Research Article

Virus inactivation in a proportion of human T-cell leukaemia virus type I-infected T-cell clones arises through naturally occurring mutations

Journal of General Virology 2000; 81(1):97

PubMed

With thanks to our partners for supporting this archive.

Abstract

Human T-cell leukaemia virus type I (HTLV-I) is the aetiological agent of adult T-cell leukaemia/lymphoma and tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). The trans-activating protein (Tax) of HTLV-I is strongly implicated in cellular proliferation. We examined the tax gene and 5' long terminal repeat (LTR) sequences in eight naturally infected T-cell clones derived from TSP/HAM-affected individuals who were either productively (proliferate spontaneously) or silently (do not proliferate spontaneously) infected. In two silently infected clones point mutations within the proviruses resulted in truncation of the Tax protein. One clone harboured both a deleterious tax gene mutation and a point mutation in an enhancer element of the 5' LTR. Sequence changes, immunological escape mutation, integration site context and host cell phenotype may all contribute to the high proportion of latently or silently infected T-cells found in vivo in virus carriers.



Human T-cell leukaemia virus type I (HTLV-I) is the aetiological agent of adult T-cell leukaemia/lymphoma (ATLL) and tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM) [reviewed in Höllsberg & Hafler (1993) ]. In addition to the usual retroviral genes, gag, pol and env, a pX region in the HTLV-I genome comprises four open reading frames (ORFs I to IV), from which six spliced mRNAs have been identified, encoding seven potential gene products. These include Rof (ORF I), Tof (ORF II), Rex (ORF III) and Tax (ORF IV). Rex protein is required for virus replication and for post-transcriptional gene splicing events. Tax (the transcriptional trans-activating protein) interacts only indirectly with the viral long terminal repeat (LTR) (Fujisawa et al., 1991 ) but also affects the regulation of a number of cellular genes involved in T-cell growth and oncogenesis [reviewed in Yoshida (1996) ]. The functions of Rof and Tof (Ciminale et al., 1992 ; Koralnik et al., 1992 ) are unclear although tof and rof as well as rex sequences are dispensable for in vitro T-cell immortalization (Berneman et al., 1992 ).

There is much evidence for Tax exerting a role in virus pathogenesis and cellular transformation (Nerenberg, 1990 ; Pozzatti et al., 1990 ; Grassmann et al., 1992 ). The tax gene can be found in ATLL tumour tissue even when other proviral sequences have been deleted (Korber et al., 1991 ; Ohshima et al., 1991 ). We have previously demonstrated a correlation between provirus transcriptional activity and an abnormal level of cellular proliferation (Richardson et al., 1997 ). With its many effects on cellular genes, Tax is the likely cause of this.

Despite possessing oncogenic properties, no part of the HTLV-I genome shows identity to known oncogenes. As the site of HTLV-I provirus integration into the host cell genome is generally regarded as random, oncogenesis by insertional mutagenesis is probably extremely infrequent. Despite this, a predilection for transcriptionally active proviruses to be found in G+C-rich chromatin was previously noted (Zoubak et al., 1994 ). With only one report to date of two individuals sharing a common HTLV-I integration site (Macera et al., 1992 ), the involvement of viral gene products in cellular transformation is more likely. The progression to leukaemia is probably a multi-step process (Okamoto et al., 1989 ) with Tax involvement likely occurring early in virus pathogenesis.

HTLV-I has been divided into genetic groups [reviewed in Slattery et al. (1999) ]. HTLV-I sequences, including tax, differ between strain types (Ratner et al., 1991 ). There is a greater degree of sequence conservation within TSP/HAM patients than within or between asymptomatic carriers (Niewiesk et al., 1994 , 1995 ). No specifically neuropathic strain of HTLV-I has been identified.

We have studied a series of HTLV-I-infected T-cell clones generated from the blood of infected individuals, Du, Mu and Ph1C, as previously described (Wucherpfennig et al., 1989 ; Hyer et al., 1991 ; Höllsberg et al., 1992 ; Zoubak et al., 1994 ; Richardson et al., 1997 ). Several of these clones, despite being isolated from a single TSP/HAM-affected individual, differ in their proliferative phenotypes: some exhibiting relatively IL-2-independent proliferation while others do not. An identical host background highlights the relative contribution of viral sequence changes to cellular dysfunction. Since the tax gene and its product are likely to be involved in cell proliferation (Richardson et al., 1997 ), we characterized the tax gene sequence of each of these clones to look for mutations. PCR amplification of tax genes was effected using overlapping primer pairs spanning nucleotides 7195 and 8474 [ATK sequence, Seiki et al. (1983) ; tax1s 5' bio-TTCCTCCACCAGCAGGTCCT 3', tax1a 5' TGGGTTCCATGTATCCATTTG 3', taxα2s 5' bio-GCTCAGCTCTACAGTTCCTTA 3', taxα2a 5' AGCTGGTAGAGGTACAT 3', taxβ2s 5' bio-ATGGATACATGGAACCCA 3', taxβ2a 5' AGGCTGTCAGCGTGACG 3', taxγ2s 5' bio-CCAATGTTCCCTACAAACGA 3', tax3s 5' CGTCACGCTGACAGCCT 3', tax3a 5' bio-GGAGGTCTGAGCTTATGATT 3': s, sense oligonucleotide; a', antisense oligonucleotide; bio', biotin]. Biotinylated sequencing was carried out according to the manufacturers instructions (Dynal) using oligonucleotides tax1.seq 5' GGGTTGTATGAGTGATT 3', taxα2.seq 5' AGACAGGGTTGGGAGGTGCTGC 3', taxβ2.seq 5' GGCAAACAGTCCTCGGGTAG 3', taxγ2.seq 5' AGGAGGACTGTAGTACTA 3', and tax3.seq 5' TACCGATGGCACGCCTATGATT 3'. Two independent PCR products were analysed to ensure polymerase fidelity.

Remarkably no two clones harboured identical sequences for Tax or the LTR even in clones derived from a single individual. The 24 different variant tax nucleotides found both sense (residue unaltered) and missense (residue altered) are summarized in Table 1 and Fig. 1. Clones Du20 and Du43 possessed a change (TGG to TAG) resulting in stop codons at positions 56 and 28, respectively. Of the six coding changes, three (G149S, H279R and G339S) do not appear to affect Tax function, as these also occur in productively infected clones (Du4, Du26 or Mu16) which exhibit spontaneous proliferation and produce infectious HTLV-I particles (Richardson et al., 1997 ). Moreover, the G339S change is located in a region dispensable for Tax function (Semmes & Jeang, 1995 ). The G14R and H279Q changes in proviruses Du34 and Ph1C, respectively, may affect Tax activity. The A221V change in the Du and Mu clones is a natural variant of Cosmopolitan-type HTLV-I (Mahieux et al., 1995 ; Renjifo et al., 1995 ).


Table 1. Sequence variants identified in the pX(tax) region


Table 1. The amino acids are abbreviated according to the standard one-letter code. (b) Activity from the interaction of mutant and wild-type Tax proteins with wild-type LTR (Tax) and the interaction of wild-type Tax protein with mutant and wild-type LTRs (LTR) with respect to wild-type Tax and LTR (WT) is recorded. Also shown is the activity from the interaction of Du34 Tax and LTR (LTR/TAX) mutants with respect to the activity of the single mutants. Figures are given as percentage acetylated product relative to that seen with wild-type Tax, which has a value of 100%. Error bars shown are±standard deviation of mean values from four transfections.


The LTR possesses a number of motifs associated with provirus transcriptional upregulation (Fig. 2) including three 21 bp imperfect repeats (Tax-responsive elements, TREs) in the U3 region. Since no changes were identified which could affect the function of Tax in clones Du4, Du26, Mu16, Mu40 and Ph1C, we analysed the 5' LTR of each clone. LTR sequences were amplified using oligonucleotides LTRs 5' GCTTAGAGCCTCCCAGTGAA 3' and LTRa 5' GAATAGGGCTAGCGCTACG 3'. The antisense oligonucleotide is complementary to sequences in the 5' region of gag. The additional sequencing of clones Mu16 and Du26 proviral LTRs identified patient-specific variation. An internal control for Ph1C was unavailable. Sequencing of two independent PCR reactions was performed using an ABI 310 automatic sequencer employing dichlororhodamine terminator chemistry and oligonucleotides LTR1.seq 5' TCCGCGAAACAGAAGTCT 3' and LTR2.seq 5' ATCCACACGCCGGTTGAGTCG 3' (Fig. 2). Alignment and screening of HTLV-I strains highlighted naturally occurring variants.



(62K):

Fig. 2. A consensus sequence for the 5' HTLV-I LTR is given. Nucleotide numbering follows that of Seiki et al. (1983) . The consensus sequence (con) was derived from available database sequences [accession nos: M69044 (Paine et al., 1991 ); M86840 (Evangelista et al., 1990 ); J02029 (Seiki et al., 1983 ); D00294 (Malik et al., 1988 ); L02534 (Gessain et al., 1993 )]. Zairean sequences were not included as they were incomplete. Standard codes for nucleotide/nucleotide combinations have been used. Gaps in the consensus indicate regions where a single isolate possessed additional sequence. The points at which the sequence of the analysed proviral LTRs differ are indicated below the consensus sequence. Changes which are natural variants are also shown. Functionally important regions are identified with boxes: an asterisk denotes Ets-binding (Bosselut et al., 1990 ; Gitlin et al., 1991 ) and a dagger denotes SP1-binding motifs (Gégonne et al., 1993 ); SD, splice donor; RBS (Rex-binding sequences), nucleotides proposed to form a contact structure for Rex protein (see text); DLS, dimer linkage site (Greatorex et al., 1996 ); PBS, primer-binding site. The boundaries of the U3, R, U5 and the RxRE sequences are indicated by arrows as are the end of LTR sequences and the start of the gag gene.

The LTR changes were predominantly naturally occurring strain variants or changes occurring in transcriptionally active proviruses or in both active and silent proviruses. The Du34 provirus harboured a G(nt174)A change in the first conserved element of the second TRE and a C(nt229)A change in a region possessing transcription factor-binding sites. The Mu40 provirus also possessed the C(nt229)A variant as well as one change in each of the R [G(nt505)C] and U5 [C(nt662)T] regions. The U5 variant was also found in the Ph1C provirus. Nucleotide 662 is in a region not present in CR-CAT; as this construct is functional (see below) this change is unlikely to explain provirus silencing in these two clones. As the R variant falls within the Rex-binding site sequence (Hanly et al., 1989 ; Toyoshima et al., 1990 ; Ratner et al., 1991 ) Rex function may be affected by this mutation in the context of the 3' LTR. A Y323G change in the Du34 provirus does not occur within a functionally significant region of the Rex-responsive element (RxRE) structure. Since it is likely that Tax is responsible for the cellular proliferation seen in the clones, RxRE changes would not influence this as Tax expression is Rex-independent.

Mutagenesis of plasmids pcDNA3Tax/Rex (Tax expression vector, Tax gene driven by cytomegalovirus promoter) and CR-CAT [pU3R-I (Sodroski et al., 1984 ); CAT gene driven by HTLV-I LTR] was effected via site-directed mutagenesis (Kunkel et al., 1987 ) of a pBluescript KSII(+) (Stratagene) intermediate containing either the 2047 bp HindIIIEcoRI fragment overlapping the tax region from pcDNA3Tax/Rex or the 716 bp XhoIHindIII LTR-containing fragment from CR-CAT. Construct pcDNA3Tax(Du34)Rex produces the G14R mutant; pcDNA3Tax(Ph1C)Rex produces the H279Q mutant; CR(Du34)-CAT harbours the TRE II mutation and CR(Mu40)-CAT harbours the RBS mutation. The function of these mutants was assessed. DEAE-dextran (Sambrook et al., 1989 ) transient cotransfection of 5 µg of CR-CAT and an equal amount of either pcDNA3Tax(Du34)Rex or pcDNA3Tax(Ph1C)Rex, or 5 µg of either CR(Du34)-CAT or CR(Mu40)-CAT and 5 µg of pcDNA3Tax/Rex into COS-1 fibroblasts was performed. The combined effect of the Tax and LTR mutations from clone Du34 was analysed by cotransfecting 5 µg CR(Du34)-CAT and 5 µg pcDNA3Tax(Du34)/Rex. CAT acetylation was assessed by thin layer chromatography and quantified on an Instant Imager (Canberra Packard). The pcDNA3Tax(Ph1C)Rex and CR(Mu40)-CAT constructs function at a level comparable to wild-type (Fig. 1b); however, the pcDNA3Tax(Du34)Rex and CR(Du34)-CAT constructs show acetylation levels approximately fivefold and twofold lower than the wild-type. In this context the effects of the Du34 Tax and enhancer mutations were not additive. A Tax allele containing the G14R substitution has been shown to be functionally compromised (Niewiesk et al., 1995 ): our data support this observation. This change falls within a defined CTL epitope and results in loss of CTL recognition in vitro and trans-activation pertaining to the in vitro up-regulation of the viral LTR or the IL-2Rα chain promoter (Parker et al., 1994 ; Niewiesk et al., 1995 ). A high level of Tax1119-specific CD8+ T-cells in the peripheral blood of TSP/HAM-affected individuals with enrichment occurring in the cerebrospinal fluid of these patients was demonstrated (Greten et al., 1998 ). These data highlight how escape mutations at immunologically important epitopes may compromise virus protein function.

The central conserved domain of the TRE is crucial for CREB-binding. When the Du34 Tax and LTR mutants were cotransfected, the resulting level of acetylation mirrored that of the Tax mutant alone, suggesting that the Tax change is the predominant silencing mutation in the in vitro system.

The nucleotide changes in tax might also affect the overlapping rex and tof genes (Fig. 1, Table 1). The rex ORF overlaps the tax gene as far as tax codons 171/172 whereas tof only overlaps as far as tax codons 84/85 (Ciminale et al., 1992 ; Koralnik et al., 1992 ). Changes in Rex that abrogate its function may result in altered post-translational splicing control of the mRNA species. An arginine-rich N-terminal region of Rex is involved in its nuclear localization and binding to the RxRE (Hammes & Greene, 1993 ), and an activation domain thought to be a target for a cellular factor spans residues 79 and 99 (Weichselbraun et al., 1992 ). The R72K and P169Q variants do not affect Rex function as these occur in the productively infected clone Du4, which expresses all of the structural viral proteins. The functional significance of the G47S, G75R, P180L and L106S changes has yet to be evaluated as they were identified in silently infected clones, the first three occurring in the proviruses from either Du20 or Du43, which have premature stop codons in tax.

The Tof D211N substitution appears to be functionally insignificant as it occurs within the Du4 provirus. The significance of a R171Q change in the clone Du34 is unclear. Given the lack of evidence that Tof is essential it seems unlikely that this change in Du34 is central to the ablation of provirus activity.

The cause of the transcriptional inactivity of the three proviruses harboured by clone Ph1C may relate to the CD8 phenotype of this clone. Much higher levels of transcription from the HTLV-I LTR in primary CD4+ T-cells, compared with primary CD8 cells, have been demonstrated, suggesting that cellular factors within CD8 T-cells may be insufficient to support efficient use of the HTLV-I promoter (Newbound et al., 1996 ). Alternatively active suppression of transcription by CREB family members or other cellular factors might contribute (Xu et al., 1990 ).

As well as contributing to the functional mapping of Tax, Rex and Tof and the 5' LTR our results illustrate the diversity of proviral sequence within an individual and show that transcriptional inactivity of the HTLV-I provirus in naturally infected T-cell clones can be caused by naturally occurring mutations, suggesting interplay with a variety of factors. Defective tax genes causing truncated proteins, or proteins with reduced trans-activation activity are associated with the non-virus-expressing and non-proliferative cellular phenotype. LTR defects may also contribute to virus silencing. A CD8 cell phenotype, integration site context and mutations resulting in abnormal mRNA production (Major et al., 1995 ) may also cause provirus inactivation. In some clones, however, none of these factors pertain, the LTR is functionally intact and the reasons for transcriptional inactivity are unclear. Further work to investigate the causes of virus silencing in these clones is ongoing.

Plasmids pcDNA3Tax/Rex and CR-CAT were generous gifts from Marie-Christine Dokhélar, Institut Cochin, Paris. Dr Marian Major is acknowledged for providing a number of the oligonucleotide primers. Drs Mark Gurnell and Rory Clifton-Bligh are gratefully acknowledged for their assistance with the automated sequencing.

The authors acknowledge the scientific support of the HTLV-I European Research Network. This work was financially supported in part by grants from the Medical Research Council (UK), Isaac Newton Trust, the Sykes Trust, and the Wellcome Trust. N.J.R was supported for part of this study by a Lady Tata Memorial Trust fellowship.

Footnotes

b Present address: Millennium Pharmaceuticals Inc., 75, Sidney Street, Cambridge, MA 02139, USA.

References

Berneman, Z. N., Gartenhaus, R. B., Reitz, M. S., Jr, Klotman, M. E. & Gallo, R. C. (1992). cDNA sequencing confirms HTLV-I expression in adult T-cell leukemia/lymphoma and different sequence variations in vivo and in vitro. Leukemia 6 (Suppl. 3), 65S71S.[Medline]

Bosselut, R., Duvall, J., Gégonne, A., Bailly, M., Hémar, A., Brady, J. & Ghysdael, J. (1990). The product of the c-ets-1 proto-oncogene and the related Ets2 protein act as transcriptional activators of the long terminal repeat of human T cell leukemia virus HTLV-1. EMBO Journal 9, 3137-3144.[Medline]

Ciminale, V., Pavlakis, G., Derse, D., Cunningham, C. & Felber, B. (1992). Complex splicing in the human T-cell leukemia virus (HTLV) family of retroviruses: novel mRNAs and proteins produced by HTLV type I. Journal of Virology 66, 1737-1745.[Abstract/Free Full Text]

Evangelista, A., Maroushek, S., Minnigan, H., Larson, A., Retzel, E. & Haase, A. (1990). Nucleotide-sequence analysis of a provirus from an individual with tropical spastic paraparesis. Microbial Pathogenesis 8, 259-278.[Medline]

Fujisawa, J.-I., Toita, M., Yoshimura, T. & Yoshida, M. (1991). The indirect association of human T-cell leukemia virus tax protein with DNA results in transcriptional activation. Journal of Virology 65, 4525-4528.[Abstract/Free Full Text]

Gégonne, A., Bosselut, R., Bailly, R.-A. & Ghysdael, J. (1993). Synergistic activation of the HTLV1 LTR Ets-responsive region by transcription factors Ets1 and Sp1. EMBO Journal 12, 1169-1178.[Medline]

Gessain, A., Boeri, E., Yanagihara, R., Gallo, R. & Franchini, G. (1993). Complete nucleotide sequence of a highly divergent human T-cell leukemia (lymphotropic) virus type I (HTLV-I) variant from Melanesia: genetic and phylogenetic relationship to HTLV-I strains from other geographical regions. Journal of Virology 67, 1015-1023.[Abstract/Free Full Text]

Gitlin, S., Bosselut, R., Gégonne, A., Ghysdael, J. & Brady, J. (1991). Sequence-specific interaction of the Ets1 protein with the long terminal repeat of the human T-lymphotropic virus type I. Journal of Virology 65, 5513-5523.[Abstract/Free Full Text]

Grassmann, R., Berchtold, S., Radant, I., Alt, M., Fleckenstein, B., Sodroski, J., Haseltine, W. & Ramstedt, U. (1992). Role of human T-cell leukemia virus type 1 X region proteins in immortalization of primary human lymphocytes in culture. Journal of Virology 66, 4570-4575.[Abstract/Free Full Text]

Greatorex, J., Laisse, V., Dokhélar, M.-C. & Lever, A. (1996). Sequences involved in the dimerisation of human T cell leukaemia virus type-1 RNA. Nucleic Acids Research 24, 2919-2923.[Abstract/Free Full Text]

Greten, T., Slansky, J., Kubota, R., Soldan, S., Jaffee, E., Leist, T., Pardoll, D., Jacobson, S. & Schneck, J. (1998). Direct visualization of antigen-specific T cells: HTLV-1 Tax1119-specific CD8+ T cells are activated in peripheral blood and accumulate in cerebrospinal fluid from HAM/TSP patients. Proceedings of the National Academy of Sciences, USA 95, 7568-7573.[Abstract/Free Full Text]

Hammes, S. & Greene, W. (1993). Multiple arginine residues within the basic domain of HTLV-I Rex are required for specific RNA binding and function. Virology 193, 41-49.[Medline]

Hanly, S., Rimsky, L., Malim, M., Kim, J., Hauber, J., Duc Dodon, M., Le, S.-Y., Maizel, J., Cullen, B. & Greene, W. (1989). Comparative analysis of the HTLV-I Rex and HIV-1 Rev trans-regulatory proteins and their RNA response elements. Genes & Development 3, 1534-1544.[Abstract]

Höllsberg, P. & Hafler, D. (1993). Pathogenesis of diseases induced by human lymphotropic virus type I infection. Seminars in Medicine of the Beth Israel Hospital, Boston 328, 1173-1182.

Höllsberg, P., Wucherpfennig, K., Ausubel, L., Calvo, V., Bierer, B. & Hafler, D. (1992). Characterization of HTLV-I in vivo infected T cell clones. Journal of Immunology 148, 3256-3263.[Abstract]

Hyer, S., Richardson, J., Brown, M., Lever, A. & Nussey, S. (1991). Progressive flaccid myelopathy associated with HTLV-I. Lancet 338, 944.[Medline]

Koralnik, I., Gessain, A., Klotman, M., Monico, A., Berneman, Z. & Franchini, F. (1992). Protein isoforms encoded by the pX region of human T-cell leukemia/lymphotropic virus type I. Proceedings of the National Academy of Sciences, USA 89, 8813-8817.[Abstract/Free Full Text]

Korber, B., Okayama, A., Donnelly, R., Tachibana, N. & Essex, M. (1991). Polymerase chain reaction analysis of defective human T-cell leukemia virus type I proviral genomes in leukemic cells of patients with adult T-cell leukemia. Journal of Virology 65, 5471-5476.[Abstract/Free Full Text]

Kunkel, T., Roberts, J. & Zakour, R. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]

Macera, M., Szabo, P. & Verma, R. (1992). Chromosomal localization of HTLV-1 viral integration sites using in situ hybridization: detection of a novel IL2R fragment. Molecular and General Genetics 234, 466-474.[Medline]

Mahieux, R., de The, G. & Gessain, A. (1995). The tax mutation at nucleotide 7959 of human T-cell leukemia virus type 1 (HTLV-1) is not associated with tropical spastic paraparesis/HTLV-1-associated myelopathy but is linked to the Cosmopolitan molecular genotype. Journal of Virology 69, 5925-5927.[Free Full Text]

Major, M., Daenke, S., Nightingale, S. & Desselberger, U. (1995). Differential Tax expression in HTLV type I-infected asymptomatic carriers. AIDS Research and Human Retroviruses 11, 415-421.[Medline]

Malik, K. T. A., Even, J. & Karpas, A. (1988). Molecular cloning and complete nucleotide sequence of an adult T cell leukaemia virus/human T cell leukaemia virus type I (ATLV/HTLV-I) isolate of Caribbean origin: relationship to other members of the ATLV/HTLV-I subgroup. Journal of General Virology 69, 1695-1710.[Abstract]

Nerenberg, M. (1990). An HTLV-I transgenic mouse model: role of the Tax gene in pathogenesis in multiple organ systems. Current Topics in Microbiology and Immunology 160, 121-128.[Medline]

Newbound, G. C., Andrews, J. M., ORourke, J. P., Brady, J. N. & Lairmore, M. D. (1996). Human T-cell lymphotropic virus type 1 Tax mediates enhanced transcription in CD4+ T lymphocytes. Journal of Virology 70, 2101-2106.[Abstract]

Niewiesk, S., Daenke, S., Parker, C., Taylor, G., Weber, J., Nightingale, S. & Bangham, C. (1994). The transactivator gene of human T-cell leukemia virus type I is more variable within and between healthy carriers than patients with tropical spastic paraparesis. Journal of Virology 68, 6778-6781.[Abstract/Free Full Text]

Niewiesk, S., Daenke, S., Parker, C., Taylor, G., Weber, J., Nightingale, S. & Bangham, C. (1995). Naturally occurring variants of human T-cell leukemia virus type I Tax protein impair its recognition by cytotoxic T lymphocytes and the transactivation function of Tax. Journal of Virology 69, 2649-2653.[Abstract]

Ohshima, K., Kikuchi, M., Masuda, Y., Kobari, S., Sumiyashi, Y., Eguchi, F., Mohtai, H., Yoshida, T., Takeshita, M. & Kimura, M. (1991). Defective provirus form of human T-cell leukemia virus type 1 in adult T-cell leukemia/lymphoma: clinicopathological features. Cancer Research 57, 4639-4642.

Okamoto, T., Ohno, Y., Tsugane, S., Watanabe, S., Shimoyama, M., Tajima, K., Miwa, M. & Shimotohno, K. (1989). Multi-step carcinogenesis model for adult T-cell leukemia. Japanese Journal of Cancer Research 80, 191-195.[Medline]

Paine, E., Garcia, J., Philpott, T., Shaw, G. & Ratner, L. (1991). Limited sequence variation in human T-lymphotropic virus type 1 isolates from North American and African patients. Virology 182, 111-123.[Medline]

Parker, C., Nightingale, S., Taylor, G., Weber, J. & Bangham, C. (1994). Circulating anti-Tax cytotoxic T lymphocytes from human T-cell leukemia virus type I-infected people, with and without tropical spastic paraparesis, recognise multiple epitopes simultaneously. Journal of Virology 68, 2860-2868.[Abstract/Free Full Text]

Pozzatti, R., Vogel, J. & Jay, G. (1990). The human T-lymphotropic virus type I tax gene can cooperate with the ras oncogene to induce neoplastic transformation of cells. Molecular and Cellular Biology 10, 413-417.[Abstract/Free Full Text]

Ratner, L., Philpott, T. & Trowbridge, D. (1991). Nucleotide sequence analysis of isolates of human lymphotropic virus type 1 of diverse geographical origins. AIDS Research and Human Retroviruses 7, 923-941.[Medline]

Renjifo, B., Borrero, I. & Essex, M. (1995). Tax mutation associated with tropical spastic paraparesis/human T-cell leukemia virus type I-associated myelopathy. Journal of Virology 69, 2611-2616.[Abstract]

Richardson, J., Höllsberg, P., Windhagen, A., Child, L., Hafler, D. & Lever, A. (1997). Variable immortalizing potential and frequent virus latency in blood-derived T cell clones infected with human T-cell leukemia virus type I. Blood 89, 3303-3314.[Abstract/Free Full Text]

Sambrook, J., Fritsch, E. & Maniatis, T. (1989). In Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Seiki, M., Hattori, S., Hirayama, Y. & Yoshida, M. (1983). Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proceedings of the National Academy of Sciences, USA 80, 3618-3622.[Abstract/Free Full Text]

Semmes, O. & Jeang, K.-T. (1995). Definition of a minimal activation domain in human T-cell leukemia virus type I Tax. Journal of Virology 69, 1827-1833.[Abstract]

Slattery, J., Franchini, G. & Gessain, A. (1999). Genomic evolution, patterns of global dissemination, and interspecies transmission of human and simian T-cell leukemia/lymphotropic viruses. Genome Research 9, 525-540.[Abstract/Free Full Text]

Sodroski, J., Rosen, C. & Haseltine, W. (1984). Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells. Science 225, 381-385.[Abstract/Free Full Text]

Toyoshima, H., Itoh, M., Inoue, J.-I., Seiki, M., Takaku, F. & Yoshina, M. (1990). Secondary structure of the human T-cell leukemia virus type 1 rex-responsive element is essential for rex regulation of RNA processing and transport of unspliced RNAs. Journal of Virology 64, 2825-2832.[Abstract/Free Full Text]

Weichselbraun, I., Farrington, G., Rusche, J., Böhnlein, E. & Hauber, J. (1992). Definition of the human immunodeficiency virus type 1 Rev and human T-cell leukemia virus I Rex protein activation domain by functional exchange. Journal of Virology 66, 2583-2587.[Abstract/Free Full Text]

Wucherpfennig, K., Höllsberg, P., Richardson, J., Benjamin, D. & Hafler, D. (1989). T-cell activation by autologous human T-cell leukemia virus type I-infected T-cell clones. Proceedings of the National Academy of Sciences, USA 89, 2110-2114.[Abstract/Free Full Text]

Xu, Y.-L., Adya, N., Siores, E., Gao, Q. & Giam, C.-Z. (1990). Cellular factors involved in transcription and Tax-mediated trans-activation directed by the TGACGT motifs in human T-cell leukemia virus type I promoter. Journal of Biological Chemistry 265, 20285-20292.[Abstract/Free Full Text]

Yoshida, M. (1996). Multiple targets of HTLV-I for dysregulation of host cells. Seminars in Virology 7, 349-360.

Zoubak, S., Richardson, J., Rynditch, A., Höllsberg, P., Hafler, D., Boeri, E., Lever, A. & Bernardi, G. (1994). Regional specificity of HTLV-I proviral integration in the human genome. Gene 143, 155-163.[Medline]

Received 9 August 1999; accepted 9 September 1999.