Research Article

Site-saturation mutagenesis of the PALTAVETG motif in coxsackievirus A9 capsid protein VP1 reveals evidence of conservation of a periodic hydrophobicity profile

Journal of General Virology 1999; 80(8):1919

PubMed

Abstract

Enteroviruses possess a highly conserved 9 amino acid stretch of mainly hydrophobic character in the capsid protein VP1. A novel strategy, combining site-saturation mutagenesis and a single-tube cloning and transfection procedure, has been developed for the analysis of this motif in coxsackievirus A9 (CAV-9). Four individual amino acids were separately mutated. Mutagenesis of three of the four positions in CAV-9 resulted in a number of viable but impaired mutant strains, each containing a single amino acid substitution. In contrast, no mutants with amino acid substitutions at leucine 31 were isolated, although three different leucine codons were found among the viruses recovered. Small plaque size was regularly associated with reduced yields of infectious virus and an amino acid substitution at the target site in the viruses isolated from the site-saturated virus pools. From the range of amino acids observed in viable mutants, it was possible to estimate the characteristics that are required at individual amino acid positions. It seems that in the motif studied here, a periodic hydrophobicity profile needs to be conserved. The constraints observed on the ranges of acceptable amino acids presumably reflect the structuralfunctional requirements that have resulted in the conservation of the motif.
Coxsackievirus A9 (CAV-9) is a member of the genus Enterovirus of the family Picornaviridae. Enteroviruses are small, non-enveloped, icosahedral particles with a positive-strand RNA genome of approximately 7500 nucleotides. An enterovirus capsid consists of 12 pentamers, each of which contains five protomers. The 60 identical protomers are formed from one copy of each of the four viral capsid proteins, VP1VP4. Structures of four enteroviruses have been resolved by X-ray crystallographic analysis: coxsackievirus B3 (Muckelbauer et al., 1995 ), poliovirus type 1/Mahoney (Hogle et al., 1985 ), poliovirus type 3/Sabin (Filman et al., 1989 ) and bovine enterovirus (Smyth et al., 1995 ). In all these structures, the smallest capsid protein, VP4, as well as the amino terminus of VP1, is on the inner surface of the capsid, partly facing the RNA. These features are shared by other picornaviruses, as has been shown by the crystal structures of rhinovirus 14 (Rossmann et al., 1985 ; Arnold & Rossmann, 1990 ), mengovirus (Luo et al., 1987 ) and foot-and-mouth disease virus (Acharya et al., 1989 ).

Although crystallographic studies show an essentially consistent picornavirus structure, several lines of evidence indicate that the solution structure is actually flexible. As early as 1971, Mandel suggested that there are two interconvertible forms of poliovirus, characterized by different isoelectric points (pI=7 or pI=4) (Mandel, 1971 ). These different forms might result from reversible exposure of parts of VP1 and VP4 that are buried in crystal structures (Chow et al., 1985 ; Roivainen et al., 1993 ; Li et al., 1994 ).

In contrast to reversible changes in free virions, binding of poliovirus to the poliovirus receptor (PVR) on the cell surface is known to induce a permanent change in the virion structure. The altered particles (A particles) sediment at 135S instead of 160S, lack VP4 and have at least the first 31 amino acids of the amino terminus of VP1 externalized (Fricks & Hogle, 1990 ). The A particles of poliovirus type 1/Sabin are capable of attaching to liposomes through the exposed amino terminus of VP1 (Fricks & Hogle, 1990 ).

A mutation at position 52 (proline to serine) of VP1 of poliovirus type 3/Sabin has been shown to destabilize the capsid and lower the temperature needed for conversion to an A particle (Mosser et al., 1994 ). There is a strongly antigenic sequence between this position and the amino-terminal region responsible for in vitro liposome binding, with a core motif of approximately 9 amino acids that is highly conserved in all enteroviruses (Roivainen et al., 1991 ; Hovi & Roivainen, 1993 ) (Table 1). In poliovirus type 3/Sabin, the stretch of 9 conserved amino acids is between positions 40 and 48, while in CAV-9 it is between positions 29 and 37. This is one of the regions reversibly externalized in free virions (Roivainen et al., 1993 ).


Table 1. Sequence alignment of amino acid positions comparable to CAV-9 amino acids 2851


We decided to investigate the role of this motif by using site-directed mutagenesis. Here we describe how a novel method was used to produce several mutant CAV-9 clones, each of which differed from the wild-type at only one amino acid position. The method used is dependent on successful site-saturation mutagenesis (Airaksinen & Hovi, 1998 ), which is then followed by single-tube cloning and transfection. Previously, when site-saturation mutagenesis has been used, cloning and transfection of the mutant viruses has been done for each clone separately. The strategy employed here drastically reduces the amount of work to be done and enables simultaneous processing of all the mutant clones. The approach used identified one amino acid position where mutations were not tolerated and gave an indication of acceptable substitutions at the three other positions studied. Strains and vectors.
A complete CAV-9 cDNA in pBS vector (pBS/CAV-9) (Chang et al., 1989 ; Hughes et al., 1995 ) was used, as shown in Fig. 1. M13mp18 vector (referred to as M13 vector) and E. coli strain TG1 were obtained from the Sculptor in vitro mutagenesis kit (Amersham).



(25K):

Fig. 1. Cloning strategy used in site-saturation mutagenesis. Mutagenesis was performed on an M13 vector and the site-saturated insert was cloned back to the genome of CAV-9. Step 1; site-directed (silent) mutagenesis to introduce additional cleavage sites for XbaI and HindIII. Step 2; ligation of the 180 bp insert to unmodified M13, followed by site-saturation mutagenesis with this construct as the template.

An adaptor was added to the polylinker of the M13 vector to include unique cleavage sites for BsiWI and BssHII. CAV-9 nucleotides 16612982 were excised by these enzymes and ligated into M13. Site-directed mutagenesis was carried out using the Sculptor in vitro mutagenesis kit (Amersham) to make four silent mutations in the CAV-9 sequence (G2444T, G2621T, C2622A and C2624A), in order to introduce unique cleavage sites for HindIII (using oligonucleotide 3869: 5' TAATAAGCTTCAAGGGGAT 3') and XbaI (using oligonucleotide 6093: 5' GACATGTGAAAAACTATCATTCTAGATCTGAGTCGACTGTGGAG 3'), and two silent mutations to block the methylation of the XbaI cleavage site (T2625A and C2626G) (using oligonucleotide 6966: 5' CTATCATTCTAGAAGTGAGTCGACTGTGG 3'). Nucleotides 16612982, including the silent mutations, were excised and ligated back into pBS/CAV-9. Nucleotides 24402619 (180 bp) from the resulting plasmid pBS/CAV-9sil were excised with HindIII and XbaI and ligated into M13. This construct (M13mp18/CAV-9180sil) was used to generate codon substitutions in the target sequence. The cloning scheme is shown in Fig. 1.

Mutagenesis and cloning.
Site-saturation mutagenesis was performed as described previously (Airaksinen & Hovi, 1998 ). Briefly, we used the M13mp18/CAV-9180sil construct as the single-stranded template for several mutagenesis reactions, using various base compositions at the mutagenic positions of the oligonucleotides in order to maximize the randomness of the target codons. The four pools of site-saturated constructs (M13mp18/CAV-9180sil/A30X, M13mp18/CAV-9180sil/L31X, M13mp18/CAV-9180sil/T32X and M13mp18/CAV-9180sil/V34X) used in this study were shown to have close to random nucleotide compositions at the target codons. The mutagenic oligonucleotides were A30X (5' CCGCGAGCGTACCTNNNCTCACTGCAGTTGAG 3'), L31X (5' GCGAGCGTACCTGCANNNACTGCAGTTGAGACAG 3'), T32X (5' GCGTACCTGCACTCNNNGCAGTTGAGACAGGG 3') and V34X (5' CCTGCACTCACTGCANNNGAGACAGGGCACAC 3'). In site-saturation, a high mutagenesis efficiency is needed to provide as many different codons as possible and to reduce the need for screening. However, efficiency of less than 100% ensures the presence of the original sequence in every mutagenized genome pool, serving as an invaluable internal control in the transfection step. When generating the above pools, the mutagenesis efficiencies were between 92 and 100%. Single-stranded DNA was purified from M13 phages by using StrataClean (Stratagene).

A single-tube cloning strategy was used to transfer each of the saturated pools from M13 phage DNA to infectious, full-length viral cDNA. Between 1200 and 2000 M13 plaques were transferred from culture plates by first incubating a Magna Lift nylon membrane (Micron Separations) on the plate for 30 min at 37 °C. The membrane was then lifted to 150 ml 2xTY medium containing E. coli TG1 and grown, with vigorous agitation, for 280 min at 37 °C. Double-stranded DNA was purified from the bacteria by using the Qiagen Midi plasmid kit.

The M13 DNA stock, containing all saturated codons, was cut with restriction enzymes XbaI and HindIII. The 180 bp fragment was purified from a 2·5% agarose gel using the Qiaex II gel extraction kit (Qiagen) and ligated back into pBS/CAV-9. Randomization of the mutagenized codons was established to be close to optimal before subcloning into pBS/CAV-9 (Airaksinen & Hovi, 1998 ). After subcloning the site-saturated inserts back into pBS/CAV-9, the sequences of 39 clones that contained mutations at codons corresponding to positions T32 and V34 were determined and 26 different codons were found in the saturated positions. From truly random pools, 33 different codons would have been expected (Airaksinen & Hovi, 1998 ) and, although some randomness may have been lost during cloning, this loss was not considered significant for the purpose of this study.

The bacterial colonies, each carrying one of the 64 possible codons at the saturated position of pBS/CAV-9, were transferred to growth medium and grown essentially as the M13 plaques above, except that LB medium containing 100 µg/ml ampicillin was used and the culture was grown overnight at 37 °C. DNA from the resulting pool of site-saturated pBS/CAV-9 clones was purified by using the Qiagen Midi plasmid kit.

Transfection and mutant virus propagation.
Site-saturated cDNA clones were linearized with ClaI and transcribed by using T7 RNA polymerase. The infectious RNA was transfected to LLC-Mk2 cells with lipofectin (Gibco-BRL). After 8 h incubation at 37 °C, the lipofectin was replaced by medium containing 0·5% carboxymethylcellulose and 10% foetal calf serum. The plates were incubated at 37 °C and plaques were picked when they appeared, after 3672 h of incubation. Each of the four different DNA pools gave rise to numerous virus plaques and 2 µl medium was collected from each of these. Virus stocks were plaque-purified and then grown to full CPE on 6-well plates with a well diameter of 35 mm. Cell-associated virus was released by three freezethaw cycles and cell debris was removed by centrifugation. These virus stocks were plaque-titrated to check the homogeneity of the plaque phenotypes of each stock. Apparently homogeneous stocks were used in further studies without further passaging.

RNA purification and PCR.
For sequencing, viral RNA was purified from virus stocks by using the Qiagen RNeasy kit. RNA was reverse transcribed to DNA using AMV reverse transcriptase (Promega). PCRs were performed either with Taq DNA polymerase (Promega) or Dynazyme (Finnzymes) with primers 7625 (5' GCGTGCAACGACTTCTCAGTAAGAATGTTGAG 3') and 4934 (5' CACAGTCGACTCAGATCTAGAATGATAGTTTTTCAC 3').

Sequencing.
Inserts in the M13 vector were sequenced with the Sequenase II sequencing kit (Amersham) and the M13 -40 primer (5' GTTTTCCCAGTCACGAC 3') included in the kit. PCR products and mutated pBS/CAV-9 constructs were sequenced by using primer 7625 with an ABI sequencer (Haartman Institute, University of Helsinki, Finland).

Variable phenotypes of mutant viruses
Positions A30, L31, T32 and V34 of the capsid protein VP1 of CAV-9 were saturated using the steps depicted in Figs 1 and 2. RNA transcribed from pools of mutated, infectious cDNA was used to transfect monolayers of LLC-Mk2 cells, which were overlaid with medium containing carboxymethylcellulose. Plaques produced by RNA transcribed from the L31-saturated cDNA pool were relatively homogeneous, while a wide range of plaque sizes was observed when the other three positions were studied. All plaques were collected, plaque-purified and grown to full CPE on 6-well plates. Homogeneity of the virus stocks was checked by plaque titration and apparently homogeneous stocks were used in further studies. RNA was extracted from 1457 virus stocks for each mutated position and the mutated region was subjected to RTPCR followed by sequencing.



(35K):

Fig. 2. Complete scheme of site-saturation mutagenesis. (A) Site-saturation mutagenesis and amplification of a short insert including the saturated codon. (B) Amplification of the viral genome with one saturated codon. (C) Expression of mutant viruses.

The mutated virus clones were found to show a range of different plaque sizes. In plaque tests, one of the mutants (A30S) appeared similar to the wild-type CAV-9, while all the others had decreased plaque sizes (Fig. 3). As a control, we used one of the viruses isolated from a site-saturated virus stock that had the wild-type nucleotide sequence. This virus and the prototype CAV-9 strain (Griggs) appeared identical.



(51K):

Fig. 3. Plaque phenotypes of unmutated CAV-9 (no mut.) and the mutant viruses.

Leucine at VP1 position 31 appears indispensable
Immediately after the mutagenesis step, in the CAV-9 inserts in M13 vectors, we found codons for 18 amino acids at position 31 from 46 sequenced inserts. Codons for isoleucine (three alternative codons) and tryptophan (one possible codon) were not found and only two leucine codons were found (CTG and TTA both once; wild-type codon CTC was not found). In striking contrast to this, when sequencing the region studied from 39 viruses originating from L31-saturated genomes, we found only three different codons at this position, all encoding leucine (CTC, CTG and CTT). The wild-type codon CTC was found 15 times, CTG twice and CTT five times. A proportion of the viruses that contained wild-type codons presumably originated from the background, unmutated DNA. In addition, 17 viruses with the wild-type L31 codon carried mutations at other positions. Three of these were at position A30 (CTG, CAG and TCA) and might thus be explained by a contamination from another mutated virus pool. However, 14 mutations were at position P29, which was not intentionally mutated in this study, and all of these had the codon CCC in place of the wild-type CCT, conserving the amino acid sequence. It seems that the unexpected mutations at codon P29 did not originate from the mutagenesis reaction since, when sequencing the 46 inserts in M13 (see above), there were no unexpected mutations. Furthermore, if there was heterogeneity in the oligonucleotide at the third base of the P29 codon, some cases would be expected with mutations at both P29 and L31 codons. Misannealing can be ruled out for the same reason. The fact that the amplicons sequenced were identical to each other and, with the exception of codon 29, identical to the wild-type sequence shows that the virus is CAV-9 in all cases. We thus suggest that the unexpected sequences represent a CAV-9 contamination that may have occurred during the propagation of the stock or in the RTPCR step.

The plaque sizes of individual viruses derived from the L31-saturated genomes showed a similarly low degree of variation as that of the unmutated parental virus. To study whether some of the plaques had contained an amino acid mutation that later reverted to wild-type during culturing, we purified RNA directly from 15 of the smallest plaques collected earlier from the transfection plates, performed RTPCR and sequenced the amplicons. All sequences were the same as those already determined from the corresponding stocks grown to full CPE.

Accepted range of amino acids in viable mutants
In this study, the number of virus plaques collected was not large enough to determine the full range of amino acids tolerated at each position. However, the observations reveal some trends in acceptability. Most notably, we found mutations at all amino acid positions that show some variation among enteroviruses, but not at position 31, which is leucine in all enteroviruses sequenced to date.

Alanine 30.
In addition to alanine (GCA), we found six different amino acids at this position: asparagine (AAC), cysteine (TGC), glutamine (CAG), glycine (GGC), leucine (CTC, CTG) and serine (TCA). As the substitutive amino acids have highly variable characteristics, and they were found by sequencing only 14 viruses, it seems that this position can tolerate a wide variety of substitutions. Though viable, most of the mutant viruses showed significantly reduced plaque sizes when compared with the wild-type virus. In the enterovirus sequences, alanine is clearly the most common amino acid at this position (69 of 79 sequences in Table 1). However, several other amino acids are found. These include asparagine (echoviruses 1, 4 and 8), methionine (echovirus 13), proline (coxsackievirus A12), serine (enteroviruses 68 and 70), threonine (poliovirus 3) and valine (coxsackievirus B2 and echovirus 21).

Threonine 32.
We were able to find only histidine (CAC) and serine (TCG, TCT) substitutions at this position. While threonine is polar, histidine and serine have intermediate hydrophobicity values. Only polar amino acids (threonine, glutamine or asparagine) are found in this position in enteroviruses sequenced to date.

Valine 34.
Four substitutions were found, alanine (GCA, GCC and GCT), cysteine (TGT), isoleucine (ATT) and serine (AGC), in addition to valine (GTA and GTC). A wild-type valine codon (GTT) was not found. Valine, alanine and isoleucine are hydrophobic, while cysteine and serine have intermediate hydrophobicity values. Only alanine and valine are found at this position in published enterovirus sequences.

Amino acid sequence alignment and comparison
We compared the sequences of all enteroviruses found in the Picornavirus sequence database (http://www.iah.bbsrc.ac.uk/virus/Picornaviridae/SequenceDatabase/entero.htm) to study the uniformity of the hydrophobicity profiles. We used amino acids 1882 of VP1 of CAV-9 and all the enterovirus sequences alignable with the CAV-9 sequence in the alignment (part of the alignment is shown in Table 1). This part of the enterovirus sequences was directly alignable without gaps or insertions. Individual amino acids were given a hydrophobicity value using the PRIFT scale, which is optimized for detecting amphipathicity (Cornette et al., 1987 ). We found that the mutagenized motif belongs to a section of 24 amino acids that shows a striking, periodic hydrophobicity profile that is conserved in all enteroviruses. In this section, between amino acids 28 and 51 in CAV-9, there are both hydrophobicity and hydrophilicity peaks with intervals of approximately three residues (Fig. 4). A profile like this is commonly associated with an amphipathic protein secondary structure (Eisenberg et al., 1984 ). We found no substitutions in the viable mutants that would change the hydrophobicity of the mutated amino acid from polar to nonpolar, or vice versa (Table 2).



(48K):

Fig. 4. Diagram of the putative amphipathic region between residues 28 and 51 of VP1, assuming angular rotation of 125° per residue. The one-letter amino acid code is used and numbers show the amino acid positions in the CAV-9 sequence. The last residue in this stretch is arginine, which in many hydrophobicity scales is polar. In amphipathic protein structures, however, it is primarily found on the same side as hydrophobic amino acids, and it is therefore given an empirically determined, hydrophobic value for detection of amphipathicity (Cornette et al., 1987 ). Polar amino acids: D, K, N, P, T and E (hydrophobicity values -3·08 to -1·81). Nonpolar amino acids: L, I, V, P, M, C, Y, R and W (hydrophobicity values 5·66 to 1·04). Intermediate amino acids: N, S, G, A and H (hydrophobicity values -0·46 to 0·46). Filled circles, polar; unfilled circles, nonpolar; shaded circles, intermediate.

Table 2. Summary of the mutagenesis data and comparison with amino acids found at corresponding positions in other enterovirus sequences

We have used a new combination of methodologies that enabled us to use a `single-tube' procedure to saturate an amino acid position in a virus protein. We have shown that an evolutionarily conserved amino acid motif in the VP1 protein of CAV-9 cannot be mutated without affecting virus growth. Furthermore, none of the viable mutants contained a substitution that changed the amino acid from polar to nonpolar or from nonpolar to polar. In all cases, the substitutive amino acids found among the mutant progeny seemed to reflect the range of amino acids found at corresponding positions in various enterovirus sequences (Table 2).

All the viruses isolated that consistently showed a small-plaque phenotype had an amino acid mutation at the expected position, and no additional mutations were found in the amplicons sequenced. This strongly suggests that the defects observed in virus growth were due to amino acid mutations at the specified positions.

The experimental approach taken ensured that the four codons that were saturated in this study had each been replaced by all possible codons, as we have shown earlier (Airaksinen & Hovi, 1998 ). Presumably, more genomes were screened for viability than were recovered in a viable form. In particular, the failure to find any amino acid substitutions at position L31, despite finding viruses having one of three different leucine codons at that position, strongly suggests that there would have also been transcripts with codons for substitutive amino acids at that position in the mutated pool but that when these were transfected, such transcripts were unable to produce a plaque. In the other three saturated positions, we found substitutive amino acids that retained the viability of the virus but decreased plaque size to a variable extent.

When we saturated position L31 and sequenced the virus obtained from plaques, we found only different codons for leucine. We did not verify the absolute requirement for L31 by simple substitution mutagenesis, and we therefore cannot rule out the possibility that some amino acids, e.g. isoleucine, could in fact replace L31. On the other hand, leucine is conserved in all enterovirus sequences at the position corresponding to L31 in CAV-9. Due to the verified randomness of the mutagenized DNA stocks, the number of unmutated sequences found in the saturated virus stocks can be used as an approximate measure of the proportion of `dead' viral sequences. As the `dead' sequences cannot be seen in plaque tests, more background unmutated sequences are likely to be found if mutations are not allowed at the target position. At positions 30, 32 and 34, fewer than 30% of the sequences were wild-type, while 68% were wild-type at position L31.

The highly hydrophobic nature of the motif, together with its capability for transient externalization, suggests that it could have a function in virushost cell interactions. One current hypothesis assumes that the amino terminus of VP1, together with the capsid protein VP4 and the myristate attached to it, forms a pore, allowing the viral RNA or the virus itself to enter the cytoplasm (Kirkegaard, 1990 ). The fact that we were able to mutate three of the four amino acids, drastically in the case of A30, suggests that the putative function of this motif allows some structural flexibility. The motif is known to be reversibly exposed in solution (Roivainen et al., 1993 ) and, in poliovirus, is probably also involved in the PVR-induced gross rearrangement of virus structure. It therefore needs to fit well into its structural position inside the capsid, in addition to maintaining any properties required for its correct structural rearrangement. It would be expected that these restraints alone would limit the range of acceptable amino acids in this region.

In the enterovirus sequences found in the Picornavirus sequence database, positions between residues 28 and 40 (numbers from the CAV-9 sequence) are relatively conserved, with five positions being identical (P29, L31, A33, E35 and G37). The hydrophobicity profile seems to be particularly well conserved, even at positions where multiple different amino acids are seen. Notably, position 32 seems to allow only polar but uncharged residues (threonine, glutamine or asparagine), while position 34 has only small hydrophobic residues (alanine or valine). This, together with the observed decrease in plaque size in the mutants described here, suggests that although a wider range of different amino acids was tolerated among the mutant viruses, these mutations would not become fixed in natural populations. We found that the motif studied is part of a section of approximately 24 amino acid positions where a periodic hydrophobicity profile seems to be conserved, regardless of the low degree of amino acid conservation at several positions. In the crystal structure of coxsackievirus B3, which is closely related to CAV-9, the only ordered structures in this region are two short α-helices at positions 3436 and 4446. As the motif is buried in the crystal structures, and it is known to be rearranged and externalized during uncoating, it is of interest to speculate about the possible structural features that the motif might have when not buried in the capsid. The hydrophobicity peak interval in this region is about three amino acids and, assuming that this reflects amphipathicity, it suggests an angular rotation of approximately 120 to 125° per residue. This is most consistent with a rare secondary structure, the 310 helix (optimum of 120° per residue), but allows formation of both α-helix and ß-strand (optima of 100 and 160°, respectively, per residue) (West & Hecht, 1995 ). This section, however, contains conserved prolines at positions 29 and 44 and, in polioviruses, an additional proline at position 41 (all residue numbers from CAV-9). Due to the strong tendency of this amino acid to break α-helices and ß-strands, any longer stretches of these secondary structures could only be expected between amino acids 29 and 41. On the other hand, 310 helices are usually very short, with a mean length of 3·3 residues and rarely containing more than 10 residues (Toniolo & Benedetti, 1991 ). If there is a regular amphipathic structure involved here, it thus seems to be centred between amino acids 29 and 41. This is also the region where the periodic hydrophobicity pattern is most conserved.

Site-saturation mutagenesis has rarely been used in virus research, despite its particular applicability to virological studies. When site-saturation mutagenesis has been used in previous studies, the resulting clones have been treated separately, which is unnecessarily laborious compared with the single-tube cloning and transfection strategy that was used in this work. The approach used demonstrates three notable features of site-saturation mutagenesis that make it superior to simple substitution mutagenesis, particularly given that it requires no additional work. Firstly, as demonstrated by mutagenesis of L31, it can readily show that a particular amino acid cannot be mutated. If simple substitution were to be used, in practice only a limited range of amino acids could be tested for their ability to substitute the amino acid of interest, and even this would require more work than the procedure employed here. Secondly, as demonstrated by mutagenesis of T32 and V34, site-saturation allows us to see directly the nature of an amino acid that has to be maintained. The only acceptable amino acids were similar to the original ones. Thirdly, as demonstrated by mutagenesis of A30, we could show that a wide variety of amino acids can substitute the one being studied and that the resulting mutant viruses show a range of phenotypes. The approach should therefore prove useful in a number of situations where conserved amino acid motifs are studied.

References

Acharya, R., Fry, E., Stuart, D., Fox, G., Rowlands, D. & Brown, F. (1989). The three-dimensional structure of foot-and-mouth disease virus at 2·9 resolution. Nature 337, 709-716.[Medline]

Airaksinen, A. & Hovi, T. (1998). Modified base compositions at degenerate positions of a mutagenic oligonucleotide enhance randomness in site-saturation mutagenesis. Nucleic Acids Research 26, 576-581.[Abstract/Free Full Text]

Arnold, E. & Rossmann, M. G. (1990). Analysis of the structure of a common cold virus, human rhinovirus 14, refined at a resolution of 3·0 . Journal of Molecular Biology 211, 763-801.[Medline]

Chang, K. H., Auvinen, P., Hyypiä, T. & Stanway, G. (1989). The nucleotide sequence of coxsackievirus A9; implications for receptor binding and enterovirus classification. Journal of General Virology 70, 3269-3280.[Abstract/Free Full Text]

Chow, M., Yabrov, R., Bittle, J., Hogle, J. & Baltimore, D. (1985). Synthetic peptides from four separate regions of the poliovirus type 1 capsid protein VP1 induce neutralizing antibodies. Proceedings of the National Academy of Sciences, USA 82, 910-914.[Abstract/Free Full Text]

Cornette, J. L., Cease, K. B., Margalit, H., Spouge, J. L., Berzofsky, J. A. & DeLisi, C. (1987). Hydrophobicity scales and computational techniques for detecting amphipathic structures in proteins. Journal of Molecular Biology 195, 659-685.[Medline]

Eisenberg, D., Weiss, R. M. & Terwilliger, T. C. (1984). The hydrophobic moment detects periodicity in protein hydrophobicity. Proceedings of the National Academy of Sciences, USA 81, 140-144.[Abstract/Free Full Text]

Filman, D. J., Syed, R., Chow, M., Macadam, A. J., Minor, P. D. & Hogle, J. M. (1989). Structural factors that control conformational transitions and serotype specificity in type 3 poliovirus. EMBO Journal 8, 1567-1579.[Medline]

Fricks, C. E. & Hogle, J. M. (1990). Cell-induced conformational change in poliovirus: externalization of the amino terminus of VP1 is responsible for liposome binding. Journal of Virology 64, 1934-1945.[Abstract/Free Full Text]

Hogle, J. M., Chow, M. & Filman, D. J. (1985). Three-dimensional structure of poliovirus at 2·9 resolution. Science 229, 1358-1365.[Abstract/Free Full Text]

Hovi, T. & Roivainen, M. (1993). Peptide antisera targeted to a conserved sequence in poliovirus capsid protein VP1 cross-react widely with members of the genus Enterovirus. Journal of Clinical Microbiology 31, 1083-1087.[Abstract/Free Full Text]

Hughes, P. J., Horsnell, C., Hyypiä, T. & Stanway, G. (1995). The coxsackievirus A9 RGD motif is not essential for virus viability. Journal of Virology 69, 8035-8040.[Abstract]

Kirkegaard, K. (1990). Mutations in VP1 of poliovirus specifically affect both encapsidation and release of viral RNA. Journal of Virology 64, 195-206.[Abstract/Free Full Text]

Li, Q., Yafal, A. G., Lee, Y. M., Hogle, J. & Chow, M. (1994). Poliovirus neutralization by antibodies to internal epitopes of VP4 and VP1 results from reversible exposure of these sequences at physiological temperature. Journal of Virology 68, 3965-3970.[Abstract/Free Full Text]

Luo, M., Vriend, G., Kamer, G., Minor, I., Arnold, E., Rossmann, M. G., Boege, U., Scraba, D. G., Duke, G. M. & Palmenberg, A. C. (1987). The atomic structure of Mengo virus at 3·0 resolution. Science 235, 182-191.[Abstract/Free Full Text]

Mandel, B. (1971). Characterization of type 1 poliovirus by electrophoretic analysis. Virology 44, 554-568.[Medline]

Mosser, A. G., Sgro, J.-Y. & Rueckert, R. R. (1994). Distribution of drug resistance mutations in type 3 poliovirus identifies three regions involved in uncoating functions. Journal of Virology 68, 8193-8201.[Abstract/Free Full Text]

Muckelbauer, J. K., Kremer, M., Minor, I., Diana, G., Dutko, F. J., Groarke, J., Pevear, D. C. & Rossmann, M. G. (1995). The structure of coxsackievirus B3 at 3·5 resolution. Structure 3, 653-667.[Medline]

Roivainen, M., Närvänen, A., Korkolainen, M., Huhtala, M.-L. & Hovi, T. (1991). Antigenic regions of poliovirus type 3/Sabin capsid proteins recognized by human sera in the peptide scanning technique. Virology 180, 99-107.[Medline]

Roivainen, M., Piirainen, L., Rysä, T., Närvänen, A. & Hovi, T. (1993). An immunodominant N-terminal region of VP1 protein of poliovirion that is buried in crystal structure can be exposed in solution. Virology 195, 762-765.[Medline]

Rossmann, M. G., Arnold, E., Erickson, J. W., Frankenberger, E. A., Griffith, J. P., Hecht, H.-J., Johnson, J. E., Kamer, G., Luo, M., Mosser, A. G., Rueckert, R. R., Sherry, B. & Vriend, G. (1985). Structure of a human common cold virus and functional relationship to other picornaviruses. Nature 317, 145-153.[Medline]

Smyth, M., Tate, J., Hoey, E., Lyons, C., Martin, S. & Stuart, D. (1995). Implications for viral uncoating from the structure of bovine enterovirus. Nature Structural Biology 2, 224-231.[Medline]

Toniolo, C. & Benedetti, E. (1991). The polypeptide 310-helix. Trends in Biochemical Sciences 16, 350-353.[Medline]

West, M. W. & Hecht, M. H. (1995). Binary patterning of polar and nonpolar amino acids in the sequences and structures of native proteins. Protein Science 4, 2032-2039.[Abstract]

Received 5 January 1999; accepted 27 April 1999.