Abstract
Rabies viruses and classical vaccine strains are classed as genotype (GT) 1, whereas rabies-related viruses belong to GT 27, the most common members being Lagos bat virus (GT 2), Mokola virus (Mok) (GT 3), Duvenhage virus (GT 4), European bat lyssavirus (EBL) 1 (GT 5), EBL2 (GT 6) and Australian bat lyssavirus (GT 7) (Bourhy et al., 1993 ; Gould et al., 1998 ). All of these viruses cause a fatal form of encephalomyelitis and the rabies vaccines currently available only provide protection against GT 1, 6 and 7. These vaccines are not effective against GT 2, 3 or 4, and the extent of protection against GT 5 depends mainly on the vaccine strain (Fekadu et al., 1988 ; Jallet et al., 1999 ). Lyssavirus glycoprotein (G) is involved in virus-neutralizing antibody (VNAb) induction and protection. Structurally and immunologically, the G molecule consists of two parts separated by a flexible hinge in the linear region (aa 253275) (Bahloul et al., 1998 ; Benmansour et al., 1991 ; Dietzschold et al., 1990 ; Jallet et al., 1999 ): (i) the N-terminal half (the `site II' region) (aa 1250) contains antigenic site II; and (ii) the C-terminal half (the `site III' region) contains antigenic site III and the transmembrane and cytoplasmic domains. This has allowed the construction of several chimeric G genes with various genotypes of lyssavirus and the demonstration that DNA-based immunization with chimeric GEBL1PV and GMokPV plasmids [site II region of EBL1 or Mok linked to the site III region of Pasteur rabies virus (PV) (GT 1)] induces protection against challenge with most lyssavirus genotypes (Bahloul et al., 1998 ; Jallet et al., 1999 ).
In the present paper, we investigate the effectiveness of lyssavirus G further as a carrier for foreign antigens in multivalent vaccine prototypes. DNA coding fragments for epitopes mimicking minimal antigens that induce both humoral and cellular immune responses were fused to those encoding the truncated PV G (site III region: GPVIII) or inserted into the hinge region of the full-length chimeric EBL1PV G. The inserted sequences corresponded to various combinations of two well-characterized epitopes: the C3 B cell epitope of the poliovirus type 1 capsid VP1 protein and the CTL epitope of the lymphocytic choriomeningitis virus (LCMV) nucleoprotein. The C3 poliovirus epitope induces the synthesis of VNAb (Delpeyroux et al., 1990 ) and the LCMV epitope is involved in both the induction of CTL and protection against LCMV challenge in H2d mice (Aichele et al., 1990 ). Combination of these foreign epitopes with the truncated G induced weak immunological responses in mice, whereas their insertion into the chimeric G induced humoral and cellular immune responses against both the parental lyssaviruses and poliovirus and gave partial protection against LCMV. These results have implications for the development of multivalent vaccines by using fragments of genes encoding antigens involved in protection against various animal diseases, including zoonoses and lyssavirus encephalomyelitis.
Mice, cells, viruses and antigens.Seven-week-old female H-2d BALB/c mice were purchased from the `Centre d'Elevage et de Recherche' Janvier (Legenest St Isle, France).
BHK-21 cells were grown in Eagle's minimal essential medium (MEM) containing 5% foetal bovine serum (FBS) and 5% newborn calf serum (Perrin, 1996 ). Neuroblastoma cells (Neuro-2a) were grown in MEM containing 8% FBS. The interleukin-2 (IL-2)-dependent CTL line (CTLL) was cultured as described previously (Perrin et al., 1988 ).
Fixed rabies PV-Paris/BHK-21 (Pasteur virus), EBL1b and LCMV strains were maintained by serial passage in BHK-21 cells as described previously (Perrin, 1996 ;Perrin et al., 1996 ; Saron et al., 1997 ). EBL1b (strain 8916FRA) was derived from a French bat isolate (Amengual et al., 1997 ). The LCMV strain Arm/53b was kindly provided by M. Oldstone and M. McChesney (Scripps Clinic, La Jolla, CA, USA).
ß-Propiolactone-inactivated, purified lyssaviruses (IPLV) were prepared as described elsewhere (Perrin, 1996 ).
Insertion of DNA encoding foreign B and T cell epitopes into truncated or chimeric G genes.
Previously described truncated (GPVIII) and chimeric (GEBL1-PV) lyssavirus G genes (Jallet et al., 1999 ) were introduced into the eukaryotic expression vector pCIneo (Promega), which was then propagated and amplified in Escherichia coli strain DH5α by standard protocols (Maniatis et al., 1982 ).
DNA fragments encoding foreign B and/or CD8+ T cell epitopes were inserted into the EcoRI restriction site (located at position 253) of the truncated or chimeric lyssavirus G gene in the area encoding the hinge region (aa 253275). The B cell epitope (B) corresponded to fragment C3 (aa 93103: DNPASTTNKDK) of the poliovirus VP1 protein. The T cell epitope (t) corresponded to aa 119127 (PQASGVYMG) of the LCMV nucleoprotein. A larger form of this epitope (T), corresponding to aa 117132 (ERPQASGVYMGNLTAQ), was also inserted. The sequence encoding the LCMV t epitope was used in the p(B-t)2-GPVIII and pGEBL1-(B-t)2-PV chimeras, whereas the sequence encoding the larger, T, epitope was used in pGEBL1-(T)-PV, pGEBL1-(T-B)-PV and pGEBL1-(B-T)-PV. The different plasmids used (see Fig. 1) were obtained as follows.
|
The plasmids p(B-t)2-GPVIII and pGEBL1-(B-t)2-PV were generated by a two-step insertion of a synthetic adaptor into the unique EcoRI restriction sites of pGPVIII and pGEBL1-PV, respectively. This adaptor was produced by using 200 pmol of each of the following primers: B-tp1 (5' AATTCAGATAACCCGGCGTCGACCACTAACAAGGATAAGCTGTTCGCAGTGCCTCAGGCCTCTGGTGTGTATATGGGT 3') and B-tp2 (5' AATTACCCATATACACACCAGAGGCCTGAGGCACTGCGAACAGCTTATCCTTGTTAGTGGTCGACGCCGGGTTATCTG 3').
For pGEBL1-(B)-PV and pGEBL1-(T)-PV, the synthetic adaptors used for the insertion were, respectively, for B: Bp3 (5' AATTTGGATAACCCGGCGTCGACCACTAACAA 3') and Bp4 (5' AATTCTTATCCTTGTTAGTGGTCGACGCCGGG 3'), and for T: Tp5 (5' AATTTGGAGAGACCTCAGGCCTCTGGTGTGTATATGGGTAATCTTACGGCCCAG 3') and CTLp6 (5' AATTCTGGGCCGTAAGATTACCCATATACACACCAGAGGCCTGAGGTCTCTCCA 3').
Plasmids pGEBL1-(B-T)-PV and pGEBL1-(T-B)-PV were constructed by inserting DNA fragments encoding the T and B epitopes into pGEBL1-(B)-PV and pGEBL1-(T)-PV, respectively, under the same conditions.
The identity of each construct was confirmed by automatic sequencing using a dye termination reaction on an ABI 377 sequencer (Perkin-Elmer).
Transient expression experiments.
The transient expression of G and related foreign antigens from plasmids was tested by transfecting Neuro-2a cells by using FuGENE 6 transfection reagent, according to the manufacturer's instructions (Boehringer Mannheim). Each well of a Nunc Labtek cell culture chamber (Life Technologies) was inoculated with 3x104 cells (in MEM, 10% FBS) and incubated for 24 h at 37 °C in a humidified atmosphere containing 7·5% CO2. The plate was washed with MEM without FBS and the wells were filled with 100 µl transfection solution (0·5 µg plasmid, 1·5 µl FuGENE 6 transfection reagent and 98·5 µl serum-free medium). The plate was incubated for 18 h at 37 °C in the presence of 7·5% CO2. MEM containing 5% FBS (200 µl) was then added to each well and the plate was incubated for 24 h at 37 °C in the presence of 7·5% CO2. Transient expression was then assessed by indirect immunofluorescence.
Immunofluorescence microscopy.
Two mouse MAbs directed against rabies PV G (D1 MAb) or poliovirus type 1 capsid VP1 protein (C3 MAb) were used for antigen staining. The D1 MAb recognizes site III of native but not SDS-treated G and the C3 MAb recognizes the 93103 region of the poliovirus type 1 capsid VP1 protein. A neutralizing polyclonal antibody (PAb) from rabbit directed against native poliovirus type 1 was also used.
Transient expression was assessed after fixing of cells in 3% paraformaldehyde (Sigma) (20 min incubation at room temperature) without permeabilization. Fixed cells were incubated for 1 h at room temperature with MAb or PAb. They were then washed with PBS and incubated for 1 h at room temperature with goat anti-mouse or anti-rabbit FITC-conjugated secondary antibody (Nordic Immunology Labs). Cells were washed with PBS, mounted in Mowiol (Sigma) and examined with a Leica inverted fluorescence microscope.
Injection of plasmids into mice.
BALB/c mice were anaesthetized with pentobarbital (30 mg/kg). Fifty µg plasmid (diluted in PBS) was injected into each anterior tibialis muscle. For studies of protection against LCMV, mice received 3·5 µg cardiotoxin (Latoxan A. P.) in each leg 4 days before immunization to degenerate the muscle.
IL-2 release assay.
To test the activity of Th cells induced by plasmids, mouse splenocytes were stimulated in vitro in order to activate IL-2-producing cells. Spleens were removed from naive or plasmid-injected mice 14 days after injection. Splenocytes (1 ml aliquots, each containing 6x106 cells) were stimulated with 0·5 µg lyssavirus antigen (IPLV-PV or IPLV-EBL1) or 5 µg concanavalin A (ConA; Miles) (Joffret et al., 1991 ). The IL-2 produced in the supernatant of splenocyte cultures was titrated by bioassay in CTLL, as described previously (Perrin et al., 1988 ). CTLL cell proliferation was determined in triplicate, based on the uptake of [3H]thymidine (New England Nuclear). Under these conditions, the cells stimulated were mostly CD4+ Th cells, which produced IL-2 (Joffret et al., 1991 ).
Antibody assays.
For serum antibody assay, blood was collected on various days by retroorbital puncture under anaesthesia. Anti-rabies virus IgG was titrated by ELISA with microplates coated with purified rabies virus G (Perrin et al., 1985 , 1986 ) and rabbit anti-mouse IgG isotype conjugated with peroxidase as the secondary antibody (Nordic Immunology Labs). The titre corresponded to the reciprocal dilution of the serum sample giving an absorbance twice that of 1:20-diluted serum from PBS-injected mice. Lyssavirus-neutralizing antibodies were titrated by the rapid fluorescent focus inhibition test (RFFIT) (Smith et al., 1996 ), with modifications described previously (Perrin et al., 1986 ), using infected (PV or EBL1) cells. Anti-PV neutralizing antibody titres are expressed in IU/ml using the 2nd International Standard (Statens Seruminstitut, Copenhagen, Denmark) as the reference. For the determination of anti-EBL1 neutralizing antibody titres, we assumed that the serum dilution causing 50% inhibition of the fluorescent focus rate had the same VNAb titre as the reference assayed against PV.
Production of antibodies against poliovirus type 1 was assayed by ELISA as described previously (Delpeyroux et al., 1990 ) using microplates coated with a synthetic peptide. This peptide consisted of a trimer of aa 93103 of VP1 and rabbit anti-mouse IgG isotype conjugated with peroxidase as the secondary antibody (Nordic Immunology Laboratories). The titre corresponded to the reciprocal dilution of the serum sample giving an absorbance twice that of 1:20-diluted serum from PBS-injected mice.
Protection test.
Two groups of 10 mice with degenerated muscle were injected with either plasmid or PBS. They were then challenged intracerebrally (i.c.) on day 21 with 101·5 p.f.u. LCMV diluted in 30 µl. Mice were killed 21 days after the challenge to test virus clearance in kidneys by RTPCR (Martins et al., 1995 ).
Plasmids containing foreign epitopes encoding sequences fused to the truncated (pGPVIII) or chimeric (pGEBL1-PV) lyssavirus G genes were tested for their ability to transiently transfect Neuro-2a cells. The truncated plasmids exhibited indirect immunofluorescence staining (in the cytoplasm) only after permeabilization, as reported previously for pGPVIII (Jallet et al., 1999 ). With the exception of pGEBL1-(B-T)-PV, transfection with the chimeric plasmids resulted in the expression of poliovirus- and lyssavirus-related antigens at the cell membrane of non-permeabilized cells, similar to that seen in response to transfection with native pGEBL1-PV (Table 1). Fig. 2 illustrates the results obtained after transfection with the chimeric pGEBL1-(B-t)2-PV. The rabies virus G site III region was recognized by PV D1 MAb (Fig. 2A) and the poliovirus insert was recognized by the C3 MAb (Fig. 2B) and by the anti-poliovirus type 1 PAb (Fig. 2C). No staining was observed with the same antibodies in cells transfected with pCIneo (Fig. 2D). This clearly shows that the chimeric G expressed either the native poliovirus B cell epitope alone or in association with the LCMV CD8+ T cell epitope at the cell surface and that synthesis of lyssavirus G protein was maintained.
Table 1. Detection of lyssavirus G and poliovirus epitopes in Neuro-2a cells by indirect immunofluorescence
|
Immunogenicity of a foreign B cell epitope carried by truncated G
No IL-2 was produced by splenocytes stimulated in vitro by IPLV-PV 14 days after injection (Fig. 3): injection of the truncated pGPVIII plasmid into mice did not induce IL-2-producing cells. In contrast, a significant amount of IL-2 production was detected following p(B-t)2-GPVIII injection and in vitro stimulation with IPLV-PV (Fig. 3). This shows that fusion of the foreign epitopes to GPVIII significantly increases the production of Th cells that are directed to the site III region of the rabies virus G.
|
Similarly, although pGPVIII did not induce anti-rabies virus antibody production, p(B-t)2-GPVIII induced the synthesis of significant levels of antibodies directed against both rabies virus G and poliovirus peptide (Fig. 4). However, VNAb directed against PV were not observed (data not shown). Thus, the fusion of foreign epitopes to the truncated G not only significantly increased the production of antibodies directed against the site III region of PV G, but also led to antibody production against the poliovirus B cell epitope.
|
The induction of antibodies directed against the poliovirus C3 peptide by p(B-t)2-GPVIII was also tested after priming with either pGPVIII or p(B-t)2-GPVIII itself (Fig. 5). When p(B-t)2-GPVIII was injected without priming and tested 13 days [PBS injected on day 0, p(B-t)2-GPVIII injected on day 26] or 39 days later [p(B-t)2-GPVIII injected on day 0, PBS injected on day 26], the anti-peptide antibody titres were 65 and 80, respectively. However, when priming was performed with pGPVIII [pGPVIII injected on day 0, p(B-t)2-GPVIII injected on day 26] or with p(B-t)2-GPVIII [p(B-t)2-GPVIII injected on day 0, p(B-t)2-GPVIII injected on day 14] the titres were 280 and 600, respectively. This clearly demonstrates that both types of priming increased the production of antibodies directed against the poliovirus peptide.
|
In summary, the fusion of the foreign B and CD8+ T cell epitopes with the truncated G induced the production of both Th cells and antibodies directed against rabies and polioviruses.
Immunogenicity of the foreign B cell epitope carried by the chimeric G
IL-2-producing cells that had been induced by the chimeric pGEBL1-PV plasmid carrying various combinations of the two foreign epitopes were tested after mice splenocyte stimulation in vitro with inactivated and purified PV or EBL1 (Fig. 6). With the exception of pGEBL1-(B-T)-PV and pCIneo, which were ineffective, all plasmids induced IL-2 production at a level similar to that induced by the pGEBL1-PV plasmid. The insertion of 49 foreign amino acid residues in the chimeric G [pGEBL1-(B-t)2-PV] did not decrease IL-2 production significantly. A positional effect was observed for pGEBL1-(B-T)-PV and pGEBL1-(T-B)-PV; the insertion of the B epitope immediately behind the EBL1 sequence reduced the induction of Th cells stimulated by lyssavirus G. This effect was less pronounced with pGEBL1-(B-t)2-PV. Therefore, it seems that, when the B cell epitope does not follow the EBL1 sequence, the chimeric G can carry foreign B and CD8+ T cell epitopes with no negative effect on its ability to induce IL-2-producing cells.
|
The insertion of foreign epitopes into pGEBL1-PV was also studied to assess the induction of antibodies against poliovirus peptide and its effect on VNAb directed against PV and EBL1 (Table 2). All plasmids containing the B cell epitope induced the production of antibodies against poliovirus. Again, if the B cell epitope immediately followed the EBL1 sequence [pGEBL1-(B-t)-PV and pGEBL1-(B-T)-PV], the insertion of foreign epitopes decreased anti-lyssavirus VNAb production, whereas it remained at an acceptable level with pGEBL1-(B-t)2-PV. In contrast, high levels of VNAb were observed in animals injected with pGEBL1-(T)-PV or pGEBL1-(T-B)-PV. It can be also observed that, if the B cell epitope did not follow the EBL1 sequence immediately, a parallelism was observed between Th cell activation (IL-2 production) and antibody production (Table 2 and Fig. 6). In contrast, if the B cell epitope followed the EBL1 sequence immediately, IL-2-producing cells were induced [with pEBL1-(B-t)-PV] or were not induced (with other plasmids).
Table 2. Antibody production induced by chimeric pGEBL1-PV plasmids carrying various combinations of foreign B and CTL epitopes
Thus, the chimeric G carried and expressed in vivo both poliovirus and lyssavirus neutralizing B cell epitopes. However, the presence of the poliovirus B cell epitope located immediately behind the EBL1 sequence [except for the (B-t)2 insertion] reduced the immunogenicity of both the site II and site III regions of the chimeric lyssavirus G.
Protection against a lethal challenge of LCMV
As the CTL epitope is involved in protection against LCMV (Battegay et al., 1992 ), several truncated and chimeric G genes encoding it were tested for their protective activity in mice. While pCIneo, pGEBL1-(T)-PV and pGEBL1-(B-T)-PV provided no protection, p(B-t)2-GPVIII and pGEBL1-(B-t)2-PV provided 20 and 13% protection, respectively, against a lethal challenge with LCMV performed on day 21 [p(B-t)2-GPVIII] or 42 [EBL1-p(B-t)2-GPVIII]. However, the chimeric pGEBL1-(T-B)-PV provided 70% protection. Under these conditions, the surviving animals eliminated the virus completely 21 days after infection (data not shown) when monitored by RTPCR (Park et al., 1997 ). Therefore, for some constructs, the chimeric G allowed correct presentation of the LCMV-protective CTL sequences.
In this paper, we investigated the development of multivalent DNA vaccine prototypes. We have shown recently (Bahloul et al., 1998 ; Jallet et al., 1999 ) that (i) plasmids encoding lyssavirus G induce both humoral and cell-mediated immune responses including CTL; and (ii) chimeras of different lyssavirus genotypes can broaden the spectrum of protection against lyssaviruses. In the present work, a truncated rabies virus G (PVIII) and a chimeric lyssavirus G (EBL1-PV) were used to carry and express well-characterized non-lyssavirus B and CD8+ T cell epitopes: the C3 epitope of poliovirus type 1 VP1 protein (involved in VNAb induction) and the CD8+ T cell epitope of LCMV nucleoprotein (involved in protection of the H2d mouse).
The truncated gene encoding the dimer of foreign epitopes, p(B-t)2-GPVII, induced in vivo anti-poliovirus peptide antibody production, indicating that the B cell epitope was expressed. Anti-rabies virus antibodies were also detected 14 days after injection of the plasmid into mice, while 21 days were required to observe a weak induction with pGPVIII. This induction only occurred if IL-2 was injected at the same time (Jallet et al., 1999 ). However, anti-rabies virus antibodies were not neutralizing and the titres against rabies and polioviruses remained low. The protection induced against LCMV was weak. Nevertheless, it appears that the fusion of the foreign (B-t)2 epitopes was clearly beneficial to the immunological properties of GPVIII, and vice versa. Further evidence for this was also provided by the significant increase of IL-2-producing cells that was observed after injection of mice with p(B-t)2-GPVIII and following splenocyte stimulation in vitro by IPLV-PV. Finally, PVIII alone was able to prime (B-t)2-GPVIII, inducing a significant increase in anti-poliovirus peptide antibody production. Thus, it appears that the Th cells that were induced by GPVIII alone, although in limited amounts, provided a helper effect to antibody-producing B cells directed against the foreign B epitope. Taken together, these results indicate that the truncated G is immunologically potent and could be used to carry larger antigenic fragments.
The chimeric gene encoding foreign epitopes was found to be efficient in inducing antibody and Th cell production and in providing protection against LCMV challenge. However, inserted sequences sometimes had a negative effect on the biological and immunological response of the pGEBL1-PV chimera: (i) pGEBL1-(B-T)-PV was expressed in the cell cytoplasm and induced poliovirus antibody production but was unable to induce Th cells and antibodies against lyssaviruses, or to provide protection against LCMV; (ii) pGEBL1-(B-t)-PV was expressed at the cell membrane, but induced weak production of antibody and provided minimal protection, whereas Th cell production was maintained; and (iii) the other combinations allowed expression at the cell membrane, induced the production of antibodies and Th cells and provided protection against LCMV [except pGEBL1-(T)-PV]. Thus, structural constraints appear to be important in the chimera. Insertion of any type of foreign epitope reduced VNAb production against both PV and EBL1 relative to that of the parent construct, pGEBL1-PV. Nevertheless, for at least two constructs [pGEBL1-(T-B)-PV and pGEBL1-(T)-PV], the VNAb titres were maintained at a protective level. Indeed, we have shown previously that, when VNAb titres in mice sera are above 1·5 IU/ml after DNA-based immunization, all animals survive an i.c. challenge (Jallet et al., 1999 ). In addition, levels of antibodies against the poliovirus peptide measured after induction with pGEBL1-(T-B)-PV were similar to those obtained by a single injection of the same epitope in hybrid hepatitis B surface antigen particles (Delpeyroux et al., 1990 ).
The protection against LCMV provided by pGEBL1-(T-B)-PV was high, showing that the efficacy of the chimera was similar to that of the gene encoding the full LCMV nucleoprotein (Martins et al., 1995 ; Yokoyama et al., 1995 ) or to that induced by recombinant bacteria (Goossens et al., 1995 ) or bacterial toxin carrying the same epitope (Saron et al., 1997 ). These results demonstrate clearly that foreign B and T cell epitopes can be expressed in an immunologically potent form and correctly presented by both MHC II and MHC I molecules.
The insertion of B-t dimer epitopes into the chimera [pGEBL1-(B-t)2-PV] seemed to have a different effect than fusion with the truncated glycoprotein. Indeed, the VNAb titres against both PV and EBL1 decreased, whereas the ability to induce IL-2-producing cells and poliovirus antibodies were only marginally affected. This decrease could be due to the size of the insert (49 amino acids). Moreover, two types of LCMV CTL epitopes were inserted: the sequence coding for PQASGVYMG, corresponding to the epitope presented by H2d MHC I (t), and the sequence ERPQASGVYMGNLTAQ, corresponding to the larger CTL epitope (T). The expression of the short epitope protected 1320% of the animals [p(B-t)2-GPVIII and pGEBL1-(B-t)2-PV], whereas the expression of the larger epitope protected 70% of the animals [pGEBL1-(T-B)-PV]. Thus epitopes t and T provided protection against LCMV challenge when carried either by the truncated or the chimeric G molecule. However, neither pGEBL1-(T)-PV nor pGEBL1-(B-T)-PV provided protection. Consequently, the inability of these constructs to provide protection might be due to factors other than the flanking amino acids being in direct contact with the short CTL epitope (Bergmann et al., 1996 ), because the larger epitope was effective in pGEBL1-(T-B)-PV. The nature and position of both the epitope(s) and the flanking regions, as well as the length of the inserted sequence, could be alternative destabilizing factors.
The present work with truncated or chimeric glycoproteins suggests opportunities both to broaden the spectrum of protection against lyssaviruses and to express foreign B and T cell epitopes efficiently. In addition, it may be possible to insert into the chimeric G various epitopes presented by different MHC alleles, in order to obtain CTL production in animals from different genetic backgrounds or in humans (An & Whitton, 1997 ; Hanke et al., 1998 ), since (i) at least 49 amino acids residues can be inserted with satisfying immunological responses; (ii) the effective delivery of multiple CTL epitopes involved in protection against many viruses, tumours, intracellular bacteria and parasites has been reported (Suhrbier, 1997 ; Thomson et al., 1998 ); and (iii) degenerate CTL epitopes can be recognized by multiple MHC I molecules, which reduces the number of epitopes that need to be used (Doolan et al., 1997 ). Moreover, the truncated or chimeric lyssavirus G is more potent than an `artificial polytope' (multiple contiguous CTL epitopes linked to a linear B cell epitope) (Thomson et al., 1998 ). Indeed, Thomson et al. (1998) reported that no antibody against a B cell epitope was induced by this polytope, due to the lack of help from CD4+ T cells. In both types of lyssavirus G, memory CD4+ T cells were induced, providing a complete immune response against foreign epitopes. Moreover, DNA-based immunization with a homogeneous, full-length rabies virus G has been shown recently to be effective in non-human primates (Lodmell et al., 1998 ). Therefore, multiple B and T cell epitopes could presumably be inserted and expressed with a view to human and/or veterinary use.
The truncated and chimeric lyssavirus G carrying antigen fragments may be a new prototype for the development of multivalent vaccines against various zoonoses including rabies. DNA-based immunization was used in these experiments but other systems able to induce CTL might also be effective, such as recombinant vaccinia virus, which has been used widely in Europe for oral vaccination of foxes (Pastoret et al., 1997 ).
We would like to thank Corinne Jallet, Laurence Levy, Sandrine Dos Santos, Jeanine Foulon and Antonio Membrilerra-Pizarro for their excellent technical assistance.References
Amengual, B., Whitby, J. E., Cobo, J. S. & Bourhy, H. (1997). Evolution of European bat lyssaviruses. Journal of General Virology 78, 2319-2328.[Abstract]
An, L.-L. & Whitton, J. L. (1997). A multivalent minigene vaccine, containing B-cell, cytotoxic T-lymphocyte, and Th epitopes from several microbes, induces appropriate responses in vivo and confers protection against more than one pathogen. Journal of Virology 71, 2292-2302.[Abstract]
Bahloul, C., Jacob, Y., Tordo, N. & Perrin, P. (1998). DNA-based immunization for exploring the enlargement of immunological cross-reactivity against the lyssaviruses. Vaccine 16, 417-425.[Medline]
Battegay, M., Oehen, S., Schulz, M., Hengartner, H. & Zinkernagel, R. M. (1992). Vaccination with a synthetic peptide modulates lymphocytic choriomeningitis virus-mediated immunopathology. Journal of Virology 66, 1199-1201.
Benmansour, A., Leblois, H., Coulon, P., Tuffereau, C., Gaudin, Y., Flamand, A. & Lafay, F. (1991). Antigenicity of rabies virus glycoprotein. Journal of Virology 65, 4198-4203.
Bergmann, C. C., Yao, Q., Ho, C.-K. & Buckwold, S. L. (1996). Flanking residues alter antigenicity and immunogenicity of multi-unit CTL epitopes. Journal of Immunology 157, 3242-3249.[Abstract]
Bourhy, H., Kissi, B. & Tordo, N. (1993). Molecular diversity of the Lyssavirus genus. Virology 194, 70-81.[Medline]
Delpeyroux, F., Van Wezel, E., Blondel, B. & Crainic, R. (1990). Structural factors modulate the activity of antigenic poliovirus sequences expressed on hybrid hepatitis B surface antigen particles. Journal of Virology 64, 6090-6100.
Dietzschold, B., Gore, M., Marchadier, D., Niu, H.-S., Bunschoten, H. M., Otvos, L.Jr, Wunner, W. H., Ertl, H. C., Osterhaus, A. D. & Koprowski, H. (1990). Structural and immunological characterization of a linear virus-neutralizing epitope of the rabies virus glycoprotein and its possible use in a synthetic vaccine. Journal of Virology 64, 3804-3809.
Donnelly, J. J., Ulmer, J. B., Shiver, J. W. & Liu, M. A. (1997). DNA vaccines. Annual Review of Immunology 15, 617-648.[Medline]
Doolan, D. L., Hoffman, S. L., Southwood, S., Wentworth, P. A., Sidney, J., Chesnut, R. W., Keogh, E., Appella, E., Nutman, T. B., Lal, A. A., Gordon, D. M., Oloo, A. & Sette, A. (1997). Degenerate cytotoxic T cell epitopes from P. falciparum restricted by multiple HLA-A and HLA-B supertype alleles. Immunity 7, 97-112.[Medline]
European Commission (1996). COST/STD-3. Advantages of combined vaccines. Vaccine 14, 693700.
Fekadu, M., Shaddock, J. H., Sanderlin, D. W. & Smith, J. S. (1988). Efficacy of rabies vaccines against Duvenhage virus isolated from European house bats (Eptesicus serotinus), classic rabies and rabies-related viruses. Vaccine 6, 533-539.[Medline]
Goossens, P. L., Milon, G., Cossart, P. & Saron, M.-F. (1995). Attenuated Listeria monocytogenes as a live vector for induction of CD8+ T cells in vivo: a study with the nucleoprotein of the lymphocytic choriomeningitis virus. International Immunology 7, 797-805.
Gould, A. R., Hyatt, A. D., Lunt, R., Kattenbelt, J. A., Hengstberger, S. & Blacksell, S. D. (1998). Characterisation of a novel lyssavirus isolated from Pteropid bats in Australia. Virus Research 54, 165-187.[Medline]
Hanke, T., Blanchard, T. J., Schneider, J., Ogg, G. S., Tan, R., Becker, M., Gilbert, S. C., Hill, A. V. S., Smith, G. L. & McMichael, A. (1998). Immunogenicities of intravenous and intramuscular administrations of modified vaccinia virus Ankara-based multi-CTL epitope vaccine for human immunodeficiency virus type 1 in mice. Journal of General Virology 79, 83-90.[Abstract]
Jallet, C., Jacob, Y., Bahloul, C., Drings, A., Desmézières, E., Tordo, N. & Perrin, P. (1999). Chimeric lyssavirus glycoproteins with increased immunological potential. Journal of Virology 73, 225-233.
Joffret, M.-L., Zanetti, C., Morgeaux, S., Leclerc, C., Sureau, P. & Perrin, P. (1991). Appraisal of rabies vaccine potency by determination of in vitro, specific interleukin-2 production. Biologicals 19, 113-123.[Medline]
Lang, J., Duong, G. H., Nguyen, V. G., Le, T. T., Nguyen, C. V., Kesmedjian, V. & Plotkin, S. A. (1997). Randomised feasibility trial of pre-exposure rabies vaccination with DTP-IPV in infants. Lancet 349, 1663-1665.[Medline]
Lodmell, D. L., Ray, N. B., Parnell, M. J., Ewalt, L. C., Hanlon, C. A., Shaddock, J. H., Sanderlin, D. S. & Rupprecht, C. E. (1998). DNA immunization protects non-human primates against rabies virus. Nature Medicine 4, 949-952.[Medline]
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Martins, L. P., Lau, L. L., Asano, M. S. & Ahmed, R. (1995). DNA vaccination against persistent viral infection. Journal of Virology 69, 2574-2582.[Abstract]
Park, J. Y., Peters, C. J., Rollin, P. E., Ksiazek, T. G., Gray, B., Waites, K. B. & Stephensen, C. B. (1997). Development of a reverse transcription-polymerase chain reaction assay for diagnosis of lymphocytic choriomeningitis virus infection and its use in a prospective surveillance study. Journal of Medical Virology 51, 107-114.[Medline]
Pastoret, P.-P., Brochier, B., Aguilar-Setién, A. & Blancou, J. (1997). Vaccination against rabies. In Veterinary Vaccinology, pp. 616-628. Edited by P.-P. Pastoret, J. Blancou, P. Vannier & C. Verschuren. Amsterdam: Elsevier.
Perrin, P. (1996). Techniques for the preparation of rabies conjugates. In Laboratory Techniques in Rabies, pp. 433-445. Edited by F.-X. Meslin, M. Kaplan & H. Koprowski. Geneva: WHO.
Perrin, P., Thibodeau, L. & Sureau, P. (1985). Rabies immunosome (subunit vaccine) structure and immunogenicity. Pre- and post-exposure protection studies. Vaccine 3, 325-332.[Medline]
Perrin, P., Versmisse, P., Delagneau, J. F., Lucas, G., Rollin, P. E. & Sureau, P. (1986). The influence of the type of immunosorbent on rabies antibody EIA; advantages of purified glycoprotein over whole virus. Journal of Biological Standardization 14, 95-102.[Medline]
Perrin, P., Joffret, M.-L., Leclerc, C., Oth, D., Sureau, P. & Thibodeau, L. (1988). Interleukin 2 increases protection against experimental rabies. Immunobiology 177, 199-209.[Medline]
Perrin, P., De Franco, M., Jallet, C., Fouque, F., Morgeaux, S., Tordo, N. & Colle, J.-H. (1996). The antigen-specific cell-mediated immune response in mice is suppressed by infection with pathogenic lyssaviruses. Research in Virology 147, 289-299.[Medline]
Saron, M.-F., Fayolle, C., Sebo, P., Ladant, D., Ullmann, A. & Leclerc, C. (1997). Anti-viral protection conferred by recombinant adenylate cyclase toxins from Bordetella pertussis carrying a CD8+ T cell epitope from lymphocytic choriomeningitis virus. Proceedings of the National Academy of Sciences, USA 94, 3314-3319.
Smith, J., Yager, P. & Baer, G. (1996). A rapid fluorescent focus inhibition test (RFFIT) for determining virus-neutralizing antibody. In Laboratory Techniques in Rabies, pp. 181-189. Edited by F.-X. Meslin, M. Kaplan & H. Koprowski. Geneva: WHO.
Spier, R. E. (1997). Multivalent vaccines: prospects and challenges. Folia Microbiologica 42, 105-112.[Medline]
Suhrbier, A. (1997). Multi-epitope DNA vaccines. Immunological Cell Biology 75, 402-408.
Thomson, S. A., Sherritt, M. A., Medveczky, J., Elliott, S. L., Moss, D. J., Fernando, G. J., Brown, L. E. & Suhrbier, A. (1998). Delivery of multiple CD8 cytotoxic T cell epitopes by DNA vaccination. Journal of Immunology 160, 1717-1723.
Yokoyama, M., Zhang, J. & Whitton, J. L. (1995). DNA immunization confers protection against lethal lymphocytic choriomeningitis virus infection. Journal of Virology 69, 2684-2688.[Abstract]
Received 10 May 1999; accepted 11 June 1999.
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
| J MED MICROBIOL | ALL SGM JOURNALS | |