber viroid in Canada. In Viroids of Plants and Their Detection,pp. 3750. International Seminar, August 1220 1986. Warsaw: Warsaw Agricultural University.

Singh, R. P. (1991). Return-polyacrylamide gel electrophoresis for the detection of viroids. In Viroids and Satellites: Molecular Parasites at the Frontier of Life, pp. 89-118. Edited by K. Maramorsch. Boca Raton, FL: CRC Press.

Singh, R. P. (1998). Viroids twenty-five years later: personal reflections. In Topics in Tropical Virology , pp. 131-152. Edited by D. N. Black, D. D. Shukla & N. Rishi. New Delhi: Malhotra Publishing House.

Singh, R. P. & Clark, M. C. (1971). Infectious low- molecular weight ribonucleic acid from tomato. Biochemical and Biophysical Research Communications 44, 1077-1083 .[Medline]

Singh, R. P. & Dhar, A. K. (1998). Detection and management of plant viroids. In Plant Virus Disease Control, pp. 428-447. Edited by A. Hadidi, R. K. Khetarpal & H. Koganezawa. St Paul, MN: APS Press.

Singh, R. P. & O'Brien, M. J. (1970). Additional indicator plants for potato spindle tuber virus. American Potato Journal 47, 367-371.

Singh, M. & Singh, R. P. (1995). Propagation of plasmid containing an unstable insert of potato virus Yo using STBL2- competent cells. Focus 17, 72-73.

Singh, R. P. , Boucher, A. & Seabrook, J. E. A. (1988). Detection of the mild strains of potato spindle tuber viroid from single true potato seed by return electrophoresis. Phytopathology 78, 663-667.

Singh, R. P. , Boucher, A. & Wang, R. G. (1991). Detection, distribution and long-term persistence of potato spindle tuber viroid in true potato seed from Heilongjiang, China. American Potato Journal 60, 65-74.

Singh, R. P. , Singh, M. , Boucher, A. & Owens, R. A. (1993). A mild strain of potato spindle tuber viroid from China is similar to North American isolates. Canadian Journal of Plant Pathology 15, 134-138.

Visvader, J. E. & Symons, R. H. (1985). Eleven new sequence variants of citrus exocortis viroid and the correlation of sequence with pathogenicity. Nucleic Acids Research 13, 2907-2920 .[Abstract/Free Full Text]

Wassenegger, M. , Heimes, S. & Sänger, H. L. (1994). An infectious viroid RNA replicon evolved from an in vitro- generated non-infectious viroid deletion mutant via a complementary deletion in vivo. EMBO Journal 13, 6172-6177 .[Medline]

Wassenegger, M. , Spieker, R. L. , Thalmer, S. , Gast, F.-U. , Riedel, L. & Sänger, H. L. (1996). A single nucleotide substitution converts potato spindle tuber viroid (PSTVd) from a noninfectious to an infectious RNA for Nicotiana tabacum. Virology 226, 191-197.[Medline]

Received 31 March 1999; accepted 1 July 1999.



HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS