Abstract
Post-transcriptional gene silencing (PTGS) is considered to be one of the dominant mechanisms of RNA-mediated protection in transgenic plants (Dawson, 1996 ; Goodwin et al., 1996 ; Lindbo et al., 1993 ; Mueller et al., 1995 ; Pang et al., 1996 , 1997 ; Prins et al., 1996 ; Sijen et al., 1996 ; Smith et al., 1994 ; Tanzer et al, 1997 ). RNA-mediated virus resistance is also known as homology-dependent resistance (Mueller et al., 1995 ). Several models have been postulated to account for the mechanism of PTGS and the resulting virus resistance (Baulcombe, 1996b ): (i) the direct production of antisense RNA model (Grierson et al., 1991 ); (ii) the expression threshold model (Dougherty & Parks, 1995 ; Smith et al., 1994 ); (iii) the aberrant RNA (ectopic pairing) model (English et al., 1996 ; Baulcombe & English, 1996 ) and (iv) the double-stranded RNA-induced model (Metzlaff et al., 1997 ; Montgomery & Fire, 1998 ; Prins & Goldbach, 1996 ; Waterhouse et al., 1998 ).
Tomato spotted wilt virus (TSWV) is the type species of the genus Tospovirus. The virus genome consists of three single-stranded RNAs that are designated as L (~8900 nucleotides), M (~5000 nucleotides) and S (~2900 nucleotides). The S and M RNAs contain two open reading frames (ORFs) of an ambisense gene arrangement (de Haan et al., 1990 ; Kormelink et al., 1992b ; Law et al., 1991 , 1992 ; Maiss et al., 1991 ; Pang et al., 1993a ), which are expressed via the synthesis of subgenomic mRNAs (Kormelink et al., 1992a ). The S RNA encodes a 52 kDa nonstructural protein (NSS) in the viral RNA strand and the 29 kDa nucleocapsid (N) protein in the viral complementary RNA strand. The M RNA encodes the precursor to the envelope glycoproteins G2 (58 kDa) and G1 (78 kDa) in the viral complementary RNA strand and a 34 kDa nonstructural protein (NSM), which possibly functions as a virus cell-to-cell movement protein, in the viral RNA strand (Kormelink et al., 1994 ). The L RNA is of negative polarity and encodes a 330 kDa putative viral polymerase (de Haan et al., 1991 ).
We previously reported that transgenic plants expressing a large segment (longer than 387 bp) of the N gene of TSWV conferred virus resistance through PTGS while N transgene segments smaller than 235 bp did not (Pang et al., 1997 ). However, resistance to TSWV was obtained when small N gene segments were fused to the non-target green fluorescent protein (GFP) gene. These data suggested that GFP was triggering PTGS of the chimeric gene while the TSWV N gene segment of the chimeric gene conferred resistance to the attacking TSWV. This system should thus allow us to determine the minimum unit of viral transgene that can confer resistance via the PTGS mechanism and to test whether a chimeric gene made of short virus segments could provide a simple way to develop transgenic plants that are resistant to multiple viruses. Here we demonstrate that minimum lengths of 59110 bp were required, fused with a silencer DNA, for RNA-mediated tospovirus resistance. In addition, the same lines expressing the hybrid transgene are protected against both TSWV and tobacco mosaic virus (TMV)GFP, demonstrating the feasibility of this simple strategy for engineering multiple virus resistance in transgenic plants.
Virus constructs.An infectious cDNA clone (designated pTMV-GFP), known as p4GD-PL (Casper & Holt, 1996 ), of the TMV common strain with a GFP gene sequence was used for construction of infectious TMV cDNAs carrying foreign inserts. The clone was a kind gift from C. A. Holt (formerly of the Scripps Institute, La Jolla, CA, USA). The construct pTMV-GFP contains the virusGFP sequence inserted in pBluescript KS(+) with a bacteriophage T7 RNA polymerase promoter to allow for in vitro production of viral RNAs. A construct, pTMV-GFP-NP, containing the N gene of TSWV (Fig. 1a) was constructed in our laboratory (Jan, 1998 ) and also used to produce transcripts for some inoculation tests.
|
In vitro transcription and virus infection.
Plasmids pTMV-GFP and pTMV-GFP-NP were linearized with KpnI at the 3' end of TMV cDNA and made blunt-ended by removing the 3' overhang with Klenow polymerase (Promega). In vitro transcription was performed essentially as described by Holt & Beachy (1991) . Capped in vitro transcripts were diluted 1:1 with 20 mM sodium phosphate buffer, pH 7·0, and the mixture was applied to carborundum-dusted leaves of Nicotiana benthamiana. Plants were rinsed with water immediately after inoculation and placed in a greenhouse for observation of symptoms. Inoculations of TSWV-BL were done as described previously (Pang et al., 1992 ). Systemic symptoms were recorded daily for at least 30 days.
Cloning and transformation.
Maps of the transgenes used in this study are shown in Fig. 1(b). The 9/16N gene segment was amplified by PCR by using oligomer primers 96-5 (5' TCTTGAGGATCCATGGAATAAGAGGTAAGCTACCT), which is identical to the S RNA of TSWV-BL at positions 23232341, and 92-54 (5' TACAGTTCTAGAACCATGGATGATGCAAAGTCTGTGAGG), which is complementary to the S RNA at positions 23592378. The 17/32N gene segment was generated by annealing oligomer primers 96-6 (5' CTAGACCATGGATGATGCAAAGTCTGTGAGGCTTG) and 96-4 (5' GATCCAAGCCTCACAGACTTTGCATCATCCATGGT). The 17/32N gene segment was located at positions 23552378 of S RNA with NcoI site and XbaI overhang sequences in the 5' end and a BamHI overhang sequence in the 3' end. The 9/16N and 17/32N segments were cloned in the sense orientation into the XbaI/BamHI sites of a plant expression vector pBI525 (Pang et al., 1992 ). For construction of N gene segment fusions with GFP, the translatable GFP ORF was amplified with GFP primers (Pang et al., 1997 ) from the plasmid pGFP (Clontech) and cloned alone or as a transcriptional fusion into the NcoI site upstream of the N gene segments 9/16N and 17/32N in pBI525. The resulting plant expression vectors were digested with HindIII and EcoRI and the HindIIIEcoRI segments containing the corresponding gene cassettes were isolated and introduced into the same sites of pBIN19 (Clontech). The resulting binary vectors were transferred into Agrobacterium tumefaciens LBA4404 and cultures of A. tumefaciens containing the vectors were used to inoculate leaf discs of N. benthamiana plants, essentially as described by Horsch et al. (1985) .
Transgenic plants containing the 2/2N, 3/4N and 5/8N gene segments fused with GFP were described by Pang et al. (1997) .
Nuclear run-on transcription assays, ELISA and Northern blot analyses of transgenic plants.
Isolation of nuclei and nuclear run-on transcription assays were described previously by Pang et al. (1996) . Double-antibody sandwich ELISA was used to detect the neomycin phosphotransferase (npt) II enzyme in transgenic plants by using an nptII ELISA kit (5 Prime to 3 Prime Inc.). For estimation of RNA transcript levels in transgenic plants by Northern blot, total plant RNAs were isolated as described by Napoli et al. (1990) and Northern blotting was performed as described by Pang et al. (1993b ). Ten µg total RNA per lane was separated on formaldehyde-containing agarose gels (Sambrook et al., 1989 ) and the agarose gels were stained with ethidium bromide to monitor the uniformity of total plant RNA in each lane. Since the N gene segments in transgenic plants containing GFP+9/16N and GFP+17/32N were too short (59 and 24 bp, respectively) to be detected when using probes made by random priming (Feinberg & Vogelstein, 1983 ), an oligonucleotide probe was used to detect the N gene in transgenic plants containing GFP linked to 17/32N or 9/16N. The oligonucleotide probe was 32P-labelled as described by Sambrook et al. (1989) . Hybridizations were performed essentially as described in the manufacturers protocol for GeneScreen Plus membrane (Dupont) except that the hybridization was at 42 °C and washing was at 48 °C. Images of some autoradiograms were photographed with a COHU CCD camera model 49152000 (COHU Inc.). Signals were quantified by using the US National Institutes of Health-Image program version 1.59.
It has been shown that transgenic plants with a silenced transgene can resist infection by a chimeric virus containing an RNA sequence homologous to the silenced transgene (Sijen et al., 1996 ; English et al., 1996 ; Marano & Baulcombe, 1998 ). To determine whether the transgenic plants with a silenced GFP transgene could inactivate chimeric TMV containing a GFP sequence or a GFPN gene segment, 19 GFP-transgenic lines were produced and R1 plants of 12 lines were inoculated with in vitro transcripts of TMVGFP or TMVGFPNP (Fig. 1a) and observed for infection. Transgenic R1 seeds were germinated and assayed by nptII ELISA to identify the non-transgenic segregants from the R1 populations. Non-transgenic control plants inoculated with TMVGFP or TMVGFPNP developed systemic mosaic symptoms 614 days and 1221 days post-inoculation (p.i.), respectively. Additionally, control plants inoculated with TMVGFP showed green fluorescence on inoculated leaves 25 days p.i. and on non-inoculated upper leaves 46 days p.i. However, green fluorescence was not observed when control plants were inoculated with TMVGFPNP (data not shown). Unlike the control plants, various proportions of progeny from four of 12 tested lines were resistant to TMVGFP and TMVGFPNP. Resistance to TMVGFP was correlated with resistance to TMVGFPNP. For example, seven of eight and seven of nine plants from line 5L were resistant to TMVGFP and TMVGFPNP, respectively. RNA gel blot analysis of inoculated leaves showed that TMVGFP genomic RNA accumulated to high levels in the susceptible line 3 and non-transformed N. benthamiana plants, while little or no TMVGFP genomic RNA was detected on the resistant line 5L (data not shown).
Northern blot and nuclear run-on assays were performed to determine whether the protection of GFP-transgenic plants against TMVGFP and TMVGFPNP was due to the PTGS mechanism. Results of hybridization analysis showed a correlation between the resistance phenotype and low levels of GFP RNA transcript accumulation (Fig. 2a). In addition, the resistant plants with low steady-state RNA accumulation had high RNA transcription rates in nuclei (Fig. 2b). These results suggest collectively that PTGS not only suppressed GFP expression but also trans-inactivated the replication of the chimeric virus containing the homologous GFP sequence.
|
Fusion of N gene segments with GFP confers resistance to TMVGFP and TSWV
We reported previously that non-translatable constructs containing segments of the TSWV-BL N gene that were fused to the GFP gene (designated as GFP+2/2N, GFP+3/4N and GFP+5/8N) conferred resistance to TSWV in transgenic N. benthamiana via PTGS (Pang et al., 1997 ). Experiments were done to determine whether these resistant lines could resist infection by TMVGFP as well as TSWV. Transgenic R1 and R2 seeds were germinated and assayed by nptII ELISA to identify the non-transgenic segregants from the populations. A number of R1 plants were inoculated with TSWV or infectious transcripts of TMVGFP (Table 1). Unlike control plants, which were susceptible to TSWV and TMVGFP, a portion of the R1 transgenic plants from lines with GFP+2/2N, GFP+3/4N and GFP+5/8N gene fusions were resistant to TSWV and TMVGFP (Table 1). Thus, for line 29 of GFP+2/2N, 17 of 18 plants tested were resistant to TSWV and six of seven plants tested were resistant to TMVGFP. Similarly, all plants of GFP+3/4N line 24 tested were resistant to TSWV (20/20) and TMVGFP (7/7) (Table 1).
Table 1. Reactions of R1 transgenic plants with GFP+2/2N, GFP+3/4N and GFP+5/8N transgenes to inoculation with TSWV and TMVGFP
In another set of experiments, self-pollinated R2 plants from selected TSWV-resistant R1 plants (Pang et al., 1997 ) were inoculated with TMVGFP, TMVGFPNP and TSWV. The R2 plants with GFPN fusions (GFP+2/2N, GFP+3/4N and GFP+5/8N) were resistant to TSWV, TMVGFP and TMVGFPNP (Table 2). With the N gene or GFP gene sequences as probes, Northern blots of some R2 plants showed that resistance to TSWV and TMVGFP was accompanied by low to medium levels of accumulation of the fusion gene transcripts (Fig. 3). These results demonstrate collectively that the hybrid transgene was capable of inactivating both the N gene-containing tospoviruses and the GFP-containing TMV through the PTGS mechanism.
Table 2. Reactions of R2 progeny of transgenic plants with GFP+2/2N, GFP+3/4N and GFP+5/8N transgenes to inoculation with TSWV, TMVGFP and TMVGFPNP
|
A minimum length of N gene segment is required to inactivate the incoming tospovirus
Two lines of evidence suggested that the minimum length of the N gene that confers resistance when fused with GFP was close to 110 nucleotides. Firstly, only one of 13 R0 lines with the GFP+5/8N transgene was resistant to TSWV compared with six of eight lines with the GFP+3/4N transgene (Pang et al., 1997 ). Secondly, only one of 18 progeny from the resistant R0 plant containing GFP+5/8N was resistant to TSWV infection while five of six progeny were resistant to TMVGFP (Table 1).
To determine more precisely the minimum length of the TSWV N gene that is required to confer resistance in the GFP+N plants that show PTGS, transgenic N. benthamiana plants were engineered to express 11024 bp of the N gene alone or fused with the GFP gene (Fig. 1b). In one set of experiments, R0 plants expressing these fusions were inoculated with infectious transcripts of TMVGFP or TMVGFPNP and observed for symptoms. Control transgenic plants with only the 9/16N or 17/32N gene segments were similarly inoculated. Plants that showed resistance to TMVGFP or TMVGFPNP or a recovery phenotype (symptoms developed initially but new leaves were symptomless at 1430 days p.i.) were then inoculated with TSWV (Table 3). Five of 12 R0 plants tested that expressed the 110 bp segment of the N gene linked to GFP (GFP+5/8N) showed resistance or recovery following inoculation with TMVGFP or TMVGFPNP. Two of these five lines were also resistant to TSWV (Table 3). In contrast, six of 12 GFP+9/16N (59 bp) and five of 12 GFP+17/32N (24 bp) lines were resistant to TMVGFP or TMVGFPNP, but none of these 11 resistant lines showed resistance to TSWV. All six plants with 9/16N or 17/32N gene segments alone were susceptible to TMVGFP or TMVGFPNP.
Table 3. Reactions of R0 transgenic plants with GFP+5/8N, GFP+9/16N and GFP+17/32N transgenes to inoculation with TMVGFP, TMVGFPNP and TSWV-BL
In a second set of experiments, progeny of GFP+9/16N and GFP+17/32N from another twelve independent R0 lines were similarly inoculated with TMVGFP and TSWV. As shown in Table 4, a proportion (61 of 170) of the R1 plants with GFP+9/16N or GFP+17/32N were resistant to TMVGFP but all 469 plants that were inoculated with TSWV-BL became infected.
Table 4. Reactions of R1 transgenic lines with small N gene segments alone or linked to GFP
Some of the R1 plants expressing the fusions were analysed by Northern blot with N gene or GFP gene sequences as probes. The results showed that the resistance observed correlated with low accumulation of the fusion gene transcripts (data not shown). Collectively, these results show that GFP+9/16N and GFP+17/32N can induce gene silencing and confer resistance to TMVGFP and TMVGFPNP but not resistance to TSWV, indicating that an N gene DNA sequence of 59 or 24 bp is insufficient to trans-inactivate the incoming tospovirus. We showed previously that plants with transgene constructs of GFP fused to short N gene segments (200110 bp) of TSWV were resistant to TSWV, while plants with transgenes consisting of only these short N gene segments were susceptible (Pang et al., 1997 ). The underlying resistance mechanism was PTGS. These results suggested that plants resistant to multiple viruses could be obtained by transforming them with a single chimeric transgene consisting of gene segments from different viruses. In this study, we provide evidence that this concept does work by showing that a GFP+N gene segment transgene conferred resistance to both TMVGFP and TSWV. The resistance was inherited through the R2 progeny. We also further define the minimum length of the transgene required to confer resistance against TSWV and presumably other tospoviruses by showing that gene segments of 59 bp or less fail to confer resistance, even though the transgene is post-transcriptionally silenced. This is the first report that RNA-mediated virus resistance and PTGS can be uncoupled if the virus transgene sequence is below a minimum size.
The simplest explanation for our results is that the 720 bp GFP DNA acts as a silencer DNA because it is large enough to induce PTGS, in contrast to N gene segments of 200 bp or less, which are not sufficiently large to induce PTGS. The silencer DNA (GFP in this case) may simply stabilize the transgene fusions or the GFP gene may provide RNA sequence elements required for activating PTGS. Resistance to TSWV is obtained in transgenic plants when these N gene segments (200110 bp) are linked to GFP because they are part of a transgene that is post-transcriptionally silenced. Our previous work also showed that N gene segments of more than 400 bp could serve as silencer DNAs. We speculate that the putative antisense molecules that are produced from the region of the mRNAs of N gene segments that are 59 bp or less are either too small or not sufficiently abundant to degrade the incoming virus effectively and induce a resistant phenotype.
Our findings demonstrate the feasibility of, and define some of the important parameters for, developing multiple virus-resistant transgenic plants by using a chimeric transgene with a silencer DNA linked to small segments that originate from target plant viruses. This novel strategy could have significant practical value because most crops are susceptible to more than one virus and a single crop is often exposed to infections by multiple viruses in a growing season. It is also likely that this strategy could be used to down-regulate multiple genes in plants and obtain transgenic plants with virus resistance and other interesting traits, for example, delayed ripening (Gray et al., 1992 ).
A potato virus X (PVX) vector has been used to show that silencing of a non-viral transgene can suppress a virus with inserted sequences homologous to the silencing transgene (English et al., 1996 ). Tobacco plants displaying PTGS of β-glucuronidase (GUS) or npt were resistant to PVX.GUS and PVX.NPT, respectively, and tomato plants with PTGS of polygalacturonase (PG) were resistant to PVX.PG. Sijen et al. (1996) also observed that N. benthamiana plants with PTGS of the movement protein (MP) of cowpea mosaic comovirus (CPMV) displayed resistance to PVX.MP.
N. benthamiana infected with TMVGFPNP did not show green fluorescence and the appearance of systemic symptoms was delayed by 68 days compared with plants infected with TMVGFP. Casper & Holt (1996) reported that the approximately 200 bp 3' UTR in the GFP cDNA inhibited GFP expression drastically from TMV. Thus, the N gene sequence at the 3' end of the GFP gene might have severely inhibited transcription and/or translation of the virus subgenomic mRNA.
Studies with CPMV and PVX suggest that there are preferential sites on the transgene mRNA molecules that act as signals for sequence-specific degradation (Sijen et al., 1996 ; English et al., 1996 ). The 640 bp 3' region of the transcribed MP transgene of CPMV and the ~700 bp 3' region of the GUS transgene might have been responsible for elimination of the incoming chimeric PVX in those studies (PVX.MP and PVX.GUS, respectively). However, our data show that a single transgene confers resistance to both a tospovirus and TMVGFP, suggesting either that there are multiple signals on the mRNA molecule for degradation or that, once the degradation process is triggered by some specific secondary structure or feature of the RNA, the process is capable of degrading any RNA molecule that shares sequence similarity with the transgene. The latter hypothesis does require a minimum length of homologous sequence to be effective, which is consistent with the data presented here. A similar result was reported by Seymour et al. (1993) , who showed that the PG and pectinesterase (PE) genes were coordinately down-regulated in transgenic tomato plants transformed with a chimeric gene construct containing the 244 bp 5' end of PG fused to the 5' end of a 1320 bp PE. Moreover, our results are consistent with the recent observation of Marano & Baulcombe (1998) , who showed that transgenic tobacco plants containing the TMV-U1 54 kDa replicase gene were resistant to PVX vectors containing the first half, middle half or second half of the replicase gene.
This work was supported in part by a grant (no. 97-35303-4624) from the US Department of Agriculture National Competitive Research Initiative program to D.G. We are very grateful to G. A. Fermin-Munoz and M. F. Carvalho for reviewing and editing the manuscript. We thank Dr C. A. Holt for providing plasmid p4GD-PL and S. Day for technical assistance in the greenhouse. F.-J.J. was partially supported by a fellowship from the Ministry of Education, Taiwan, ROC, and C.F. was supported by a fellowship from the Ministerio Español de Educación y Ciencia.Footnotes
b Present address: Instituto Valenciano de Investigaciones Agrarias, Apartat Oficial 46113, Moncada, Valencia, Spain.c Present address: BB5K, Monsanto Company, 700 Chesterfield Village Pkwy N., St Louis, MO 63198, USA.
References
Baulcombe, D. C. (1996b). RNA as a target and an initiator of post-transcriptional gene silencing in transgenic plants. Plant Molecular Biology 32, 79-88.[Medline]
Baulcombe, D. C. & English, J. J. (1996). Ectopic pairing of homologous DNA and post-transcriptional gene silencing in transgenic plants. Current Opinion in Biotechnology 7, 173-180.
Casper, S. J. & Holt, C. A. (1996). Expression of the green fluorescent protein-encoding gene from a tobacco mosaic virus-based vector. Gene 173, 69-73.[Medline]
Dawson, W. D. (1996). Gene silencing and virus resistance: a common mechanism. Trends in Plant Science 1, 107-108.
de Haan, P., Wagemakers, L., Peters, D. & Goldbach, R. (1990). The S RNA segment of tomato spotted wilt virus has an ambisense character. Journal of General Virology 71, 1001-1007.
de Haan, P., Kormelink, R., Resende, R. de O., van Poelwijk, F., Peters, D. & Goldbach, R. (1991). Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. Journal of General Virology 72, 2207-2216.
Dougherty, W. G. & Parks, T. D. (1995). Transgenes and gene suppression: telling us something new? Current Opinion in Cell Biology 7, 399-405.[Medline]
English, J. J., Mueller, E. & Baulcombe, D. C. (1996). Suppression of virus accumulation in transgenic plants exhibiting silencing of nuclear genes. Plant Cell 8, 179-188.[Abstract]
Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analytical Biochemistry 132, 6-13.[Medline]
Goodwin, J., Chapman, K., Swaney, S., Parks, T. D., Wernsman, E. A. & Dougherty, W. G. (1996). Genetic and biochemical dissection of transgenic RNA-mediated virus resistance. Plant Cell 8, 95-105.[Abstract]
Gray, J., Picton, S., Shabbeer, J., Schuch, W. & Grierson, D. (1992). Molecular biology of fruit ripening and its manipulation with antisense genes. Plant Molecular Biology 19, 69-87.[Medline]
Grierson, D., Fray, R. G., Hamilton, A. J., Smith, C. J. S. & Watson, C. F. (1991). Does co-suppression of sense genes in transgenic plants involve antisense RNA? Trends in Biotechnology 9, 122-123.
Grumet, R. (1995). Genetic engineering for crop virus resistance. Hortscience 30, 449-456.
Holt, C. A. & Beachy, R. N. (1991). In vivo complementation of infectious transcripts from mutant tobacco mosaic virus cDNAs in transgenic plants. Virology 181, 109-117.[Medline]
Horsch, R. B., Fry, J. E., Hoffman, N. L., Eichholtz, D., Rogers, S. G. & Fraley, R. T. (1985). A simple and general method for transferring genes into plants. Science 227, 1229-1231.
Jan, F.-J. (1998). Roles of nontarget DNA and viral gene length in influencing multi-virus resistance through homology-dependent gene silencing. PhD dissertation, Cornell University, NY, USA.
Kormelink, R., de Haan, P., Peters, D. & Goldbach, R. (1992a). Viral RNA synthesis in tomato spotted wilt virus-infected Nicotiana rustica plants. Journal of General Virology 73, 687-693.
Kormelink, R., de Haan, P., Meurs, C., Peters, D. & Goldbach, R. (1992b). The nucleotide sequence of the M RNA segment of tomato spotted wilt virus, a bunyavirus with two ambisense RNA segments. Journal of General Virology 73, 2795-2804.
Kormelink, R., Storms, M., Van Lent, J., Peters, D. & Goldbach, R. (1994). Expression and subcellular location of the NSM protein of tomato spotted wilt virus (TSWV), a putative viral movement protein. Virology 200, 56-65.[Medline]
Law, M. D., Speck, J. & Moyer, J. W. (1991). Nucleotide sequence of the 3' non-coding region and N gene of the S RNA of a serologically distinct tospovirus. Journal of General Virology 72, 2597-2601.
Law, M. D., Speck, J. & Moyer, J. W. (1992). The M RNA of impatiens necrotic spot Tospovirus (Bunyaviridae) has an ambisense genomic organization. Virology 188, 732-741.[Medline]
Lindbo, J. A., Silva, R. L., Proebsting, W. M. & Dougherty, W. G. (1993). Induction of a highly specific antiviral state in transgenic plants: implications for regulation of gene expression and virus resistance. Plant Cell 5, 1749-1759.[Abstract]
Lomonossoff, G. P. (1995). Pathogen-derived resistance to plant viruses. Annual Review of Phytopathology 33, 323-343.
Maiss, E., Ivanova, L., Breyel, E. & Adam, G. (1991). Cloning and sequencing of the S RNA from a Bulgarian isolate of tomato spotted wilt virus. Journal of General Virology 72, 461-464.
Marano, M. R. & Baulcombe, D. (1998). Pathogen-derived resistance targeted against the negative-strand RNA of tobacco mosaic virus: RNA strand-specific gene silencing? Plant Journal 13, 537-546.
Metzlaff, M., ODell, M., Cluster, P. D. & Flavell, R. B. (1997). RNA-mediated RNA degradation and chalcone synthase A silencing in petunia. Cell 88, 845-854.[Medline]
Montgomery, M. K. & Fire, A. (1998). Double-stranded RNA as a mediator in sequence-specific genetic silencing and co-suppression. Trends in Genetics 14, 255-258.[Medline]
Mueller, E., Gilbert, J., Davenport, G., Brigneti, G. & Baulcombe, D. C. (1995). Homology-dependent resistance: transgenic virus resistance in plants related to homology-dependent gene silencing. Plant Journal 7, 1001-1013.
Napoli, C., Lemieux, C. & Jorgensen, R. (1990). Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell 2, 279-290.
Pang, S.-Z., Nagpala, P., Wang, M., Slightom, J. L. & Gonsalves, D. (1992). Resistance to heterologous isolates of tomato spotted wilt virus in transgenic tobacco expressing its nucleocapsid protein gene. Phytopathology 82, 1223-1229.
Pang, S.-Z., Slightom, J. L. & Gonsalves, D. (1993a). The biological properties of a distinct tospovirus and sequence analysis of its S RNA. Phytopathology 83, 728-733.
Pang, S.-Z., Slightom, J. L. & Gonsalves, D. (1993b). Different mechanisms protect transgenic tobacco against tomato spotted wilt and impatiens necrotic spot Tospoviruses. Biotechnology 11, 819-824.[Medline]
Pang, S.-Z., Jan, F.-J., Carney, K., Stout, J., Tricoli, D. M., Quemada, H. D. & Gonsalves, D. (1996). Post-transcriptional transgene silencing and consequent tospovirus resistance in transgenic lettuce are affected by transgene dosage and plant development. Plant Journal 9, 899-909.
Pang, S.-Z., Jan, F.-J. & Gonsalves, D. (1997). Nontarget DNA sequences reduce the transgene length necessary for RNA-mediated tospovirus resistance in transgenic plants. Proceedings of the National Academy of Sciences, USA 94, 8261-8266.
Prins, M. & Goldbach, R. (1996). RNA-mediated virus resistance in transgenic plants. Archives of Virology 141, 2259-2276.[Medline]
Prins, M., Resende, R. de O., Anker, C., van Schepen, A., de Haan, P. & Goldbach, R. (1996). Engineered RNA-mediated resistance to tomato spotted wilt virus is sequence specific. Molecular PlantMicrobe Interactions 9, 416-418.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanford, J. C. & Johnston, S. A. (1985). The concept of parasite-derived resistance deriving resistance genes from the parasites own genome. Journal of Theoretical Biology 113, 395-405.
Seymour, G. B., Fray, R. G., Hill, P. & Tucker, G. A. (1993). Down-regulation of two non-homologous tomato genes with a single chimaeric sense gene construct. Plant Molecular Biology 23, 1-9.[Medline]
Sijen, T., Wellink, J., Hiriart, J. B. & van Kammen, A. (1996). RNA-mediated virus resistance: role of repeated transgenes and delineation of targeted regions. Plant Cell 8, 2277-2294.[Abstract]
Smith, H. A., Swaney, S. L., Parks, T. D., Wernsman, E. A. & Dougherty, W. G. (1994). Transgenic plant virus resistance mediated by untranslatable sense RNAs: expression, regulation, and fate of nonessential RNAs. Plant Cell 6, 1441-1453.[Abstract]
Tanzer, M. M., Thompson, W. F., Law, M. D., Wernsman, E. A. & Uknes, S. (1997). Characterization of post-transcriptionally suppressed transgene expression that confers resistance to tobacco etch virus infection in tobacco. Plant Cell 9, 1411-1423.[Abstract]
van den Boogaart, T., Lomonossoff, G. P. & Davies, J. W. (1998). Can we explain RNA-mediated virus resistance by homology-dependent gene silencing? Molecular PlantMicrobe Interactions 11, 717-723.
Waterhouse, P. M., Graham, M. W. & Wang, M. B. (1998). Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proceedings of the National Academy of Sciences, USA 95, 13959-13964.
Wilson, T. M. A. (1993). Strategies to protect crop plants against viruses: pathogen-derived resistance blossoms. Proceedings of the National Academy of Sciences, USA 90, 3134-3141.
Received 16 July 1999; accepted 14 September 1999.