Abstract
Double-stranded RNA, formed as an intermediate during replication of RNA viruses, has been identified as a triggering signal for IFN-α/β production by infected cells, whether or not they are leukocytes (Vilek & Sen, 1996 ). Another signalling pathway has been identified for several enveloped viruses [e.g. herpes simplex virus type 1 (HSV-1), human immunodeficiency virus, human parainfluenza virus and porcine transmissible gastroenteritis coronavirus], which are able to trigger IFN-α synthesis in the absence of virus replication (Fitzgerald-Bocarsly, 1993 ). A feature shared by these viruses is the presence of envelope glycoproteins capable of triggering IFN-α synthesis directly in the absence of virus replication (Ankel et al., 1994 , 1998 ; Baudoux et al., 1998 ; Ito et al., 1994 ). The cells triggered to produce IFN-α have been named natural IFN-producing cells (NIPC) (Fitzgerald-Bocarsly, 1993 ). According to studies in vitro on human or porcine blood cells, NIPCs belong to a very rare subset of leukocytes distinct from T cells, B cells, NK cells or monocytes (Fitzgerald-Bocarsly, 1993 ) and express several markers of dendritic cells (Svensson et al., 1996 ). Recent data generated in vitro suggest that a subset of dendritic cells (DC) called plasmacytoid monocytes (Cella et al., 1999 ) or precursor of DC 2 (Siegal et al., 1999 ) corresponds to the previously described NIPC and may be the main source of IFN-α among human mononuclear blood cells. The molecular motifs exposed on viral particles, the type of viral nucleic acid and the genetic programme that is expressed by the virus itself will therefore determine different IFN-α synthesis pathways. This implies that our understanding of the biological consequences of IFN-α production conjointly with other early immune mediators is not necessarily transposable from one virus-driven process to another and must be deciphered for each virus under study.
By using an experimental system that relies on intradermal (i.d.) injection of UV-inactivated HSV-1 (UV-HSV-1) in the ear of C57Bl/6 mice, we have previously described an in vivo counterpart of NIPC. We have reported that such an abortive virus input results in early and transient IFN-α/β production in blood, with IFN-α/β-producing cells being detected mainly in the lymph node draining the site of virus delivery (Riffault et al., 1996 ). This experimental model, which mimics natural sites of virus entry, allows a stepwise analysis of IFN-α/β effects independently of virus replication. We demonstrated previously that IFN-α/β production contributes to the rapid accumulation of leukocytes observed in the draining lymph node following i.d. UV-HSV-1 injection (Riffault et al., 1996 ).
In the present study, we took advantage of our in vivo experimental model to address the question of the expression of another early immune mediator, IFN-γ, and of its potential regulation by IFN-α/β. Indeed, IFN-γ production supported by NK cells characterizes the early process elicited by many viruses (Biron et al., 1999 ; Hussell & Openshaw, 1998 ). In mouse models, the early IFN-γ synthesis by NK cells following virus infection is generally thought to be under the control of IL-12 (Biron, 1998 ), yet IFN-α has also been reported to reduce IL-12 expression (Cousens et al., 1997 ), while both IL-12 and IFN-α contribute to IFN-γ synthesis by human T cells (Sareneva et al., 1998 ; Sinigaglia et al., 1999 ). By using a quantitative RTPCR technique (Colle et al., 1997 ), we showed that IFN-γ mRNA expression was rapidly and transiently upregulated in the lymph node draining the site of non-replicating UV-HSV-1 virus delivery. By using flow cytometric analysis, we showed that the IFN-γ-producing cells belonged to the NK and, to a lesser extent, to the T lymphocyte lineages. We then analysed the IL-12p40 and IFN-α mRNA transcripts: a prompt transient increase of both transcripts was detected. Finally, the possible contribution of either mediator in the control of the early IFN-γ burst was analysed using IFN-α/β-receptor knockout mice and in the presence of IL-12-neutralizing antibody delivered prior to UV-HSV-1 inoculation. We conclude that IL-12 played a major role and IFN-α/β a minor one, if any, in the signalling pathway(s) that leads to transient IFN-γ production following the dermal delivery of UV-HSV-1.
Mice.Female, 810-week-old, pathogen-free C57Bl/6 mice were purchased from the INRA animal care facilities (Jouy-en-Josas, France). 129 SvEv mice, deficient in IFN-α/β receptor function as a result of the targetted disruption of the IFNRA1 gene on the 129SvEv background, and wild-type 129SvEv mice were obtained from B&K Universal. Both knockout and wild-type 129SvEv mice were bred within the INRA animal care facilities mentioned above. Female knockout and wild-type 129SvEv were used at 810 weeks of age. Female, 89-week-old, C57Bl/10ScCr mice, which are non-responsive to LPS (kindly provided by Dr F. Huetz, Institut Pasteur), were purchased from the CNRS animal care facilities (Orleans, France).
Mice were handled in accordance with institutional guidelines for animal care and use.
Virus.
HSV-1 strain Shelley (generously provided by Professor P. Lebon, Hospital St Vincent de Paul, Paris) was propagated in Vero cells. Supernatant, collected 2 days post-infection, was centrifuged at 2000 g to remove cellular debris. Virions were concentrated further by ultracentrifugation at 100000 g (rotor TI45) through a cushion of 20% sucrose. Semi-purified HSV-1 virions were resuspended in PBS, irradiated with 1·5 J/cm2 UV light and stored at -80 °C. Virus titre (TCID50) was determined on Vero cells before and after UV irradiation to check that the inactivation was complete. Endotoxin activity in virus inoculum was quantified by using the Limulus amaebocyte lysate assay (QCL1000, BioWhittaker).
I.d. injection and tissue processing.
UV-HSV-1 (5x107 TCID50 before UV inactivation) was injected i.d. in a volume of 50 µl in the right ear of each mouse. The left ears received the same volume of PBS as a control. In some experiments, a rat IgG MAb directed against the mouse IL-12p70 chain (clone C17.8, kindly provided by Dr G. Trinchieri, Wistar Institute, Philadelphia, PA, USA, and Shering Plough, Dardilly, France) was used to neutralize IL-12 function in vivo (Wysocka et al., 1995 ). Partially purified C17.8 antibody or control rat Ig (1 mg of 40% ammonium sulphate precipitate from ascites or serum preparation, respectively) were injected intraperitoneally (i.p.) 15 h and 1 h before i.d. UV-HSV-1 injection.
Mice were killed and auricular lymph nodes collected at different time-points after UV-HSV-1 injection. Lymph nodes were disrupted between two sheets of nylon net (Blutex quality monofilament; Tissages Tissus Techniques, Combles, France) in Eagles minimal essential medium (MEM) supplemented with 100 U/ml penicillin and 0·1 mg/ml streptomycin (MEM-PS), as described previously (Riffault et al., 1996 ).
Immunolabelling and flow cytometry.
The draining and contralateral lymph nodes were collected 10 h after i.d. UV-HSV-1 injection. Our preliminary studies showed that staining of IFN-γ-positive cells was better when lymph nodes were kept overnight on ice in MEM-PS, and that cultivating the dissociated lymph node cells for a few additional hours at 37 °C in the presence of Brefeldin A did not result in enhanced IFN-γ staining. Thus, in further experiments, lymph nodes were kept on ice overnight before being processed and cells were stained directly.
Lymph node cells (12x106) were incubated for 15 min on ice in 96-well flat-bottomed microtitre plates (Falcon 3072) with the following biotin-conjugated MAbs (PharmingenBecton Dickinson) diluted in cold PBS: anti CD3ε (clone 500A2, 15 µg/ml), anti pan-NK cells (clone DX5, 20 µg/ml) and matching isotype controls. After washing, the cells were incubated for 15 min at 4 °C with FITCstreptavidin diluted in cold PBS (15 µg/ml) (PharmingenBecton Dickinson). Lymph node cells were then fixed at room temperature with 2% paraformaldehyde in PBS and permeabilized with 0·1% saponin in PBS before being labelled for 15 min at room temperature with PE-conjugated MAb anti-IFN-γ (clone XMG1.2, 2 µg/ml) (Caltag) diluted in PBS with 0·1% saponin or with the matching isotype control (Caltag). Flow cytometry was performed with a FACScan (Becton-Dickinson). Data were collected on 3000080000 cells (Lysis software).
RNA extraction and reverse transcription.
Total RNA isolated from lymph node cells according to the method of Chomczynski & Sacchi (1987) was treated with 10 U DNase I (Boehringer Mannheim) in 0·1 M sodium acetate, 5 mM MgSO4, pH 5, with 60 U ribonuclease inhibitor (RNaseOUT, Gibco BRL) for 1 h at 37 °C. DNase I was eliminated by phenolchloroform extraction. The amount of total RNA was quantified at 260 nm. Of each RNA sample, 5 µg was reverse transcribed by using 400 U M-MLV reverse transcriptase, RNase H- (Promega) with 7 µM random hexanucleotide primers [pd(N)6, Pharmacia Biotech], 10 mM of each dNTP and 60 U RNaseOUT.
Quantitative PCR.
IFN-γ, IL-12p40 and β-actin cDNA were quantified by using a PCR method involving co-amplification with an internal standard, as described previously (Colle et al., 1997 ). To quantify IFN-α mRNA expression, we set up a similar competitive PCR assay. The IFN-α DNA internal standard was generated by mutation of a unique BfaI restriction endonuclease site into a SmaI site. A BfaI site is present in the 10 murine IFN-α sequences available from GenBank (accession numbers X01974, M13660, K01238, X01973, X01971, X01972, M13710, D00460, M68944, M28587), whereas SmaI sites are absent from these IFN-α sequences. Mutagenesis was performed on the IFN-α1 coding sequence cloned into a pGEM4 vector (van der Korput et al., 1985 ) by means of the QuikChange site-directed mutagenesis kit (Stratagene). Consensus PCR primers were designed in order to amplify the different murine IFN-α sequences: sense primer, 5' CTCATAACCTCAGGAACAAGAGAGCCT 3'; antisense primer, 5' GCATCAGACAGGCTTGCAGGTCATT 3'. The resulting IFN-α PCR products were 288 bp long and endonuclease restriction by both BfaI and SmaI generated products of 229 bp and 59 bp. PCRs were performed in a final volume of 50 µl in 200 µl microtubes (MicroAmp, Perkin Elmer). The mixture contained the cDNA template and the internal DNA standard (105, 104 or 103 copies) diluted in 10 mM TrisHCl (pH 9 at 25 °C), 50 mM KCl with 100 pmol of each primer, 300 µM of each dNTP and 2·5 U Taq polymerase (Promega). Amplification required 3540 cycles on a Perkin Elmer 2400 thermocycler as follows: 30 s at 94 °C, 30 s at 61 °C and 1 min at 72 °C. Two aliquots of each PCR were subjected to digestion with one of the restriction enzymes specific for the wild-type template or the standard template (listed in Colle et al., 1997 ). Digestions were carried out in 20 µl containing 10 µl of the PCR products, 2 µl 10x concentrated enzyme buffer and 5 U of the appropriate restriction enzyme. The digested PCR products were analysed by electrophoresis in an ethidium bromide-stained, 2% agarose gel.
Statistical analysis.
Results are expressed as means ± SD. Data were collected from at least four distinct experiments, in which lymph nodes from at least four animals were pooled. The statistical significance of differences between test groups was analysed by Students t-test (P<0·01).
In an attempt to get an accurate picture of the early IFN-γ synthesis in the draining lymph node following delivery of UV-HSV-1 in the ear dermis, mice were killed 1·5, 3, 6, 12, 24 and 48 h after virus injection. Total RNA was extracted from lymph nodes draining either the UV-HSV-1-loaded ear or the contralateral ear, inoculated with PBS alone, and IFN-γ mRNA was monitored by using a quantitative RTPCR (Colle et al., 1997 ). To standardize the different steps of the quantification procedure, the amount of IFN-γ transcript was expressed as the number of mRNA copies per 105 copies of actin mRNA. UV-HSV-1 injection elicited a rapid burst of IFN-γ mRNA (a 111±53-fold increase at 6 h, mean ± SD of four experiments) in the draining lymph node, whereas the IFN-γ mRNA level did not vary in the contralateral lymph node (Fig. 1a). The level of IFN-γ mRNA increased as early as 3 h after UV-HSV-1 injection, peaked at 612 h and returned to the control level (contralateral lymph node) at 24 h (Fig. 1a).
|
LPS-non-responsive C57Bl/10ScCr mice responded by a 100-fold increase in the IFN-γ mRNA level in the draining lymph node at 6 h, as recorded for LPS-responsive C57Bl/6 mice (data not shown). These data indicate that the endotoxin activity detected in UV-HSV-1 inoculum (2·55 EU/ml) did not account for IFN-γ mRNA upregulation.
Taking into account the kinetics of IFN-γ mRNA accumulation, the percentage and the phenotype of the IFN-γ-positive lymph node cells were analysed by flow cytometry 10 h after UV-HSV-1 injection. The percentage of IFN-γ-positive cells was significantly higher (P<0·01) in cell populations from the lymph node draining the UV-HSV-1-loaded ear (0·53±0·24%) than from the contralateral lymph node (0·15±0·06%) (Fig. 2). As we reported previously (Riffault et al., 1996 ), the total number of nucleated cells in the lymph node draining the UV-HSV-1 loaded ear was 3-fold higher than in the contralateral lymph node. Thus, the absolute number of IFN-γ-producing cells was about 10-fold higher in the draining lymph node than in the contralateral lymph node.
|
NK cells are an important early source of IFN-γ during virus infection (Biron et al., 1999 ). Thus, a two-colour FACS analysis was carried out with anti-IFN-γ MAb and DX5, an antibody reported to recognize the majority of NK cells, including most of the NK1.1-expressing cells. Fig. 3(ab) shows that the percentage of DX5-positive cells was similar in the cell populations of the lymph node draining the UV-HSV-1 inoculated ear and the contralateral lymph node. Quadrant limits were set according to matching isotype Ig dot plots: less than 0·05% non-specific IFN-γ staining and less than 0·1% non-specific DX5 or CD3ε staining. The upper windows contain the IFN-γ-positive cells. The percentages of single- and double-positive cells are shown for each dot plot. In the contralateral lymph node cell population, almost no double-positive DX5+/IFN-γ+ cells were detected, whereas the frequency of double-positive cells was increased significantly in the draining lymph node (Fig. 3ab). Double-positive DX5+/IFN-γ+ cells accounted for only 4050% of IFN-γ-positive cells (recorded in four independent experiments). This suggested that another subset is involved in the early IFN-γ synthesis triggered by UV-HSV-1 in the lymph node. To date, memory/effector T cells are the other main subset known to produce IFN-γ upon reactivation (Dutton et al., 1998 ). We therefore carried out a two-colour FACS analysis to detect IFN-γ-producing T cells, based on the use of anti-CD3ε and the anti-IFN-γ antibody. Fig. 3(cd) shows that the percentage of double-positive CD3ε+/IFN-γ+ cells was increased 10-fold in the lymph node draining the UV-HSV-1-loaded ear compared with the control cell population. Double-positive CD3ε+/IFN-γ+ cells accounted for 30% of IFN-γ-positive cells (recorded in six independent experiments). Although we have only identified 7080% of the IFN-γ+ cells, we consider it unlikely that a third cell subset is involved in IFN-γ synthesis. Indeed, as mentioned above, percentages of DX5+ or CD3ε+ cells were lowered by discarding cells stained with isotype-matched control Ig.
|
Upregulation of IFN-γ transcripts in the draining lymph node is under the control of IL-12 independently of the IFN-α/β receptor-signalling pathway
To determine whether IFN-α and/or IL-12 might contribute to this transient synthesis of IFN-γ, we analysed the kinetics of their transcripts in the draining lymph nodes. Expression of both IFN-α and IL-12p40 mRNA was indeed upregulated in the draining lymph node, while it remained at basal levels in the contralateral lymph node (levels corresponding to time zero, data not shown) (Fig. 1bc). IFN-α transcripts were upregulated as early as 1·5 h after UV-HSV-1 injection and the copy number of IFN-α mRNA was increased by a factor of 183±151 (mean ± SD of four experiments) at 3 and 6 h. The increase of IL-12p40 mRNA was comparatively lower, with a 5·7±3·7-fold increase (mean ± SD of four experiments) at 6 h after UV-HSV-1 injection. At 24 h, as expected from our previous experiments (Riffault et al., 1996 ) when UV-irradiated virus is used, only basal levels were detectable in the draining lymph node for both transcripts (Fig. 1bc). Similar increases were recorded for both IFN-α and IL-12p40 mRNA in the draining lymph node of LPS-non-responsive C57Bl/10ScCr mice (data not shown). As was shown for the IFN-γ mRNA increase, these data indicate that the endotoxin activity detected in the UV-HSV-1 inoculum did not contribute to the transient upregulation of the cytokine transcripts under study.
The very prompt and prominent expression of IFN-α mRNA suggested that this cytokine could be the triggering signal of the early IFN-γ synthesis. To address this point, we used IFN-α/β receptor-knockout 129 mice (IFNAR1-/- 129) (Muller et al., 1994 ). The levels of IFN-γ mRNA within the lymph node of knockout and wild-type 129 mice were quantified at different time-points after i.d. UV-HSV-1 injection. A burst of IFN-γ mRNA that peaked at 12 h was detectable in the lymph nodes of mice, whether the IFNAR1 gene was present or not (Fig. 4ab). In addition, quantification of the IL-12p40 mRNA showed a similar upregulation of this transcript whether the IFNAR1 gene was present or not (data not shown).
|
As the transient burst of IFN-γ synthesis was still detectable in the absence of a functional IFN-α/β receptor pathway, we hypothesized that IL-12 could be one of the molecules that delivers the signal to NK and CD3 T cells for IFN-γ synthesis. Thus, MAbs that neutralized IL-12 or irrelevant control Ig were administered i.p. before i.d. inoculation of UV-HSV-1 to either IFNAR1-/- or wild-type mice. The IFN-γ transcript level was reduced (7580% at 12 h after i.d. UV-HSV-1 injection) in the lymph node draining the UV-HSV-1-loaded ear once they were given IL-12-neutralizing antibodies, whether the IFNAR1 gene was present or not (Fig. 4de). This inhibition of IFN-γ mRNA upregulation was also detected at earlier and later time-points (6 and 24 h) in IFNAR1-/- mice (Fig. 4c). In the present study, we have demonstrated that two different subsets of cells (DX5+ NK cells and CD3ε+ T cells) are triggered rapidly to synthesize IFN-γ after UV-HSV-1 delivery upstream of the lymph node. IFN-γ-producing CD3ε+ T cells appeared to be CD8α+ and CD4- in preliminary flow cytometric analysis (S. Riffault, unpublished data). However, due to their very low abundance in the lymph node, a reliable phenotype of the IFN-γ-producing CD3ε+ T cells was difficult to establish. It has been shown recently that DX5 is expressed on about 5% of mouse naive CD4 and CD8 T cells and on up to 20% of virus-reactive CD4 and CD8 T cells following LCMV infection (Slifka et al., 2000 ). Therefore, we cannot exclude that some of the DX5+/IFN-γ+ cells detected in the draining lymph node are T or NKT cells.
The IFN-γ-producing T cells may correspond to the memory phenotype CD44hi T lymphocytes that accumulate and proliferate in lymphoid tissues in response to IFN-α/β, irrespective of their clonotypic receptor (Tough et al., 1996 ). We have demonstrated in a previous study that IFN-α/β synthesis is induced rapidly in the lymph node draining the UV-HSV-1-loaded ear (Riffault et al., 1996 ).
We have shown that both IFN-α and IL-12p40 transcripts are upregulated rapidly and transiently in the draining lymph node. Therefore, we investigated whether the early T- and NK-dependent IFN-γ production was under the control of IFN-α/β and/or IL-12. The use of IFNAR1-/- mice as well as IL-12-neutralizing antibody allowed us to establish the following points: (i) whether the IFN-α/β receptor-signalling pathway is functional or not, the transient overexpression of IL-12 and IFN-γ transcripts is maintained, and (ii) IL-12 is required for IFN-γ transcript accumulation. Interestingly, the lower amount of IL-12p40 or IL-12p70 in serum of mice collected 48 h after parenteral injection of LCMV suggests downregulation of their synthesis by IFN-α/β (Cousens et al., 1997 ). Depending on the virus system, e.g. replicating versus non-replicating virus, route of delivery, temporal window of analysis, loco-regional versus systemic immune response, different regulatory pathways may be transiently switched on or off. Under our experimental conditions, which involve delivery of non-replicating virus particles into a dermal site, we showed previously that IFN-α/β contributes to the rapid leukocyte accumulation we detected in the lymph node that drains the UV-HSV-1-loaded site (Riffault et al., 1996 ). In the present analysis, we observed a significant 50% decrease (P<0·01) in leukocyte accumulation in the IFNAR1-/- 129 mice compared with wild-type mice (3·17±0·84x106 versus 6·56±1·50x106 lymph node cells at 6 h, mean±SD of four experiments). The number of cells in the contralateral lymph node remained at a control level (corresponding to time zero) and was not statistically significantly different between knockout and wild-type mice (data not shown). Therefore, the data obtained from knockout and wild-type 129 mice suggest that IFN-α/β contributes to leukocyte recruitment in the lymph node and that IL-12 provides additional signals supporting T and NK cell IFN-γ synthesis.
Studies in situ of the timing and location of IFN-α/β and IL-12 production will provide a basis for understanding the dynamic transient processes triggered by the delivery of UV-HSV-1 within the dermis, a site otherwise tractable to analysis of leukocyte trafficking (Belkaid et al., 1996 ). Indeed, the candidate leukocytes that are expected to produce these cytokines within the lymph node are (i) subcapsular resident siglec-1+ mononuclear phagocytes, (ii) leukocytes entering through the afferent lymphatic vessels and (iii) leukocytes entering through the high endothelial venules (HEV) (Girard & Springer, 1995 ; Kraal & Mebius, 1997 ; Cyster, 1999 ). Relevant markers are available for many of these leukocytes and these will be helpful in distinguishing the subcapsular macrophages, neutrophils, monocytes and dendritic cells emigrating from the epidermis/dermis or dendritic cells entering through the HEV (Salomon et al., 1998 ; Cyster, 1999 ). The early neutrophil recruitment we have observed previously in the lymph node following UV-HSV-1 delivery in the C57BL/6 ear dermis (Riffault et al., 1996 ) is consistent with a contribution by neutrophils in IL-12 synthesis at this site (Romani et al., 1997 ). As mentioned above, different teams have recently attempted to characterize the leukocytes that transcribe and produce IFN-α/β under steady-state conditions or following exposure to UV-inactivated HSV (Siegal et al., 1999 ), influenza virus (Cella et al., 1999 ) or infectious enveloped RNA and DNA viruses (Milone & Fitzgerald-Bocarsly, 1998 ). Leukocytes of the dendritic cell lineage(s) do produce and/or transcribe IFN-α/β depending on the experimental conditions, which have varied from one team to another. They are: (i) CD3- CD14- CD16- CD19- HLADR+ mannose receptor (MR)+ so-called dendritic cells (Milone & Fitzgerald-Bocarsly, 1998 ), (ii) CD3- CD11c- CD4+ preDC2, otherwise known to depend on IL-3 as an anti-apoptotic factor (Siegal et al., 1999 ), or (iii) CD11c- CD4+ HLADR+ IL-3R+ MR- so-called plasmacytoid monocytes (Cella et al., 1999 ). The latter subset can also produce a small amount of IL-12 on exposure to LPS and CD40L (Cella et al., 1999 ).
The pathways by which HSV-1 triggers human NIPC to synthesize IFN-α involve interaction between its membrane glycoprotein gD and chemokine receptors (Ankel et al., 1998 ) and/or the mannose receptor (Milone & Fitzgerald-Bocarsly, 1998 ). Whether the same pathways can trigger IL-12 expression is not yet known. NIPC are therefore a component of the host immune response that can be activated very rapidly upon infection, even before the virus undergoes replication in host cells. The local cytokine environment elicited in this way could contribute both to limiting virus spread downstream of the lymph node draining the site of virus delivery and to stimulation of virus-reactive T and B lymphocytes.
The IFN-α-producing cells that we have detected in the regional lymph node could be the mouse counterparts of the human NIPC. One further question to which an answer is needed is the following: among the cells of the dendritic lineage(s), will a subset of DC at a given stage of differentiation be directly or indirectly reactive to UV-HSV-1 by simultaneous and/or sequential synthesis/release of IFN-α/β and of bioactive heterodimeric IL-12?
We thank Brigitte Askonas and Tracy Hussell for critical reading of the manuscript. We thank G. Trinchieri for providing us with the C17.8 hybridoma. This work was supported by the Institut National de la Recherche Agronomique (INRA), the Institut Pasteur (3450) and DGA contract 95/150.References
Ankel, H., Westra, D. F., Welling-Wester, S. & Lebon, P. (1998). Induction of interferon-alpha by glycoprotein D of herpes simplex virus: a possible role of chemokine receptors.Virology 251, 317-326.[Medline]
Baudoux, P., Carrat, C., Besnardeau, L., Charley, B. & Laude, H. (1998). Coronavirus pseudoparticles formed with recombinant M and E proteins induce alpha interferon synthesis by leukocytes.Journal of Virology 72, 8636-8643.
Belardelli, F. & Gresser, I. (1996). The neglected role of type I interferon in the T-cell response: implications for its clinical use.Immunology Today 17, 369-372.[Medline]
Belkaid, Y., Jouin, H. & Milon, G. (1996). A method to recover, enumerate and identify lymphomyeloid cells present in an inflammatory dermal site: a study in laboratory mice.Journal of Immunological Methods 199, 5-25.[Medline]
Biron, C. A. (1998). Role of early cytokines, including α and β interferons (IFN-α/β), in innate and adaptive immune responses to viral infections.Seminars in Immunology 10, 383-390.[Medline]
Biron, C. A., Nguyen, K. B., Pien, G. C., Cousens, L. P. & Salazar-Mather, T. P. (1999). Natural killer cells in antiviral defense: function and regulation by innate cytokines.Annual Review of Immunology 17, 189-220.[Medline]
Cella, M., Jarrossay, D., Facchetti, F., Alebardi, O., Nakajima, H., Lanzavecchia, A. & Colonna, M. (1999). Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon.Nature Medicine 5, 919-923.[Medline]
Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction.Analytical Biochemistry 162, 156-159.[Medline]
Colle, J. H., Falanga, P. B., Singer, M., Hevin, B. & Milon, G. (1997). Quantitation of messenger RNA by competitive RTPCR: a simplified read out assay.Journal of Immunological Methods 210, 175-184.[Medline]
Cousens, L. P., Orange, J. S., Su, H. C. & Biron, C. A. (1997). Interferon-α/β inhibition of interleukin 12 and interferon-γ production in vitro and endogenously during viral infection.Proceedings of the National Academy of Sciences, USA 94, 634-639.
Cyster, J. G. (1999). Chemokines and cell migration in secondary lymphoid organs.Science 286, 2098-2102.
Dutton, R. W., Bradley, L. M. & Swain, S. L. (1998). T cell memory.Annual Review of Immunology 16, 201-223.[Medline]
Fitzgerald-Bocarsly, P. (1993). Human natural interferon-alpha producing cells.Pharmacology and Therapeutics 60, 39-62.
Girard, J. P. & Springer, T. A. (1995). High endothelial venules (HEVs): specialized endothelium for lymphocyte migration.Immunology Today 16, 449-457.[Medline]
Gresser, I., Guy-Grand, D., Maury, C. & Maunoury, M. T. (1981). Interferon induces peripheral lymphadenopathy in mice.Journal of Immunology 127, 1569-1575.[Abstract]
Hussell, T. & Openshaw, P. J. M. (1998). Intracellular IFN-γ expression in natural killer cells precedes lung CD8+ T cell recruitment during respiratory syncytial virus infection.Journal of General Virology 79, 2593-2601.[Abstract]
Ishikawa, R. & Biron, C. A. (1993). IFN induction and associated changes in splenic leukocyte distribution.Journal of Immunology 150, 3713-3727.[Abstract]
Ito, Y., Bando, H., Komada, H., Tsurudome, M., Nishio, M., Kawano, M., Matsumura, H., Kusagawa, S., Yuasa, T., Ohta, H., Ikemura, M. & Watanabe, N. (1994). HN proteins of human parainfluenza type 4A virus expressed in cell lines transfected with a cloned cDNA have an ability to induce interferon in mouse spleen cells.Journal of General Virology 75, 567-572.
Korngold, R., Blank, K. J. & Murasko, D. M. (1983). Effect of interferon on thoracic duct lymphocyte output: induction with either poly I:poly C or vaccinia virus.Journal of Immunology 130, 2236-2240.[Abstract]
Kraal, G. & Mebius, R. E. (1997). High endothelial venules: lymphocyte traffic control and controlled traffic.Advances in Immunology 65, 347-395.[Medline]
Leib, D. A., Harrison, T. E., Laslo, K. M., Machalek, M. A., Moorman, N. J. & Virgin, H. W. (1999). Interferons regulate the phenotype of wild-type and mutant herpes simplex viruses in vivo.Journal of Experimental Medicine 189, 663-672.
Milone, M. C. & Fitzgerald-Bocarsly, P. (1998). The mannose receptor mediates induction of IFN-alpha in peripheral blood dendritic cells by enveloped RNA and DNA viruses.Journal of Immunology 161, 2391-2399.
Muller, U., Steinhoff, U., Reis, L. F., Hemmi, S., Pavlovic, J., Zinkernagel, R. M. & Aguet, M. (1994). Functional role of type I and type II interferons in antiviral defense.Science 264, 1918-1921.
Orange, J. S. & Biron, C. A. (1996). Characterization of early IL-12, IFN-αβ, and TNF effects on antiviral state and NK cell responses during murine cytomegalovirus infection.Journal of Immunology 156, 4746-4756.[Abstract]
Riffault, S., Eloranta, M. L., Carrat, C., Sandberg, K., Charley, B. & Alm, G. (1996). Herpes simplex virus induces appearance of interferon-α/β-producing cells and partially interferon-α/β-dependent accumulation of leukocytes in murine regional lymph nodes.Journal of Interferon and Cytokine Research 16, 1007-1014.[Medline]
Romani, L., Mencacci, A., Cenci, E., Spaccapelo, R., Del Sero, G., Nicoletti, I., Trinchieri, G., Bistoni, F. & Puccetti, P. (1997). Neutrophil production of IL-12 and IL-10 in candidiasis and efficacy of IL-12 therapy in neutropenic mice.Journal of Immunology 158, 5349-5356.[Abstract]
Salazar-Mather, T. P., Ishikawa, R. & Biron, C. A. (1996). NK cell trafficking and cytokine expression in splenic compartments after IFN induction and viral infection.Journal of Immunology 157, 3054-3064.[Abstract]
Salomon, B., Cohen, J. L., Masurier, C. & Klatzmann, D. (1998). Three populations of mouse lymph node dendritic cells with different origins and dynamics.Journal of Immunology 160, 708-717.
Sareneva, T., Matikainen, S., Kurimoto, M. & Julkunen, I. (1998). Influenza A virus-induced IFN-α/β and IL-18 synergistically enhance IFN-γ gene expression in human T cells.Journal of Immunology 160, 6032-6038.
Siegal, F. P., Kadowaki, N., Shodell, M., Fitzgerald-Bocarsly, P. A., Shah, K., Ho, S., Antonenko, S. & Liu, Y. J. (1999). The nature of the principal type 1 interferon-producing cells in human blood.Science 284, 1835-1837.
Sinigaglia, F., DAmbrosio, D., Panina-Bordignon, P. & Rogge, L. (1999). Regulation of the IL-12/IL-12R axis: a critical step in T-helper cell differentiation and effector function.Immunological Review 170, 65-72.
Slifka, M. K., Pagarigan, R. R. & Whitton, J. L. (2000). NK markers are expressed on a high percentage of virus-specific CD8+ and CD4+ T cells.Journal of Immunology 164, 2009-2015.
Svensson, H., Johannisson, A., Nikkila, T., Alm, G. V. & Cederblad, B. (1996). The cell surface phenotype of human natural interferon-α producing cells as determined by flow cytometry.Scandinavian Journal of Immunology 44, 164-172.[Medline]
Tough, D. F., Borrow, P. & Sprent, J. (1996). Induction of bystander T cell proliferation by viruses and type I interferon in vivo.Science 272, 1947-1950.[Abstract]
van den Broek, M. F., Muller, U., Huang, S., Zinkernagel, R. M. & Aguet, M. (1995). Immune defence in mice lacking type I and/or type II interferon receptors.Immunological Review 148, 5-18.
van der Korput, J. A. G. M., Hilkens, J., Kroezen, V., Zwarthoff, E. C. & Trapman, J. (1985). Mouse interferon alpha and beta genes are linked at the centromere proximal region of chromosome 4.Journal of General Virology 66, 493-502.
Vilek, J. & Sen, G. C. (1996). Interferons and other cytokines. In Fundamental Virology, pp. 341-365. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Wysocka, M., Kubin, M., Vieira, L. Q., Ozmen, L., Garotta, G., Scott, P. & Trinchieri, G. (1995). Interleukin-12 is required for interferon-γ production and lethality in lipopolysaccharide-induced shock in mice.European Journal of Immunology 25, 672-676.[Medline]
Received 8 March 2000; accepted 30 June 2000.