Research Article

Transactivation activity of the human cytomegalovirus IE2 protein occurs at steps subsequent to TATA box-binding protein recruitment

Journal of General Virology 2000; 81(1):37

PubMed

With thanks to our partners for supporting this archive.

Abstract

The IE2 protein of human cytomegalovirus transactivates viral and cellular promoters through a wide variety of cis-elements, but the mechanism of its action has not been well characterized. Here, IE2Sp1 synergy and IE2TATA box-binding protein (TBP) interaction are examined by artificial recruitment of either Sp1 or TBP to the promoter. It was found that IE2 could cooperate with DNA-bound Sp1. A 117 amino acid glutamine-rich fragment of Sp1, which can interact with Drosophila TAFII110 and human TAFII130, was sufficient for the augmentation of IE2-driven transactivation. In binding assays in vitro, IE2 interacted directly with the C-terminal region of Sp1, which contains the zinc finger DNA-binding domain, but not with its transactivation domain, suggesting that synergy between IE2 and the transactivation domain of Sp1 might be mediated by other proteins such as TAF or TBP. It was also found that TBP recruitment to the promoter markedly increased IE2-mediated transactivation. Thus, IE2 acts synergistically with DNA-bound Sp1 and DNA-bound TBP. These results suggest that, in human cytomegalovirus IE2 transactivation, Sp1 functions at an early step such as recruitment of TBP and IE2 acts to accelerate rate-limiting steps after TBP recruitment.
Human cytomegalovirus (HCMV), a member of the Betaherpesvirinae, is endemic among the human population. Similar to other herpesviruses, HCMV expresses its genes in three temporal classes: immediate-early (IE), early and late (reviewed by Mocarski, 1996 ). The IE genes encode the first set of proteins expressed upon infection, some of which are involved in modulating subsequent events in the virus life-cycle.

One of the most intensely studied IE genes of HCMV is IE2. This 86 kDa phosphonucleoprotein appears to regulate the switch in viral gene expression between the immediate-early and later stages of the HCMV life-cycle. IE2 is a promiscuous transactivator of many cellular and viral promoters, particularly when acting in conjunction with IE1, another IE gene of HCMV (Hermiston et al., 1987 ; Malone et al., 1990 ; Biegalke & Geballe, 1991 ; Hagemeier et al., 1992a , b ; Arlt et al., 1994 ; Lukac et al., 1994 ; Choi et al., 1995 ; Schwartz et al., 1996 ; Yoo et al., 1996 ; Kim et al., 1999 ). Some aspects of IE2-mediated transcriptional activation are thought to occur via TFIID through direct interaction of IE2 with the TATA box-binding protein (TBP) (Hagemeier et al., 1992b ; Jupp et al., 1993 ). Other studies have revealed that IE2 also binds to additional cellular proteins including TFIIB, Sp1, CBP and Egr-1 (Caswell et al., 1993 ; Lukac et al., 1994 ; Schwarz et al., 1996 ; Yoo et al., 1996 ; Yurochko et al., 1997 ). However, the precise mode by which IE2 activates transcription and the mechanism of synergistic cooperation between IE1 and IE2 are not yet fully understood.

Sp1 is a transcription factor that binds to specific GC-rich elements (Dynan & Tjian, 1983a , b ). It is derived from a single gene product (Kadonaga et al., 1987 ) and is heavily modified post-translationally. Sp1 is important in the regulation of cellular transcription and is utilized in the regulation of both herpesvirus and non-herpesvirus gene products (Everett et al., 1983 ; Jones et al., 1986 ; Wu et al., 1998 ). It has been reported that Sp1 activity is upregulated by HCMV infection and that IE2 can interact physically with Sp1 and can cooperate functionally with Sp1 to increase promoter transactivation (Yurochko et al., 1997 ; Wu et al., 1998 ). Furthermore, an enhancement of Sp1 DNA-binding activity by IE2 is suggested as one model of Sp1IE2 synergy (Yurochko et al., 1997 ; Wu et al., 1998 ). However, this perspective does not address the possibility that IE2 may also act synergistically with Sp1 after it binds a promoter.

The binding of TBP or the multisubunit TFIID to the TATA element is the first of a series of steps required for assembly of a transcription-initiation complex on a promoter (Buratowski et al., 1989 ; Koleske & Young, 1994 ). For productive transcription to occur, it is believed that activators bound to upstream enhancers can influence the recruitment of TBP and TBP-associated factors (TAFs) to the TATA box, which in turn modulate the docking of the RNA polymerase (RNAP) II holoenzyme at the initiator site (Struhl, 1996 ). Consistent with this model, DNA-bound activators have been found to associate with components of the general transcription machinery including TBP, TAFs, TFIIA and TFIIB (Stringer et al., 1990 ; Lin et al., 1991 ; Tjian & Maniatis, 1994 ; Kobayashi et al., 1995 ). IE2 differs from typical DNA-binding activators as, although it can bind to DNA through the cis repression signal element and its related sequences (Arlt et al., 1994 ; Pizzorno & Hayward, 1990 ), IE2 can also transactivate various promoters in the absence of DNA binding (Hagemeier et al., 1992a ; Lukac et al., 1994 ). IE2 has been shown to interact directly with TBP (Hagemeier et al., 1992b ) and to stabilize the binding of TBP to the TATA box in vitro (Jupp et al., 1993 ). Although this IE2TBP interaction is consistent with the promiscuous nature of IE2-mediated transactivation of various promoters, it is not yet clear whether stabilization of TBP binding is necessary and/or sufficient for the functional effects of IE2. Furthermore, the fact that IE2 can interact with promoter-bound TBP suggests that IE2 may function at steps subsequent to TBP recruitment.

In this study, we focused on the synergy between Sp1 and IE2 and the relationship between TBP and IE2, in order to understand the mechanism of IE2-mediated transactivation. To investigate the molecular mechanism of the Sp1IE2 synergy, we addressed several questions. (i) Can artificial recruitment of Sp1 bypass a requirement for IE2? (ii) Which domain of Sp1 is required for the augmentation of IE2-mediated transactivation? (iii) Is proteinprotein interaction between IE2 and Sp1 required for Sp1IE2 synergy? In addition, we analysed whether artificial recruitment of TBP could bypass the requirement for IE2. Our results demonstrated that IE2 can cooperate with Sp1 that is already bound to DNA and that a 117 amino acid glutamine-rich fragment of Sp1 was sufficient for the augmentation of IE2-driven transactivation. In addition, we showed that IE2 did not interact directly with the transactivation domain of Sp1, but with the C-terminal region that contains the zinc finger DNA-binding domain, suggesting that other proteins such as human (h) TAFII130 may mediate the Sp1IE2 interaction. Finally, our data also suggested that IE2 functions at a limiting event(s) after recruitment of TBP to the promoter.

Plasmids.
We used pEQ326 as a mammalian IE2 expression vector (Biegalke & Geballe, 1991 ). This plasmid contains the HCMV IE gene region, including the promoter, but lacks exon 4, which specifies IE1. Therefore pEQ326 expresses only IE2. As controls, pEQ336, which contains only the HCMV major IE promoter (MIEP), and pEQ273, which expresses IE1 under the control of HCMV MIEP, were used. Bacterial expression vectors for maltose-binding protein (MBP)-fusion proteins, pMBP-IE2 and pMBP-IE1-4, were described previously (Choi et al., 1995 ; Kim et al., 1996 ). pMBP-IE2 contains the full-length IE2 cDNA sequence. pMBP-IE1-4 containing the exon 4 region of IE1 sequence is identical to pMBP-IE1 described by Kim et al. (1996) .

A series of human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) mutant plasmids (p938, pΔκB, pΔSp1 and pΔTATA) were described previously (Kim et al., 1996 ). Reporter plasmids containing GAL4-binding sites (GAL4BS) were described by Xiao et al. (1997) . Plasmid pGAL-E1b-CAT contains the E1b TATA element (-34 to -22 of the adenovirus E1b promoter region) upstream of the CAT gene and five 17-mer GAL4BS upstream of position -34. Plasmid pGAL-HIV-CAT contains sequences from -43 to +80 of the HIV-1 promoter region with four 17-mer GAL4BS positioned upstream of -43 and CAT positioned downstream of +80. Plasmid pGAL-HIV-CAT/TG is identical to pGAL-HIV-CAT except that the TATAA element has been mutated to TGTAA.

An expression vector pGAL4-VP16, encoding the GAL4 DNA-binding domain (GAL4BD; amino acids 1147) fused to the N-terminal activation domain of VP16 (amino acids 413490), was reported previously (Chun & Jeang, 1996 ). Most of the GAL4Sp1 expression plasmids were reported previously (Gill et al., 1994 ; Emami et al., 1995 ); all plasmids express a fusion protein containing the GAL4BD (amino acids 1147) and a portion of Sp1. pGAL4-Sp1 contains Sp1 amino acids 83778 and is the same as GAL4-Sp1WT of Gill et al. (1994) . pGAL4-Sp1(A), pGAL4-Sp1(B) and pGAL4-Sp1(BC) contain Sp1 amino acids 83262, 263542 and 425542, respectively. pGAL4-Sp1(BN) contains Sp1 amino acids 263448 and was constructed by inserting a fragment from pGAL4-Sp1(B) into expression vector pBXG1 (Emami et al., 1995 ). The GAL4Sp1(BN) fragment was amplified by PCR with the following primers complementary to the 5' end of the GAL4 fragment and to the 3' end of Sp1(BN) domain, respectively: 5' AAGCTTCCTGAAAGATGAAGCTA 3' and 5' GATTTCTAGATTACACTGTTGGTGTCCGGAT 3'. The amplified products were cleaved with HindIII and XbaI and inserted into the same sites in plasmid pBXG1, resulting in pGAL4-Sp1(BN). The expression vectors encoding the GAL4BD (amino acids 1147) fused to hTBP (amino acids 2339), hTBPΔN (amino acids 94339) or hTBPM3 were reported previously (Xiao et al., 1997 ).

For in vitro transcription and translation, a series of Sp1 deletion mutant expression vectors were constructed. For construction of pCR2.1-Sp1(83778), pCR2.1-Sp1(83621) and pCR2.1-Sp1(543778), Sp1 cDNAs encoding amino acids 83778, 83621 and 543778 were generated by PCR using pGAL4-Sp1 as template and the appropriate oligonucleotide primers. The sequences of the primers used were as follows: 5' primer for Sp1(83778) and Sp1(83621), 5' GAATTCATGACAGGTGAGCTTGACCTC; 5' primer for Sp1(543778), 5' GAATTCATGCTGCCGTTGGCTATAGCA; 3' primer for Sp1(83778) and Sp1(543778), 5' TCTAGATCAGAAGCCATTGCCACTGAT; and 3' primer for Sp1(83621), 5' TCTAGATCAGCAAATATGCTGTTTCTT. The amplified DNA fragments were cloned into the pCR2.1 vector (Invitrogen).

DNA transfection.
Promoter activities were assessed by transiently transfecting BHK21 and human foreskin fibroblast (HFF) cells with promoterCAT constructs and assaying for CAT activity. Procedures for DEAEdextran transient transfection, CAT assay and quantification have been described previously (Choi et al., 1995 ). The total amount of DNA per transfection was always adjusted to the same amount within each experiment by using appropriate control plasmids.

IE2Sp1 binding assay.
To generate in vitro-translated proteins, expression vector DNA (1 µg) was incubated with a TNT-coupled reticulolysate system (Promega) in the presence of [35S]methionine as described previously (Choi et al., 1995 ). MBP-fusion protein expression and purification were carried out as described previously (Choi et al., 1995 ).

For protein-binding assays, 500 ng MBP-fusion protein, on beads, was rocked for 3 h at 4 °C with 5 µl in vitro-translated test protein in a final volume of 250 µl in buffer A (100 mM TrisHCl, pH 7·4, 140 mM NaCl, 0·5% Nonidet P-40,1 mM DTT, 0·1 mM PMSF). The beads were then washed five times in 1 ml buffer A, pelleted at 500 g for 30 s and boiled in 4x SDSPAGE sample buffer. Gels were fixed and incubated with a fluorograph for 30 min prior to drying and autoradiography.

Role of the Sp1 sites in IE2-mediated transactivation
Because the HIV-1 LTR has been shown to be highly activated by IE2 and cis-acting sequences of this promoter have already been well characterized (Biegalke & Geballe, 1991 ; Hagemeier et al., 1992b ; Choi et al., 1995 ), we first used the HIV-1 LTR to analyse the transactivational activity of IE2. To identify the nucleotide sequences responsible for IE2-mediated transactivation, we used a series of mutants that specifically lacked one of the three major transcriptional elements of the HIV-1 LTR promoter, NF-κB, Sp1 and the TATA box. pΔκB has point mutations in the κB sites, as reported by Nabel & Baltimore (1987) , whereas the Sp1 sites and TATA box were selectively removed and replaced by restriction linkers in plasmids pΔSp1 and pΔTATA, as reported previously (Kim et al., 1996 ). These mutant constructs were transfected into BHK21 cells and transient expression of the CAT gene was used to measure the contribution of these elements to IE2-driven transactivation of the HIV LTR. As shown in Fig. 1, mutation of the κB sites had little effect on both basal and IE2-mediated gene expression from the LTR. Mutations in the TATA box slightly lowered CAT activity, but overall the magnitude of activation did not change. In contrast, removal of the three Sp1 sites lowered significantly the ability of the LTR to respond to IE2. These results suggested that Sp1-binding sites could play an important role in IE2-mediated transactivation of the HIV-1 LTR.



(13K):

Fig. 1. Different activation patterns by HCMV IE2 on various mutants of the HIV-1 LTR. Point mutations are indicated by x. BHK21 cells were transfected with 1 µg mutant HIV-1 LTRCAT fusion constructs in the presence or absence of 2 µg IE2-expressing plasmid pEQ326 (Biegalke & Geballe, 1991 ) by the DEAEdextran method. As a control for plasmid pEQ326, pEQ336 containing no IE coding sequence was used to maintain an equal total amount of DNA in the transfections. Cells were harvested and assayed for CAT activity 48 h after transfection. Transfection and CAT assays were performed more than four times for each construct. Relative CAT activity was calculated by dividing each activity by the activity of cells transfected with p938 without IE2.

IE2 cooperates with DNA-bound Sp1
It has been reported that IE2 can increase the DNA-binding activity of Sp1 (Yurochko et al., 1997 ; Wu et al., 1998 ). To test whether the IE2Sp1 synergy is due solely to an increase in Sp1 DNA-binding activity by IE2, we devised an experiment to test whether activation of a minimal adenovirus E1b promoter by artificial recruitment of Sp1 would bypass a requirement for IE2. We used a fusion construct containing the DNA-binding domain of GAL4 (GAL4BD; amino acids 1147) fused to Sp1 (amino acids 83778). As a control, a GAL4BDVP16 fusion protein was used, which contains the activation domain of VP16 (amino acids 413490) in place of Sp1. For functional readouts, we used a minimal promoterCAT reporter (pGAL-E1b-CAT) containing five synthetic GAL4BS and the adenovirus E1b TATA element from -34 to -22. It has been shown previously that the pGAL-E1b-CAT reporter permits artificial docking of GAL4BDactivator fusion proteins to the five upstream GAL4BS, thereby recruiting these factors to an E1b promoter-proximal location (Xiao et al., 1997 ). In this context, if IE2 functions simply by recruiting Sp1 to the promoter, the artificial tethering of Sp1 via the GAL4BDGAL4BS interaction should bypass the requirement for IE2. On the other hand, if IE2 functions other than by Sp1 recruitment, an activatorIE2 combination should be additive or synergistic.

First, we examined the ability of IE2 to cooperate with Sp1. BHK21 cells were transfected with pGAL-E1b-CAT and pGAL4-Sp1 in the presence or absence of an IE2-expressing plasmid. At 48 h post-transfection, CAT activities were quantified in the linear range of the enzyme assay. As shown in Fig. 2, GAL4Sp1 activated pGAL-E1b-CAT expression in the absence of IE2. However, the addition of IE2 resulted in a further activation that was 8-fold greater than that seen with GAL4Sp1 alone. As a control, a similar experiment was performed with GAL4VP16. VP16 greatly increased the CAT activity from pGAL-E1b-CAT, but IE2 had no effect on such activation. The synergy between IE2 and Sp1 was specific for IE2, since IE1 had little effect on Sp1-mediated transactivation under the same conditions. We obtained similar results by using HFF cells, which are known to be permissive for HCMV infection (data not shown). These results suggested that IE2 could cooperate with DNA-bound Sp1 and that the synergy between Sp1 and IE2 might not only be due to enhancement of Sp1 DNA-binding by IE2.



(21K):

Fig. 2. Activation of the E1b promoter by GAL4Sp1 or GAL4VP16 in the presence or absence of HCMV IE2. As a reporter plasmid, the pGAL-E1b-CAT fusion construct was used in transfections. It contains sequences from -34 to -22 of the adenovirus E1b promoter region containing the E1b TATA element, with five 17-mer GAL4BS positioned upstream of -34 and CAT positioned downstream of -22. pGAL4-Sp1 and pGAL4-VP16 were used as activator plasmids. BHK21 cells were transfected by DEAEdextran with 1 µg pGAL-E1b-CAT and 2 µg of the GAL4-fusion constructs together with 2 µg of either the control plasmid pEQ336, the IE1-expressing plasmid pEQ273 or the IE2-expressing plasmid pEQ326. Transfections and CAT assays were done as described in Fig. 1 and performed at least three times for each construct. Relative CAT activity was calculated by dividing each activity by the activity of cells co-transfected with pGAL-E1b-CAT and pGAL4(1147) in the absence of the IE proteins. The latter plasmid contains only the GAL4BD.

A 117 amino acid glutamine-rich fragment of Sp1 is sufficient for the augmentation of IE2-driven transactivation
To localize the domains of Sp1 involved in the IE2-mediated transactivation, various N-terminal Sp1 subfragments were tested as GAL4-fusion proteins. Previous studies of Sp1 in cultured Drosophila cells revealed that the N terminus contains two distinct domains, A and B, each containing a glutamine-rich stretch and an adjacent region rich in serines and threonines (Courey & Tjian, 1988 ). In mammalian cells, each of the glutamine-rich domains alone was found to be sufficient for transcriptional activation (Gill et al., 1994 ). Moreover, the C-terminal half of the B domain (BC) was found to activate transcription to a similar extent as the entire B domain, but the N-terminal half (BN) was inactive (Gill et al., 1994 ).

BHK21 cells were transfected with pGAL-E1b-CAT together with plasmids that expressed the GAL4 DNA-binding domain fused to the A, B, BN or BC subdomains of Sp1 in the presence or absence of IE2-expressing plasmids. The analysis of CAT activity showed that the A, B and BC fragments of Sp1 could all augment IE2-mediated transactivation to a similar extent as the full-length Sp1 (Fig. 3), but GAL4Sp1(BN) enhanced IE2-mediated transactivation only weakly. It has been shown previously that BN alone does not interact with Drosophila (d) TAFII110 (Gill et al., 1994 ). This suggests that a direct interaction between Sp1 and hTAFII130, the human homologue of dTAFII110, may underlie the augmentation of IE2-mediated transactivation.



(20K):

Fig. 3. Effects of the various Sp1 deletion mutants on transcriptional activation of the E1b promoter. One µg pGAL-E1b-CAT and 2 µg of each GAL4BD-fused Sp1 deletion mutant were co-transfected with or without the IE2-expressing plasmid pEQ326. pEQ336 was used as a control plasmid to keep the total amount of DNA in each transfection the same. Transfections and CAT assays were done as described in Fig. 1 and performed more than four times for each construct. Relative CAT activity was calculated by dividing each activity by the activity of cells co-transfected with pGAL-E1b-CAT and pGAL4(1147) in the absence of IE2.

IE2 interacts directly with the C-terminal region of Sp1
It has been reported that IE2 can interact with Sp1 in vitro (Lukac et al., 1994 ; Yurochko et al., 1997 ). To localize the domain of Sp1 that interacts with the IE2 protein, an in vitro binding assay was performed by using an MBPIE2 fusion protein and three in vitro-translated, [35S]methionine-labelled Sp1 proteins; the full-length Sp1 protein (83778), Sp1(83621), containing only the N-terminal domain, and Sp1(543778), containing the C-terminal zinc finger domain. As expected from the findings of Yurochko et al. (1997) , the full-length, [35S]methionine-labelled Sp1 protein was retained by the MBPIE2 resin (Fig. 4, lane 3) and MBPIE1-4 (lane 4), but not by the resin containing MBP alone (lane 2). Similarly, in vitro-translated and radiolabelled Sp1(543778) bound the MBPIE2 resin (Fig. 4, lane 11) and the MBPIE1-4 resin (lane 12), but not the control resin (lane 10). Sp1(83621) was retained by MBPIE1-4 resin (lane 8) but not by the resin containing MBP or MBP-IE2 (lanes 6 and 7). Taken together, these results demonstrate that IE2 interacts directly with the C-terminal region of Sp1, which contains the zinc finger DNA-binding domain, but not with the activation domain. Therefore, the synergy between IE2 and the activation domain of Sp1 does not appear to require direct proteinprotein interaction.



(38K):

Fig. 4. Identification of the Sp1 domain that interacts with IE2. Various [35S]methionine-labelled Sp1 domains were generated by in vitro transcription and translation. Labelled proteins were incubated with an affinity matrix containing MBP (lanes 2, 6 and 10), MBPIE2 (lanes 3, 7 and 11) or MBPIE1-4 (lanes 4, 8 and 12) synthesized in E. coli. The bound proteins were subjected to SDSPAGE and visualized by autoradiography. One-fifth of the amount of [35S]methionine-labelled Sp1 used in the binding reaction was used as a marker (Input; lanes 1, 5 and 9).

IE2 functions after TBP recruitment
The previous findings suggested that the BC transactivation domain of Sp1 was sufficient to confer augmentation of IE2-mediated transactivation. This region of Sp1 has been demonstrated to interact with hTAFII130 (Saluja et al., 1998 ), which in turns binds to TAFII250, thereby bridging Sp1 with TBP (Chen et al., 1994 ).

TBP recruitment to the promoter is an early defining step of initiation-complex formation (Stargell & Struhl, 1996 ; Struhl, 1996 ; Ptashne & Gann, 1997 ). To characterize more precisely the function(s) of IE2 in transcription, we asked whether artificial recruitment of TBP could bypass the requirement for IE2. We approached this question by using a GAL4BDhTBP hybrid protein that, when assayed for its ability to enhance transcription from the pGAL-E1b-CAT plasmid, addresses whether recruitment of TBP is a rate-limiting step accelerated by IE2. Because GAL4 binds DNA even when packaged into nucleosomes, in principle, GAL4hTBP would be recruited efficiently to the GAL4BS in plasmid pGAL-E1b-CAT. Accordingly, if the function of IE2 is only to recruit TBP to the promoter, then artificial tethering of TBP via the GAL4BDGAL4BS interaction should bypass the requirement for IE2. Indeed, this type of tethering approach has been used to document TBP recruitment as a major rate-limiting step in transcription from many yeast promoters (Chatterjee & Struhl, 1995 ; Xiao et al., 1995 ).

BHK21 cells were transfected with plasmids pGAL-E1b-CAT and pGAL4-hTBP in the presence or absence of an IE2-expressing plasmid. At 48 h after transfection, CAT activities were quantified in the linear range of the enzyme assay. As shown in Fig. 5, GAL4hTBP activated pGAL-E1b-CAT expression in the absence of IE2. Addition of IE2 resulted in a 5-fold greater activation than was seen with either GAL4hTBP or IE2 alone. Synergy with TBP was specific for IE2, since IE1 had little effect on TBP-mediated transactivation under the same conditions. We obtained similar results with another reporter construct, pGAL-HIV-CAT, which contains four synthetic GAL4BS and the HIV-1 TATATAR sequences from -43 to +80 (data not shown). We also obtained similar results by using HFF cells, which are known to be permissive for HCMV infection (data not shown). The slight increase in minimal E1b promoter activity in the presence of IE2 alone is due presumably to the constitutive docking of some native hTBP at the pGAL-E1b-CAT TATA element. Overall, these results are consistent with a simple interpretation that IE2 can act at one or more steps after TBP recruitment.



(18K):

Fig. 5. Activation of the E1b promoter by GAL4hTBP or GAL4hTBPΔN in the presence or absence of IE2. pGAL-E1b-CAT was used in the transfections as a reporter plasmid and plasmids pGAL4-hTBP and pGAL4-hTBPΔN were used as activator plasmids. pGAL4-hTBP contains the entire hTBP fused to the GAL4BD; pGAL4-hTBPΔN is identical to pGAL4-hTBP except that the N-terminal amino acids 193 were deleted. BHK21 cells were co-transfected by DEAEdextran with 1 µg pGAL-E1b-CAT together with 2 µg of either the control plasmid pEQ336, the IE1-expressing plasmid pEQ273 or the IE2-expressing plasmid pEQ326. Transfections and CAT assays were done as described for Fig. 1 and performed at least three times for each construct. Relative CAT activity was calculated by dividing each activity by the activity of cells co-transfected with pGAL-E1b-CAT and pGAL4(1147) in the absence of the IE proteins.

TBP has been described as possessing a fortuitous activation domain (Seipel et al., 1993 ). Hence, an alternative interpretation of the above results could be that GAL4hTBP did not provide natural TBP function at the promoter (i.e. interaction of GAL4hTBP with TATA followed by recruitment of RNAP II holoenzyme) but instead functioned simply as a conventional upstream activator, working in a manner similar to Sp1, in recruiting endogenous hTBP to TATA. To exclude such a possibility, control experiments were performed. First, we used the pGAL4-hTBPΔN expression plasmid, which is the same as pGAL4-hTBP except that the N-terminal amino acids 193 were deleted. It was reported previously that the TBP N-terminal region acts as an auxiliary activation domain that reinforces the activity of other promoter-bound factors (Seipel et al., 1993 ). We asked whether GAL4hTBPΔN would yield equivalent findings when assayed in place of GAL4hTBP. We observed that deletion of the activation domain of hTBP had no effect on the IE2hTBP synergy (Fig. 5). Thus, the N-terminal activation domain of TBP does not contribute to IE2-mediated transactivation.

Second, we compared GALhTBP with a mutant derivative, GAL4hTBPM3, for their ability to activate transcription from a TGTA element in the HIV-1 promoter. Previous studies have shown that an A-to-G substitution at the second position of TATA greatly reduces its affinity for TBP and that promoters with TGTA elements are transcriptionally inactive in both yeast and human cells (Strubin & Struhl, 1992 ; Tansey et al., 1994 ). It has been demonstrated that a TGTA promoter can be trans-complemented with an altered-specificity TBP mutant, TBPM3 (Strubin & Struhl, 1992 ). We therefore used this property to analyse TBPIE2 synergy, by using pGAL-HIV-CAT/TG, which was identical to pGAL-HIV-CAT except that the HIV-1 TATAA was changed to TGTAA. We reasoned that if TBP in GAL4hTBP functions by direct binding to the TATA element, one would expect the A-to-G change to affect transcription dramatically from a TGTA promoter mediated through wild-type GAL4hTBP but not through GAL4hTBPM3. Indeed, the A-to-G substitution dramatically reduced synergistic activation by wild-type GAL4hTBP and IE2, but had a minimal affect on synergy between mutant GAL4hTBPM3 and IE2 (Fig. 6). Since endogenous hTBP cannot dock at TGTA, if GAL4hTBPM3 supplied an activation domain function for purposes of recruiting endogenous hTBP, one would not expect to see an increase in IE2-dependent activity from the TGTA promoter. The fact that activation was observed is fully consistent with a model of IE2 action at a step after recruitment of mutant GAL4hTBPM3 at TGTA or wild-type GAL4hTBP at TATA.



(26K):

Fig. 6. Effects of TATA mutations on transcriptional activation of the HIV-1 promoter by GAL4hTBP or GAL4hTBPM3 fusion proteins in the presence or absence of IE2. pGAL-HIV-CAT and pGAL-HIV-CAT/TG were used as reporter plasmids. pGAL-HIV-CAT/TG is identical to pGAL-HIV-CAT except that the TATAA element has been changed to TGTAA by site-directed mutagenesis. pGAL4-hTBP and pGAL4-hTBPM3 were used as activator plasmids. pGAL4-hTBPM3 is the same as pGAL4-hTBP except that it contains three point mutations in the conserved core domain, which confer a new DNA-recognition specificity to TBP for the TGTAA sequence. However, this mutant TBP still retains the ability to recognize the wild-type TATAA sequence. The interactions of wild-type GAL4hTBP and mutant GAL4hTBPM3 fusion proteins with wild-type TATA or mutant TGTA elements are presented schematically in (A) and (B), respectively. Relative CAT activities are shown after transfection of 1 µg reporter plasmid and 2 µg of either pGAL4-hTBP or pGAL4-hTBPM3, with or without 2 µg of an IE2-expressing plasmid, pEQ326, into BHK21 cells by DEAEdextran. Transfection and CAT assays were performed as for Fig. 1 and done more than four times. Relative CAT activity was calculated by dividing each activity by the activity of cells co-transfected with pGAL-HIV-CAT and either pGAL4-hTBP (A) or pGAL4-hTBPM3 (B) in the absence of IE2.

Supplying the activation domain of Sp1 can bypass the requirement for the TATA box in IE2-mediated transactivation
The data shown in Fig. 6 suggested that the TATA box was essential for IE2-mediated transactivation of the HIV-1 LTR containing only the minimal portion of promoter elements. This result is consistent with the previous report that IE2 transactivates heterologous promoters in a TATA box-dependent manner (Hagemeier et al., 1992b ). On the other hand, the result shown in Fig. 1 indicated that mutations in the TATA box did not abolish IE2-mediated transactivation of HIV-1 LTR. The difference between these two experiments producing seemingly contradictory results is that pΔTATA used in the experiment shown in Fig. 1 contains binding sites for various upstream transcription factors including Sp1, while pGAL-HIV-CAT/TG used in the experiment shown in Fig. 6 contains the minimal region of LTR starting from -43. Because Sp1 appears to play an important role in IE2-mediated transactivation, we tested whether artificial recruitment of Sp1 could affect the dependence of IE2-mediated transactivation on the TATA box.

pGAL-HIV-CAT/TG was co-transfected into BHK21 cells together with pGAL4-Sp1, pGAL4-Sp1BN or pGAL4-Sp1BC in the presence or absence of an IE2-expressing plasmid. The analysis of CAT activity showed that, in the presence of full-length Sp1 or the truncated Sp1 containing only the BC transactivation domain, IE2 could greatly activate gene expression from the promoter containing the mutated TATA box (Fig. 7). IE2 had little effect on that promoter in the presence of Sp1 containing only the BN subdomain. These results suggested that the presence of the activation domain of Sp1 alone could allow IE2 to bypass the requirement for the TATA box in its transactivation of the promoter.



(19K):

Fig. 7. Effects of the various Sp1 deletion mutants on transcriptional activation of the HIV-1 LTR containing the mutated TATA sequence. One µg pGAL-HIV-CAT/TG and 2 µg of plasmids expressing each GAL4BD-fused Sp1 deletion mutant were co-transfected with or without the IE2-expressing plasmid pEQ326. pEQ336, containing no IE2 coding sequence, was used as a control plasmid to keep the total amount of DNA in each transfection the same. Transfections and CAT assays were done as described in Fig. 1 and performed more than four times for each GAL4-fusion construct. Relative CAT activity was calculated by dividing each activity by the activity of cells co-transfected with pGAL-HIV-CAT/TG and pGAL4(1147) in the absence of IE2.
In this study, we have demonstrated that IE2 can cooperate with DNA-bound Sp1 and DNA-bound TBP to enhance transcription. Taken together, these observations suggest that Sp1 may provide the required first step that allows for subsequent IE2 activation by recruiting TBP (Emili et al., 1994 ; Blau et al., 1996 ).

Artificial recruitment of Sp1 to the promoter through its attachment to a heterologous DNA-binding domain can trigger gene transcription. Addition of IE2 can augment such Sp1-mediated transactivation, suggesting that IE2 can cooperate with DNA-bound Sp1. Analysis of a series of Sp1 deletion mutants revealed that the BC subdomain of Sp1 is sufficient for the augmentation of IE2-mediated transactivation, while the BN subdomain had little effect. It has been reported previously that the BC domain can interact with hTAFII130, while the BN subdomain of Sp1 failed to interact with hTAFII130 (Saluja et al., 1998 ). Therefore, it is possible that the interaction between Sp1 and hTAFII130 may be important for IE2Sp1 synergy.

The interaction between IE2 and Sp1 appears to be mediated by the C terminus of Sp1, which contains the zinc finger DNA-binding domain. It has been suggested previously that zinc fingers, in addition to binding DNA and RNA, may mediate proteinprotein interactions. For instance, the zinc fingers of YY1 have been shown to be involved in physical interactions with Sp1, p300 and bZIP-containing proteins such as CREB (Lee et al., 1993 , 1995 ; Zhou et al., 1995 ). IE2 has also been shown to interact with the zinc fingers of Egr-1 (Yoo et al., 1996 ). The observation that IE2 can interact directly with the DNA-binding domain of Sp1 may underlie the enhancement of Sp1 DNA-binding activity by IE2 (Wu et al., 1998 ). It has been reported that HIV-1 Tat interacts directly with Sp1 and that Tat cooperates with DNA-bound Sp1 (Jeang et al., 1993 ; Xiao et al., 1997 ). The interaction between these two proteins appears to modulate Sp1 phosphorylation in a double-stranded DNA-dependent protein kinase-dependent manner (Chun et al., 1998 ). Because IE2 has features similar to Tat in regard to its relationship with Sp1, it will be interesting to test whether IE2 can regulate the function of Sp1 by modulating the phosphorylation of this protein.

IE2 has been shown to interact with TBP (Hagemeier et al., 1992b ) and to stabilize the binding of TBP to the TATA box (Jupp et al., 1993 ). However, it is not yet clear whether IE2 can function at steps after TBP recruitment. To test whether IE2 can act at steps subsequent to TBP recruitment, we posed a simple question: would artificial recruitment of hTBP to the promoter bypass a transcriptional requirement for IE2? We found that GAL4BD-based recruitment of TBP alone could increase expression from a minimal promoter, but that the addition of IE2 to this ensemble increased transcription markedly from the promoter. These findings suggest that the IE2 enhancement of promoter function occurs at steps after TBP recruitment. Deletion of the N-terminal activation domain of TBP had little effect on IE2TBP cooperation, suggesting that IE2-activated transcription probably occurs through an IE2-dependent step after TBP recruitment rather than as a consequence of interactions between the activation domain of TBP and IE2. When considered in the context of a two-step model of transcriptional activation (Stargell & Struhl, 1996 ), the upstream DNA-bound factors such as Sp1 serve primarily to recruit TBP, whereas the IE2 protein appears to act at later steps.

It has been reported that the TATA box is essential for IE2-mediated transactivation (Hagemeier et al., 1992b ). Our finding that an A-to-G substitution in the HIV-1 TATA box dramatically reduced synergistic activation by hTBP and IE2 is consistent with the previous report (Hagemeier et al., 1992b ). However, in the presence of the activation domain of Sp1, IE2 can greatly activate gene expression from the promoter containing the mutated TATA sequence. The glutamine-rich activation domain of Sp1 has been shown to stimulate Inr-containing core promoters preferentially (Emami et al., 1995 ). During IE2 activation, the activation domain of Sp1 appears to be able to recruit TBP independently of the TATA box. Indeed, it was reported that Sp1, possibly through an Sp1TAF interaction, recruits TFIID to an Inr element directly in the absence of a TATA box (Kaufmann & Smale, 1994 ).

Events occurring at the promoter after TBP engagement are numerous and complex (Buratowski et al., 1989 ; Zawel & Reinberg, 1993 ). In this area, one could propose that IE2 functions directly or indirectly to recruit either additional general transcription factors or the RNAP II holoenzyme. Indeed, consistent with such a hypothesis is the fact that IE2 has been shown to interact with transcription factors such as TFIIB and hTAFII130 (Caswell et al., 1993 ; Lukac et al., 1997 ). The observations that IE2 is capable of binding both TFIIB and TBP and that the binding regions overlap but are not identical imply that IE2 may be capable of interacting with both factors simultaneously (Caswell et al., 1993 ). This suggests a model by which IE2 might act through general transcription factors, that is by increasing the rate of assembly of the pre-initiation complex.

We thank Paula Cannon for critical reading of the manuscript. This work was supported by research grants from the Korea Science and Engineering Foundation (96-0403-03-01-3; S.K.) and the Korean Ministry of Science and Technology (G7 project 08-02-02; S.K.) and the Korea Research Foundation made in the program years of 1996 and 1997.

References

Arlt, H., Lang, D., Gebert, S. & Stamminger, T. (1994). Identification of binding sites for the 86-kilodalton IE2 protein of human cytomegalovirus within an IE2-responsive viral early promoter. Journal of Virology 68, 4117-4125.[Abstract/Free Full Text]

Biegalke, B. J. & Geballe, A. P. (1991). Sequence requirements for activation of the HIV-1 LTR by human cytomegalovirus. Virology 183, 381-385.[Medline]

Blau, J., Xiao, H., McCracken, S., OHare, P., Greenblatt, J. & Bentley, D. (1996). Three functional classes of transcriptional activation domain. Molecular and Cellular Biology 16, 2044-2055.[Abstract]

Buratowski, S., Hahn, S., Guarente, L. & Sharp, P. A. (1989). Five intermediate complexes in transcription initiation by RNA polymerase II. Cell 56, 549-561.[Medline]

Caswell, R., Hagemeier, C., Chiou, C.-J., Hayward, G., Kouzarides, T. & Sinclair, J. (1993). The human cytomegalovirus 86K immediate early (IE) 2 protein requires the basic region of the TATA-box binding protein (TBP) for binding, and interacts with TBP and transcription factor TFIIB via regions of IE2 required for transcriptional regulation. Journal of General Virology 74, 2691-2698.[Abstract/Free Full Text]

Chatterjee, S. & Struhl, K. (1995). Connecting a promoter-bound protein to TBP bypasses the need for a transcriptional activation domain. Nature 374, 820-822.[Medline]

Chen, J. L., Attardi, L. D., Verrijzer, C. P., Yokomori, K. & Tjian, R. (1994). Assembly of recombinant TFIID reveals differential coactivator requirements for distinct transcriptional activators. Cell 79, 93-105.[Medline]

Choi, K. S., Kim, S.-J. & Kim, S. (1995). The retinoblastoma gene product negatively regulates transcriptional activation mediated by the human cytomegalovirus IE2 protein. Virology 208, 450-456.[Medline]

Chun, R. F. & Jeang, K. T. (1996). Requirements for RNA polymerase II carboxyl-terminal domain for activated transcription of human retroviruses human T-cell lymphotropic virus I and HIV-1. Journal of Biological Chemistry 271, 27888-27894.[Abstract/Free Full Text]

Chun, R. F., Semmes, O. J., Neuveut, C. & Jeang, K. T. (1998). Modulation of Sp1 phosphorylation by human immunodeficiency virus type 1 Tat. Journal of Virology 72, 2615-2629.[Abstract/Free Full Text]

Courey, A. J. & Tjian, R. (1988). Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55, 887-898.[Medline]

Dynan, W. S. & Tjian, R. (1983a). Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II. Cell 32, 669-680.[Medline]

Dynan, W. S. & Tjian, R. (1983b). The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35, 79-87.[Medline]

Emami, K. H., Navarre, W. W. & Smale, S. T. (1995). Core promoter specificities of the Sp1 and VP16 transcriptional activation domains. Molecular and Cellular Biology 15, 5906-5916.[Abstract]

Emili, A., Greenblatt, J. & Ingles, C. J. (1994). Species-specific interaction of the glutamine-rich activation domains of Sp1 with the TATA box-binding protein. Molecular and Cellular Biology 14, 1582-1593.[Abstract/Free Full Text]

Everett, R. D., Baty, D. & Chambon, P. (1983). The repeated GC-rich motifs upstream from the TATA box are important elements of the SV40 early promoter. Nucleic Acids Research 11, 2447-2464.[Abstract/Free Full Text]

Gill, G., Pascal, E., Tseng, Z. H. & Tjian, R. (1994). A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proceedings of the National Academy of Sciences, USA 91, 192-196.[Abstract/Free Full Text]

Hagemeier, C., Walker, S., Caswell, R., Kouzarides, T. & Sinclair, J. (1992a). The human cytomegalovirus 80-kilodalton but not the 72-kilodalton immediate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID. Journal of Virology 66, 4452-4456.[Abstract/Free Full Text]

Hagemeier, C., Walker, S. M., Sissons, P. J. G. & Sinclair, J. H. (1992b). The 72K IE1 and 80K IE2 proteins of human cytomegalovirus independently trans-activate the c-fos, c-myc and hsp70 promoters via basal promoter elements. Journal of General Virology 73, 2385-2393.[Abstract/Free Full Text]

Hermiston, T. W., Malone, C. L., Witte, P. R. & Stinski, M. F. (1987). Identification and characterization of the human cytomegalovirus immediate-early region 2 gene that stimulates gene expression from an inducible promoter. Journal of Virology 61, 3214-3221.[Abstract/Free Full Text]

Jeang, K. T., Chun, R., Lin, N. H., Gatignol, A., Glabe, C. G. & Fan, H. (1993). In vitro and in vivo binding of human immunodeficiency virus type 1 Tat protein and Sp1 transcription factor. Journal of Virology 67, 6224-6233.[Abstract/Free Full Text]

Jones, K. A., Kadonaga, J. T., Luciw, P. A. & Tjian, R. (1986). Activation of the AIDS retrovirus promoter by the cellular transcription factor, Sp1. Science 232, 755-759.[Abstract/Free Full Text]

Jupp, R., Hoffmann, S., Stenberg, R. M., Nelson, J. A. & Ghazal, P. (1993). Human cytomegalovirus IE86 protein interacts with promoter-bound TATA-binding protein via a specific region distinct from the autorepression domain. Journal of Virology 67, 7539-7546.[Abstract/Free Full Text]

Kadonaga, J. T., Carner, K. R., Masiarz, F. R. & Tjian, R. (1987). Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 51, 1079-1090.[Medline]

Kaufmann, J. & Smale, S. T. (1994). Direct recognition of initiator elements by a component of the transcription factor IID complex. Genes & Development 8, 821-829.[Abstract/Free Full Text]

Kim, S., Yu, S. S. & Kim, V. N. (1996). Essential role of NF-κB in transactivation of the human immunodeficiency virus long terminal repeat by the human cytomegalovirus IE1 protein. Journal of General Virology 77, 83-91.[Abstract/Free Full Text]

Kim, J.-M., Hong, Y., Kim, S., Cho, M. H., Yoshida, M., Jeang, K. T., Burns, W. & Kim, S. (1999). Sequences downstream of the RNA initiation site of the HTLV type I long terminal repeat are sufficient for trans-activation by human cytomegalovirus immediate-early proteins. AIDS Research and Human Retroviruses 15, 545-550.[Medline]

Kobayashi, N., Boyer, T. G. & Berk, A. J. (1995). A class of activation domains interacts directly with TFIIA and stimulates TFIIATFIIDpromoter complex assembly. Molecular and Cellular Biology 15, 6465-6473.[Abstract]

Koleske, A. J. & Young, R. A. (1994). An RNA polymerase II holoenzyme responsive to activators. Nature 368, 466-469.[Medline]

Lee, J. S., Galvin, K. M. & Shi, Y. (1993). Evidence for physical interaction between the zinc-finger transcription factors YY1 and Sp1. Proceedings of the National Academy of Sciences, USA 90, 6145-6149.[Abstract/Free Full Text]

Lee, J. S., Galvin, K. M., See, R. H., Eckner, R., Livingston, D., Moran, E. & Shi, Y. (1995). Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300. Genes & Development 9, 1188-1198.[Abstract/Free Full Text]

Lin, Y.-S., Ha, I., Maldonado, E., Reinberg, D. & Green, M. R. (1991). Binding of general transcription factor TFIIB to an acidic activating region. Nature 353, 569-571.[Medline]

Lukac, D. M., Manuppello, J. R. & Alwine, J. C. (1994). Transcriptional activation by the human cytomegalovirus immediate-early proteins: requirements for simple promoter structures and interactions with multiple components of the transcription complex. Journal of Virology 68, 5184-5193.[Abstract/Free Full Text]

Lukac, D. M., Harel, N. Y., Tanese, N. & Alwine, J. C. (1997). TAF-like functions of human cytomegalovirus immediate-early proteins. Journal of Virology 71, 7227-7239.[Abstract]

Malone, C. L., Vesole, D. H. & Stinski, M. F. (1990). Transactivation of a human cytomegalovirus early promoter by gene products from the immediate-early gene IE2 and augmentation by IE1: mutational analysis of the viral proteins. Journal of Virology 64, 1498-1506.[Abstract/Free Full Text]

Mocarski, E. S.Jr (1996). Cytomegaloviruses and their replication. In Fields Virology, pp. 2447-2492. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.

Nabel, G. & Baltimore, D. (1987). An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature 326, 711-713.[Medline]

Pizzorno, M. C. & Hayward, G. S. (1990). The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major immediate-early promoter through a target sequence located near the cap site. Journal of Virology 64, 6154-6165.[Abstract/Free Full Text]

Ptashne, M. & Gann, A. (1997). Transcriptional activation by recruitment. Nature 386, 569-577.[Medline]

Saluja, D., Vassallo, M. F. & Tanese, N. (1998). Distinct subdomains of human TAFII130 are required for interactions with glutamine-rich transcriptional activators. Molecular and Cellular Biology 18, 5734-5743.[Abstract/Free Full Text]

Schwartz, R., Helmich, B. & Spector, D. H. (1996). CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2·2-kilobase RNA promoter. Journal of Virology 70, 6955-6966.[Abstract/Free Full Text]

Seipel, K., Georgiev, O., Gerber, H. P. & Schaffner, W. (1993). C-terminal domain (CTD) of RNA polymerase II and N-terminal segment of the human TATA binding protein (TBP) can mediate remote and proximal transcriptional activation, respectively. Nucleic Acids Research 21, 5609-5615.[Abstract/Free Full Text]

Stargell, L. A. & Struhl, K. (1996). Mechanisms of transcriptional activation in vivo: two steps forward. Trends in Genetics 12, 311-315.[Medline]

Stringer, K. F., Ingles, C. J. & Greenblatt, J. (1990). Direct and selective binding of an acidic transcriptional activation domain to the TATA-box factor TFIID. Nature 345, 783-786.[Medline]

Strubin, M. & Struhl, K. (1992). Yeast and human TFIID with altered DNA-binding specificity for TATA elements. Cell 68, 721-730.[Medline]

Struhl, K. (1996). Chromatin structure and RNA polymerase II connection: implications for transcription. Cell 84, 179-182.[Medline]

Tansey, W. P., Ruppert, S., Tjian, R. & Herr, W. (1994). Multiple regions of TBP participate in the response to transcriptional activators in vivo. Genes & Development 8, 2756-2769.[Abstract/Free Full Text]

Tjian, R. & Maniatis, T. (1994). Transcriptional activation: a complex puzzle with few easy pieces. Cell 77, 5-8.[Medline]

Wu, J., ONeill, J. & Barbosa, M. S. (1998). Transcription factor Sp1 mediates cell-specific trans-activation of the human cytomegalovirus DNA polymerase gene promoter by immediate-early protein IE86 in glioblastoma U373MG cells. Journal of Virology 72, 236-244.[Abstract/Free Full Text]

Xiao, H., Friesen, J. D. & Lis, J. T. (1995). Recruiting TATA-binding protein to a promoter: transcriptional activation without an upstream activator. Molecular and Cellular Biology 15, 5757-5761.[Abstract]

Xiao, H., Lis, J. T. & Jeang, K. T. (1997). Promoter activity of Tat at steps subsequent to TATA-binding protein recruitment. Molecular and Cellular Biology 17, 6898-6905.[Abstract]

Yoo, Y. D., Chiou, C.-J., Choi, K. S., Yi, Y., Michelson, S., Kim, S., Hayward, G. S. & Kim, S.-J. (1996). The IE2 regulatory protein of human cytomegalovirus induces expression of the human transforming growth factor β1 gene through an Egr-1 binding site. Journal of Virology 70, 7062-7070.[Abstract/Free Full Text]

Yurochko, A. D., Mayo, M. W., Poma, E. E., Baldwin, A. S.Jr & Huang, E.-S. (1997). Induction of the transcription factor Sp1 during human cytomegalovirus infection mediates upregulation of the p65 and p105/p50 NF-κB promoters. Journal of Virology 71, 4638-4648.[Abstract]

Zawel, L. & Reinberg, D. (1993). Initiation of transcription by RNA polymerase II: a multi-step process. Progress in Nucleic Acid Research and Molecular Biology 44, 67-108.[Medline]

Zhou, Q., Gedrich, R. W. & Engel, D. A. (1995). Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB. Journal of Virology 69, 4323-4330.[Abstract]

Received 26 July 1999; accepted 9 September 1999.