Research Article

Spread of distinct human immunodeficiency virus type 1 AG recombinant lineages in Africa

Journal of General Virology 2000; 81(2):515

PubMed

Abstract

To identify new subtype G human immunodeficiency virus type 1 (HIV-1) strains and AG recombinant forms, we collected 28 serum samples from immigrants to the Netherlands from 12 countries throughout Africa. Based on the gag sequences 22 isolates were identified as subtype A or G. Phylogenetic analysis of discontinuous regions of the gag (726 nt), pol (1176 nt) and env (276 nt) genes revealed 13 AG recombinants with the mosaic structure Agag/Gpol/Aenv, three with Agag/Gpol/Genv and one other with Agag /Gpol/Genv , in addition to pure subtypes Agag/Apol/Aenv (n=1) and Ggag/Gpol/Genv (n=4). To analyse the crossover points in more detail, a new RTPCR was developed resulting in a large contiguous sequence of 2600 nt from the gag region to half the pol region. All the 13 Agag/Gpol/Aenv recombinants appeared to belong to the circulating recombinant form (CRF) AG (IbNG). The three Agag/Gpol /Genv recombinants differed from the CRF AG (IbNG) subtype, suggesting the identification of a new CRF subtype. The recovery of AG recombinants from African countries a thousand miles apart indicates the active spread of new recombinants.
Soon after human immunodeficiency virus type 1 (HIV-1) was discussed as the causative agent of AIDS, its remarkable genetic variability evoked intense interest. The largest amount of variability, a difference in the surface coding portion of the env gene of up to 35%, emerged from the initial comparison of genetic sequences of HIV-1 viruses obtained from North American and European patients with sequences from African individuals (Alizon et al., 1986 ; Benn et al., 1985 ; Shaw et al., 1984 ). Notable but less dramatic variability was observed among virus isolates from individuals in a single geographical locale (Starcich et al., 1986 ; Wong-Staal et al., 1985 ). Within individual patients, the diversity can reach 15% (Lukashov & Goudsmit, 1997 ), but the distinguishable viral variants, or quasispecies, detected during the course of infection are highly related.

Several factors contribute to the generation of new HIV variants. One is the error-prone nature of the viral reverse transcriptase (RT), which lacks proofreading functions and causes nucleotide substitutions, deletions and insertions (Mansky & Temin, 1996 ). A second factor is the high rate of virus production and the large number of replication cycles (Coffin, 1995 ). The third factor is the rapid selection for viruses of distinct fitness due to the immune pressure, coreceptor selection and/or effective antiviral drugs encountered in the infected individual. The clearest example of positive selection is the appearance, within weeks of the onset of monotherapy, of mutant viruses with reduced susceptibility to the drug administered (Schuurman et al., 1995 ; Wei et al., 1995 ). Recombination has been described as another factor that contributes significantly to HIV-1 diversity (Cornelissen et al. 1996 ; Leitner et al., 1995 ; Robertson et al., 1995 ).

Based on new criteria for defining subtypes of HIV-1 (Korber et al., 1998 ), strains can be divided into eight pure subtypes (AD, FH, J) and various circulating recombinant forms (CRFs). The subtype formerly known as E is now called CRF AE. The subtype G reference sequences show an intermediate relationship to subtype A in regions of pol, vif and env. Some have suggested that the G viruses are actually recombinant with subtype A in these regions (Gao et al., 1998 ) and should be called CRF GA. Others, however, have been unable to convincingly demonstrate a recombinant nature for the G viruses (Carr et al., 1998 ). To solve this issue completely more subtype G viruses need to be identified and sequenced. Therefore, the objective of this study was to identify new subtype G viruses and AG recombinant forms of epidemic importance.

Samples.
The first subtype G samples to be identified came from HIV-1-infected individuals living in Zaire (Louwagie et al., 1993 ), Gabon (Janssens et al., 1994 ) and Nigeria (Abimiku et al., 1994 ). To obtain a unique set of new subtype G samples, we collected serum from immigrants to the Netherlands of African origin, who were assumed to have been infected in their home country. Samples were collected from individuals, known or suspected to be infected with an African HIV-1 strain, who had been identified by the epidemiological investigation to which every newly diagnosed HIV case is subjected at the Amsterdam Medical Centre clinic. We selected 34 serum samples and, only if all three RTPCR amplifications were positive, did we proceed by sequencing the gag gene. In total, 28 serum samples were analysed by sequencing: 13 from Ghana, two from Cameroon, two from Liberia, two from Rwanda and one each from Angola, Kenya, Mozambique, Nigeria, Somalia, Tanzania, Zaire and Zambia. One serum sample was collected from a Caribbean individual and found to have a subtype G V3 sequence. The samples are listed (Table 1) according to UNAIDS nomenclature denoting the year of sampling, the country of origin (two-letter code) and the patient number (Korber et al., 1994 ). For example, 94GH10 denotes serum samples collected in 1994 (94) from an individual from Ghana (GH) whose patient number is 10.


Table 1. Genetic subtyping of HIV-1 in samples collected from African immigrants


PCR.
Nucleic acids were isolated by the procedure described by Boom et al. (1990) using 200 µl serum. The primer positions and RT-conditions employed in the various PCRs were identical to those described previously for gag (Cornelissen et al., 1996 ), pol (Cornelissen et al., 1997 ), and env and MS2 (Cornelissen et al., 1995 ). A sequence of 729 nucleotides (nt) encoding 243 amino acids (aa) of the gag gene was amplified, including 109 aa of the P17 protein and 134 aa of the P24 protein. A 1176 nt pol fragment was sequenced encoding 392 aa, including 297 aa of the RT protein and 95 aa of the Protease protein. The first 4 aa of Protease were part of the 5' nested sense primer. For the env gene we analysed approximately 276 nt encoding the V3 loop (92 aa). A new RTPCR was developed to identify the crossover sites of 22 isolates characterized as A, G or AG. The resulting PCR product contained the coding information for the 3'end P24, P7 and P6 peptides, the spacer peptide sequences P2 and P1, and five proteolytic cleavage sites. Moreover, this fragment had a 49 nt overlap with the gag sequences and a 49 nt overlap with the protease sequences, resulting in a large contiguous sequence of 2600 nt. From stored samples of isolated nucleic acids, 10 µl volumes were used in the RT reaction with an antisense primer (5' TAATACTGTATCATCTGCTCCT, 3' HxB2 positions 23292350). This primer is located in the protease part of the pol gene. After incubation of the mixture for 45 min at 42 °C, we added a PCR mixture containing the sense primer (5' GGGGAAGTGACATAGCAG GAACTA, 3' HxB2 positions 14831506), PCR buffer, deoxynucleotide triphosphate, 2·0 mM MgCl2 and 2 U of Taq polymerase (Perkin Elmer Cetus). This reaction mixture was subjected to 35 cycles of amplification in a type 9700 DNA thermal cycler (Perkin Elmer Cetus). A nested PCR was performed to obtain enough material for direct sequencing. To generate a fragment of 807 bp 1/20th of the first PCR product was amplified for 25 cycles with the sense primer (5' GATTTAGGTGACACTATAGTGGGAGAAATCTATAAAAGATGG, 3' HxB2 positions 15611583) and the antisense primer (5' TAATACGACTCACTATAGGGTACTGTGACAAGGGGTCGTTGCCA, 3' HxB2 positions 22672290). The production of amplified material by all the different PCRs was verified by electrophoresis on 1% agarose gels stained with ethidium bromide.

DNA sequencing.
The PCR fragments were directly sequenced on both strands, as previously described (Cornelissen et al., 1997 ). Alignment of the sequences was straightforward and was performed manually. Phylogenetic analyses were done by the neighbour-joining method as implemented in the MEGA program (Kumar et al., 1993 ) and the reliability of the trees was estimated by bootstrap replications. All statistical calculations were done with SPSS/PC+ software (version 5.0; SPSS Inc.).

Bootscanning.
To identify recombination breakpoints we used the bootscanning method as implemented in the SIMPLOT program for Microsoft Windows. In this program, a panel of reference sequences is moved across the query sequence (Ray, 1999 ). Our bootscan analyses were done with a window of 300 bp moving along the alignment in increments of 20 bp. We evaluated 100 replicates generated by the bootstrap resampling for each phylogeny, plotting the percent bootstrap values of the query sequence with the sequence from the reference panel.

gag sequence analysis
The geographical distribution of the different genetic subtypes of HIV is very heterogeneous. Subtype A is the most prevalent subtype in Africa, although subtype G has been documented in many West and Central African countries (Janssens et al., 1997 ). We selected serum samples obtained from African immigrants to the Netherlands who were born and raised in countries with documented cocirculation of subtypes A and G. To minimize our sequence work, we started with gag sequences to identify the A and G samples and further analysed only these two subtypes by sequencing the env and pol PCR products (see Methods).

Fig. 1 shows the neighbour-joining tree generated with gag sequences and compared with a set of reference sequences. In this phylogenetic tree, several major groups of related sequences were easily discernible and corresponded to HIV-1 subtypes A, B, C, D and G (bootstrap value 98100). Most strains from our African sample collection belong to subtype A (n=18), but we also identified four gag sequences of subtype G, three of subtype C, one of subtype B and two of subtype D. The presence of mainly non-B subtypes among individuals originating from HIV endemic areas has been reported previously (Alaeus et al., 1997 ; Clewly et al., 1996 ; Franzen et al., 1996 ; Op de Coul et al., 1998 ). One individual carried subtype B (92RW44), and since this subtype dominates in Europe he had probably been infected after his arrival in the Netherlands.



(19K):

Fig. 1. Results of phylogenetic analysis of the gag gene (729 nt) sequences by the neighbour-joining method [implemented as part of the MEGA program (Kumar et al., 1993 )] from 28 serum samples collected from individuals known or suspected to be infected with an HIV-1 strain originating in Africa (see Methods). Subtype-specific gag sequences taken from our previous work (Cornelissen et al., 1996 ) and from the Los Alamos database (Korber et al., 1997) were included as references in the analysis. These reference sequences are not denoted by the UNAIDS code (see Methods) but by their subtype designation. Values at nodes indicate the percentage of bootstraps in which the cluster to the right was found; only values greater than 75% are shown, because bootstrap values lower than 75% correspond to a probability of less than 95% that the clade is true (Hillis & Bull, 1993 ). Brackets at the right indicate the major sequences subtypes.

Within the major subtype A group, four sequence clusters (Fig. 1, depicted A, A', AE and AG) could be observed, all four supported by a significant bootstrap value (83100%). The Central African samples, Rwanda and Uganda, represent a distinct group of the subtype A family, named A. The Thai AE sequences were included as references. Since not one virus from our African collection clustered with this group, it is highly unlikely that any of our serum samples harboured CRF AE viruses. Another distinct subcluster of 14 samples (bootstrap value 97%, Fig. 1, AG) was most closely related to the DJ258 sequences (Louwagie et al., 1993 ) from Djibouti and the IbNG sequences from Nigeria (Howard & Rasheed, 1996 ), now called CRF AG (IbNG). The last distinct subcluster of subtype A is represented by three gag sequences: two from Ghana and one from Nigeria (Fig. 1, A'). Four samples from our African collection were closely associated with subtype G.

env sequences
Only the gag subtype A family (n=18) and the four gag subtype G samples were analysed by sequencing the env V3 region and a large part of the pol gene. Fig. 2(a) shows a neighbour-joining tree of the env V3 region sequence fragments (about 276 nt). Based on the report of Hilles & Bull (1993) in which bootstrap proportions of 75% correspond, in most situations, to a probability of 95% that the corresponding clade is genuine, there are four established subtypes: subtype A, G, B, D and one CRF AE. Among our samples the high bootstrap value of the subtype G (bootstrap value 98%) and subtype A clades (bootstrap value 89%) strongly indicated that they were indeed true clades. Within the subtype A family we observed two distinct sequence clusters with bootstrap values of 88% (AG) and 79% (A), respectively. The latter was formed by the isolates from Central Africa, Uganda and Rwanda; the former included our new African samples, mainly from Ghana, which were closely related to DJ258 and IbNG, the recently described CRF AG (IbNG). There is a high frequency of recombination events in the gag gene and/or discordant branching between the gag and env genes (Cornelissen et al., 1996 ). Based on the phylogenetic analysis of the gag and env gene fragments, four strains had to be considered recombinants: 97NG18, 97GH19, 97GH22 and 94GH09 (Agag/Genv). Although 97NG18, 97GH19 and 97GH22 represented a true sequence A subcluster in the gag tree, in the env tree they were indistinguishable from the other subtype G genotypes.



(29K):

Fig. 2. Results of the neighbour-joining phylogenetic analysis of (a) the env gene fragment (276 nt) and (b) the pol gene, encoding Protease and half of RT (1176 nt).

pol sequences
To further investigate the subtype classification of the selected subtype A and G samples, we constructed phylogenetic neighbour-joining trees based on the protease gene and half of the RT gene (1176 nt) (Fig. 2b). Based on the position of the reference subtype G sequences, SE6165, the large distinct cluster in Fig. 2(b) (>>96% bootstrap value) can be identified as subtype G.

Surprisingly, thissubtype G cluster showed three sequence clusters supported by significant bootstrap values. The major group (Fig. 2b, AG bootstrap value 100%) clustered together with IbNG and represented a large (n=13) recombinant group: Agag/Gpol/Aenv. To confirm the observed sequence relationship of IbNG and DJ258, we determined the pol sequences of DJ258. The phylogenetic pol tree showed a tight clustering of these two reference sequences. Two other sequence clusters were observed, one containing the newly identified recombinants 97NG18, 97GH19 and 97GH22 (Agag/Gpol/Genv)(Fig. 2b, G') and the other group clustering with SE6165 (Fig. 2b, G). The 94GH09 sequence fell into the large group of IbNG-related sequences. All phylogenetic analyses are summarized in Table 1. Taken together, the phylogenetic analyses demonstrated that we have identified different AG mosaic forms Agag/Gpol/Aenv (n=13) and Agag/Gpol/Genv (n=4) in addition to pure subtypes Ggag/Gpol /Genv (n=4) and Agag/Apol/Aenv (n=1) viruses. Each group represents a distinct monophyletic group, as indicated by the significantly high bootstrap values in the different genome fragment analyses (Figs 1 and 2).

Identification of crossover sites
The 13 strains of the major recombinant group, CRF AG (IbNG), have a recombination site between P24 and the start of Protease. To examine whether the four newly identified recombinants show the same structure as the large group, we developed a new RTPCR followed by a direct sequence analysis. The sequences contained the coding information for the 3'end P24, P7 and P6 peptides, the spacer peptides P1 and P2, and five proteolytic cleavage sites. Moreover, they had a 49 nt overlap with the gag sequences and a 49 nt overlap with the protease sequences, resulting in a large contiguous sequence of 2600 nt (5' gaghalf RT) from each individual sample. Phylogenetic neighbour-joining trees based on various parts of gag and pol sequences were constructed to investigate the 22 newly derived A, G or AG sequences. Two patterns were observed (data not shown). Whereas IbNG- and DJ258-related sequences appeared to have a crossover site surrounding the gag/protease cleavage site, sequences 97NG18, 97GH19 and 97GH22 had a crossover site in the P24 part of the gag gene and an unidentified region in the RT part of the pol gene. The 97GH09 sequences showed high similarity with the large group of IbNG- and DJ258-related sequences. To identify the crossover sites more precisely, the sequences were analysed with the pprogram SIMPLOT, which implements bootscanning (see Methods). In these analyses a sliding window of 300 nt was moved across the aligned sequences in steps of 20 nt. The magnitude of the bootstrap values supporting the clustering of our AG recombinants with reference subtypes A, B, C, D, F, G, H and J was determined (data not shown). To determine whether the IbNG virus was truly a parental strain, we performed bootstrap plot analysis with IbNG, subtype C (C2220), subtype F (93Br020) and each member of the large mosaic group. Fig. 3(b) shows an example, 95GH14, confirming the phylogenetic relationship between IbNG and this large group. The bootscan graph of sample 94GH09 was identical with this large group of recombinant (Fig. 3c) viruses, confirming the observation from the phylogenetic tree analysis that the gag and pol sequences of 94GH09 were derived from an IbNG AG CRF virus. The graphs for samples 97NG18, 97GH19 and 97GH22 were different from the previous two graphs, as shown in Fig. 3(d) for subtype A (92UG37A), subtype C (C2220), subtype G (SE6165G) and query 97GH19. The bootscan plots for sequences 97NG18 and 97GH22 were similar (data not shown). This bootstrap profile (Fig. 3d) clearly indicates a breakpoint in the gag region, resulting in an AG recombinant gag gene. For the RT gene the bootstrap profile shows an intermediate relationship in small regions (from nt 16502000 in Fig. 3d). This result confirmed the observation of the short fragment phylogenetic analysis.



(26K):

Fig. 3. Analysis of mosaic structures by bootscanning. The analyses are based on neighbour-joining tree analysis [Kimura two-parameter distances (Kimura, 1980 )] with bootstrapping. The bootstrap values that support the clustering of the query sequences with the references are plotted. The chosen window size is 300 nt, moving in steps of 20 nt along the alignment. (a) Map of the HIV-1 genome to show the region used in the bootscan analyses. (b) Plot analysis of the query 94GH14 versus IbNG (red), subtype C (C2220 green) and subtype F (93BR020 purple). (c) Query 94GH09 versus IbNG (red), subtype C (C2220 green) and subtype F (93BR020 purple). (d) Query 97GH19 versus subtype G (SE6165 yellow), subtype A (92UG37 black) and subtype C (C2220 green).

With the precision attainable by the technique, common breakpoints for the CRF AG (IbNG) sequences were identified between 1400 and 1465 nt, counting the start codon ATG of gag as nt 1. This site is located near the Gag/Protease cleavage site and confirmed the published IbNG crossover points (Carr et al., 1998 ). All our IbNG-related sequences showed similar crossover sites and an evolutionary linkage was observed in the phylogenetic analysis. This suggests that those sequences originated from a common ancestor. The crossover site of sample 94GH09 was identical with that of the IbNG- and DJ258-related sequences. Thus, its gag and pol regions appeared to derive from the same common ancestor as the recently identified IbNG family. The different phylogenetic position of the env sequence of 94GH09 (subtype G) (Figs 1 and 2a ) can be explained by the occurrence of another recombination event after the spread of this family.

The crossover site analysis of the three samples, 97NG18, 97GH19 and 97GH22, revealed identical crossover sites, one located at the C-terminal end of P24 and two in the 5'end of the RT gene, where an unidentified region was observed. Although sequence 97GH19 showed characteristics of subtype A in that region, the two other sequences, 97NG22 and 97NG18, could not be identified by comparison with all the reference sequences (data not shown). The similar crossover sites and unidentified regions at the same position suggest that these three viruses are derived from another common ancestor. The various AG mosaic structures observed in this study are depicted in Fig. 4.



(25K):

Fig. 4. Composite picture summarizing the results of the phylogenetic as well as the crossover site analyses. Regions of subtype A and subtype G origin are indicated, respectively; white boxes represent regions that are not yet subtyped. Three different mosaic forms are observed among the AG recombinants. The number of isolates sharing the same mosaic structure is indicated far-right.
In our study of the ongoing process of generation and selection of HIV-1 variants, we identified 13 samples belonging to the CRF AG (IbNG) family and four subtype G viruses. However, the apparently nonrecombinant subtype G strains may contain segments of different subtypes in their unsequenced regions.

The similarity between CRF AE viruses and CRF AG (IbNG) is striking throughout the genome. First, both are inter-subtype recombinants of subtype A (AE and AG, respectively). Second, the AE viruses spread rapidly and largely through heterosexual transmission routes and the recently identified IbNG-like family appears to share these characteristics. It is widely distributed in West Africa (see Table 1) and we collected samples from individuals from Ghana, Liberia and Cameroon, but clearly the same phylogenetic behaviour was seen in isolates from Djibouti, Nigeria, Gabon, Côte dIvoire (Louwagie et al., 1993 ) and Senegal (unpublished data). The major transmission routes of HIV-1 in Africa are between heterosexuals and vertically from mother to child. Third, CRF AE viruses are highly related to each other at the genetic level, presumably reflecting a founder effect. The CRF AG (IbNG) viruses are also highly related to each other but with a higher degree of genetic divergence, which could be seen in the trees as larger branches. This difference between the subtype AE viruses and AG viruses can be explained by the different times at which they were introduced into the population. Serology and genetic analyses show that subtype AE viruses were introduced into the Thai population relatively late in the global epidemic, between 1988 and 1989 (Ou et al., 1993 ). In contrast, seroepidemiological data from Central Africa suggest that although HIV and AIDS were rare and sporadic before the 1960s, HIV infection was clearly spreading during the 1970s. The sequence of ZR.59 from a sample obtained in the Democratic Republic of Congo in 1959 is the earliest known HIV-1 sequence (Zhu et al., 1998 ). Phylogenetic analysis placed its origin very near the ancestral node of the B, D and F clades of the M group. IbNG itself was isolated in 1991 from the peripheral blood mononuclear cells of a 23-year-old blood donor from Ibadan, Nigeria (Howard & Rasheed, 1996 ; Olaleye et al., 1996 ). Other recombinant AG viruses from Central Africa were collected in the mid-1970s and 1980s, including Z321, isolated from a previously frozen serum sample obtained in 1976, and VI191, which was isolated in 1989 from a Belgian who may have acquired the virus while working in Zaire from 1979 to 1984 (Choi et al., 1997 ; Dube et al., 1994 ; Getchell et al., 1987 ). Fourth, multiple points of recombination crossover sites have been identified in the AE viruses (Gao et al., 1996 ; Carr et al., 1996 ) and, importantly, all AE viruses show the same pattern of mosaics, indicating that they are derived from a common recombinant ancestor. Although only the gag, pol and env gene fragments of the AG group have been sequenced, all exhibited a crossover site near the Gag/Protease proteolytic cleavage site, strongly suggesting derivation from a common recombinant ancestor. This conclusion is confirmed by the full-length genome sequencing of two Djibouti isolates (DJ263 and DJ264) (Carr et al., 1998 ).

Our phylogenetic analysis of the gag and pol sequences of 94GH09 revealed this sample to be a true member of the CRF AG (IbNG) group. However, the env tree suggested that there had been a recombination event after the spread of this ancestor, with a crossover site (or sites) in the region between pol and env.

Finally, we have documented a new recombinant AG structure with alternating segments of subtype A and G in one strain from Nigeria (97NG18) and two from Ghana (97GH19 and 97GH22). These three samples shared similar variants in gag and pol sequences, forming a distinct and significant sequence cluster within subtype A and G. However, we were unable to show that the env sequences were statistically more closely related to each other than to the other members of env subtype G. Three criteria should be fulfilled to define a new CRF. First, the isolates should have been found in at least two epidemiologically unlinked individuals. Strain 97NG18 was isolated from a Nigerian man, whereas the two other samples were isolated from individuals born a thousand miles away in Ghana. Second, they should resemble each other but no other existing CRF in their subtype structure. The third and most important criterion is that at least two isolates should be sequenced in their entirety. Thus, further investigations are needed to confirm if this group of three isolates represents a new CRF AG subtype. The identification of new unique recombinant viruses does not point to a major global epidemic. However, the identification of mosaic viruses, which spread from one location to another and can be associated with new outbreaks of epidemic, has important implications for HIV vaccine strategies.

We are greatly indebted to Suzanne Jurriaans and Margreet Bakker for helping to collect the non-B cohort samples; their help came perilously close to co-authorship. We thank John Mascola of the Henry M. Jackson Foundation at Rockville, MD, for sending the DJ258 isolate, Eline op de Coul for running the SIMPLOT program, Els van Zijl for assistance with typing work and Lucy Phillips for editing the manuscript.

References

Abimiku, A. G., Stern, T. L., Zwandor, A., Markham, P. D. & Calef, C. (1994). Subgroup G HIV type 1 isolates from Nigeria. AIDS Research and Human Retroviruses 10, 1581-1583.[Medline]

Alaeus, A., Leitner, T., Lidman, K. & Albert, J. (1997). Most HIV-1 genetic subtypes have entered Sweden. AIDS 11, 199-202.[Medline]

Alizon, M., Wain-Hobson, S., Montagnier, L. & Sonigo, P. (1986). Genetic variability of the AIDS virus: nucleotide sequence analysis of two isolates from African patients. Cell 46, 63-74.[Medline]

Benn, S., Rutledge, R., Folks, T., Gold, J., Baker, L., McCormick, J., Feorino, P., Piot, P., Quinn, T. & Martin, M. (1985). Genomic heterogeneity of AIDS retroviral isolates from North America and Zaire. Science 230, 949-951.[Abstract/Free Full Text]

Boom, R., Sol, C. J. A., Salimans, M. M. M., Jansen, C. L., Wertheim-van Dillen, P. M. E. & van der Noordaa, J. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495-503.[Abstract/Free Full Text]

Carr, J. K., Salminen, M. O., Koch, C., Gotte, D., Artenstein, A. W., Hegerich, P. A., St Louis, D., Burke, D. & McCutchan, F. E. (1996). Full-length sequences and mosaic structure of human immunodeficiency type 1 isolate from Thailand. Journal of Virology 70, 5935-5943.[Abstract]

Carr, J. K., Salminen, M. O., Albert, J., Sanders-Buell, E., Gotte, D., Birx, D. L. & McCutchan, F. E. (1998). Full genome sequences of human immunodeficiency virus type 1 subtypes G and A/G intersubtype recombinants. Virology 247, 22-31.[Medline]

Choi, D. J., Dube, S., Spicer, T. P., Slade, H. B., Jensen, F. C. & Poiesz, B. J. (1997). HIV type 1 Z321, the strain used to make a therapeutic HIV type 1 immunogen, is intersubtype recombinant. AIDS Research and Human Retroviruses 13, 357-361.[Medline]

Clewly, J. P., Arnold, C., Barlow, K. L., Grant, P. R. & Parry, J. V. (1996). Diverse HIV-1 genetic subtypes in UK. Lancet 347, 1487.[Medline]

Coffin, J. M. (1995). HIV population dynamics in vivo: implications for genetic variation, pathogenesis and therapy. Science 267, 483-489.

Cornelissen, M., Mulder-Kampinga, G., Veenstra, J., Zorgdrager, F., Kuiken, C., Hartman, S., Dekker, J., van der Hoek, L., Sol, C., Coutinho, R. & Goudsmit, J. (1995). Syncytium-inducing (SI) phenotype suppression at seroconversion after intramuscular inoculation of a non-syncytium-inducing/SI phenotypically mixed human immunodeficiency virus population. Journal of Virology 69, 1810-1818.[Abstract]

Cornelissen, M., Kampinga, G., Zorgdrager, F., Goudsmit, J. & UNAIDS Network for HIV Isolation and Characterization (1996). Human immunodeficiency virus type 1 subtypes defined by env show high frequency of recombinant gag genes. Journal of Virology 70, 82098212.[Abstract]

Cornelissen, M., van den Burg, R., Zorgdrager, F., Lukashov, V. & Goudsmit, J. (1997). Pol gene diversity of five human immunodeficiency virus type 1 subtypes: evidence for naturally occurring mutations that contribute to drug resistance, limited recombination patterns and common ancestry for subtypes B and D. Journal of Virology 71, 6348-6358.[Abstract]

Dube, D. K., Dube, S., Erensoy, S., Jones, P., Bryz-Gornia, V., Spicer, T., Love, J., Saksena, N., Lechat, M. F., Shrager, D. I., Dosik, H., Glaser, J., Levis, W., Blattner, W., Montagna, R., Blumberg, B. S. & Poiesz, B. J. (1994). Serological and nucleic acid analyses for HIV and HTLV infection on archival human plasma samples from Zaire. Virology 202, 379-389.[Medline]

Franzen, L., Buve, A., Nkengasong, J. N., Lage, M. & van der Groen, G. (1996). Longstanding presence in Belgians of multiple non-B HIV 1 subtypes. Lancet 347, 1403.[Medline]

Gao, F., Robertson, D. L., Morrison, S. G., Hui, H., Craig, S., Decker, J., Fultz, P. N., Girard, M., Shaw, G. M., Hahn, B. H. & Sharp, P. M. (1996). The heterosexual human immunodeficiency virus type 1 epidemic in Thailand is caused by an intersubtype (A/E) recombinant of African origin. Journal of Virology 70, 7013-7029.[Abstract/Free Full Text]

Gao, F., Robertson, D. L., Carruthers, C. D., Morrison, S. G., Jian, B., Jhen, Y., Barré-Sinoussi, F., Girard, M., Srinivasan, A., Abimiku, A. G., Shaw, G. M., Sharp, P. M. & Hahn, B. H. (1998). A comprehensive panel of near-full-length clones and reference sequences for non-subtype B isolates of human immunodeficiency virus type 1. Journal of Virology 72, 5680-5698.[Abstract/Free Full Text]

Getchell, J. P., Hicks, D. R., Svinivasan, I., Heath, J. L., York, D. A., Malonga, M., Forthal, D. N., Mann, J. M. & McCormick, J. B. (1987). Human immunodeficiency virus isolated from a serum sample collected in 1976 in Central Africa. Journal of Infectious Diseases 156, 833-837.[Medline]

Hillis, D. M. & Bull, J. J. (1993). An empirical test for bootscanning as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42, 182-192.

Howard, T. M. & Rasheed, S. (1996). Genomic structure and nucleotide sequence analysis of a new HIV type A strain from Nigeria. AIDS Research and Human Retroviruses 12, 1413-1425.[Medline]

Janssens, W. L., Heyndrickx, L., Fransen, K., Motte, J., Peeters, M., Nkengasong, J. N., Ndumbe, P. M., Delaporte, E., Perret, J.-L., Atende, C., Piot, P. & van der Groen, G. (1994). Genetic and phylogenetic analysis of env subtypes G and H in Central Africa. AIDS Research and Human Retroviruses 10, 877-879.[Medline]

Janssens, W. L., Buvé, A. & Nkengasong, J. N. (1997). The puzzle of HIV-1 subtypes in Africa. AIDS 11, 705-712.[Medline]

Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitution through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]

Korber, B. T. M., Osmanov, S., Esparza, J., Myers, G. & WHO Network for HIV Isolation and Characterization (1994). The World Health Organization global programme on AIDS proposal for standardization of HIV sequence nomenclature. AIDS Research and Human Retroviruses 11, 13551358.

Korber, B., Kuiken, C., Foley, B., Hahn, B., McCutchan, F., Mellors, J. & Sodroski, J. (1998). Human Retroviruses and AIDS 1998. A Compilation and Analysis of Nucleic Acid and Amino Acid Sequences. Los Alamos, NM: Theoretical Biology and Biophysics, Los Alamos National Laboratory.

Kumar, S., Tamura, K. & Wei, M. (1993). MEGA: molecular evolutionary genetics analysis, version 1.0. PA 16802, Pennsylvania.

Leitner, T., Escanilla, D., Marquina, S., Wahlberg, J., Brostrom, C., Hansson, H. B., Uhlen, M. & Albert, J. (1995). Biological and molecular characterization of subtype D, G, and A/D recombinant HIV-1 transmissions in Sweden. Virology 209, 136-146.[Medline]

Louwagie, J., McCutchan, F. E., Peeters, M., Brennan, T. P., Sanders, B. E., Eddy, G. A., van der Groen, G., Fransen, K., Gershy-Damet, G.-M., Deleys, R. & Burke, D. S. (1993). Phylogenetic analysis of gag genes from 70 international HIV-1 isolates provides evidence for multiple genotypes. AIDS 7, 769-780.[Medline]

Lukashov, V. V. & Goudsmit, J. (1997). Evolution of the human immunodeficiency virus type 1 subtype-specific V3 domain is confined to a sequence space with fixed distance to the subtype consensus. Journal of Virology 71, 6332-6338.[Abstract]

Mansky, L. M. & Temin, H. M. (1996). Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. Journal of Virology 69, 5087-5094.[Abstract]

Olaleye, D. O., Sheng, Z., Howard, T. M. & Rasheed, S. (1996). Isolation and characterization of a new subtype A variant of human immunodeficiency virus type 1 from Nigeria. Tropical Medicine and International Health 1, 97-106.

Op de Coul, E. L. M., Lukashov, V. V., van Doornum, G. J. J., Goudsmit, J. & Coutinho, R. A. (1998). Multiple HIV-1 subtypes present among heterosexuals in Amsterdam 19881996: no evidence for spread of non-B subtypes. AIDS 12, 1253-1255.[Medline]

Ou, C. Y., Takebe, Y., Weniger, B. G., Luo, C. C., Kalish, M. L., Auwanit, W., Yamazaki, S., Gayle, H. D., Young, N. L. & Schochetman, G. (1993). Independent introduction of two major HIV-1 genotypes into distinct high-risk populations in Thailand. Lancet 341, 1171-1174.[Medline]

Ray, S. C. (1999). Simplot for Windows. (http://www.med.jhu.edu/deptmed/scray/download/simplot).

Robertson, D. L., Sharp, P. M., McCutchan, F. E. & Hahn, B. H. (1995). Recombination in HIV-1. Nature 374, 124-126.[Medline]

Schuurman, R., Nijhuis, M., van Leeuwen, R., Schipper, P., de Jong, D., Collis, P., Danner, S. A., Mulder, J., Loveday, C., Christopherson, C., Kwok, S., Sninsky, J. & Boucher, C. A. B. (1995). Rapid changes in human immunodeficiency virus 1 RNA load and appearance of drug resistance mutations in individuals treated with lamivudine. Journal of Infectious Diseases 171, 1411-1419.[Medline]

Shaw, G. M., Hahn, B. H., Arya, S. K., Groopman, J. E., Gallo, R. C. & Wong-Staal, F. (1984). Molecular characterization of human T-cell leukemia (lymphotropic) virus type III in the acquired immune deficiency syndrome. Science 226, 1165-1171.[Abstract/Free Full Text]

Starcich, B. R., Hahn, B. H., Shaw, G. M., McNeely, P. D., Modrow, S., Wolf, H., Parks, E. S., Parks, W. P., Josephs, S. F., Gallo, R. C. & Wong-Staal, F. (1986). Identification and characterization of conserved and variable regions in the envelope gene of HTLVIII/LAV, the retrovirus of AIDS. Cell 45, 637-648.[Medline]

Wei, X., Ghosh, S. K., Taylor, M. E., Johnson, V. A., Emini, E. A., Deutsch, P., Lifson, J. D., Bonhoeffer, S., Nowak, M. A., Hahn, B. H., Saag, M. S. & Shaw, G. M. (1995). Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373, 117-122.[Medline]

Wong-Staal, F., Shaw, G. M., Hahn, B. H., Salahuddin, S. Z., Popovic, M., Markham, P., Redfield, R. & Gallo, R. C. (1985). Genomic diversity of human T-lymphotropic virus type III (HTLV-III). Science 229, 759-762.[Abstract/Free Full Text]

Zhu, T., Korber, B. T., Nahmias, A. J., Hooper, E., Sharp, P. M. & Ho, D. D. (1998). An African HIV-1 sequence from 1959 and implications for the origin of the epidemic. Nature 391, 594-597.[Medline]

Received 24 June 1999; accepted 8 November 1999.