Abstract
Members of the genus Bunyavirus, family Bunyaviridae, have a genome consisting of three segments of single-stranded, negative-sense RNA designated large (L), medium (M) and small (S). The L segment encodes a large protein that contains the RNA polymerase activity for replication and transcription of the genomic RNA segments. The M segment encodes a precursor polypeptide which gives rise to viral surface glycoproteins G1 and G2, and a non-structural protein NSm. The S segment encodes two proteins, the nucleocapsid (N) protein and a smaller non-structural protein, NSs, in overlapping reading frames (Elliott, 1990 ).
Oropouche (ORO) virus, a member of the Simbu serogroup of the genus Bunyavirus, is an important human pathogen that causes an acute febrile dengue-like illness called ORO fever (LeDuc & Pinheiro, 1989 ). During outbreaks, ORO virus is transmitted by the biting midge Culicoides paraensis. Over the past 38 years, ORO fever has emerged as an increasing public health problem in tropical regions of South America. ORO virus was first isolated in 1955 from the blood of a febrile forest worker in Trinidad (Anderson et al., 1961 ). However, it was not until 1961, when an urban outbreak of ORO fever occurred in Belem, Brazil, that the epidemic potential of the virus was realized (Pinheiro et al., 1962 ). It is estimated that 11000 human infections occurred during that initial outbreak. Subsequently, there have been at least 30 additional outbreaks of ORO fever with the estimated number of cases in these outbreaks varying from a few hundred to approximately 100000 (Pinheiro et al., 1998 ). To date, human cases of ORO fever have been confirmed in Trinidad, Brazil, Panama and Peru.
Given the public health importance of ORO virus, surprisingly little attention has been paid towards understanding its molecular biology. To date, no nucleotide sequence information is available for any segment of the ORO virus genome. Little strain variation has been noted among ORO viruses when examined by routine virological techniques (LeDuc & Pinheiro, 1989 ). However, more sensitive methods, such as nucleotide sequencing and phylogenetic analyses, have never been attempted to address this issue. To understand the genetic relationships among strains of ORO virus, the N protein coding regions of 28 strains, including the prototype strain TRVL 9760, were determined and compared phylogenetically.
The ORO virus strains used in this study represented low passage isolates obtained from the World Arbovirus Reference Center at the University of Texas Medical Branch, Galveston. The geographical origins, sources and years of isolation of these strains are listed in Table 1. To determine the nucleotide sequence of the S RNA segment, the prototype strain was grown in monolayer cultures of Vero cells. Viral RNA was extracted from the supernatant of infected cell culture using the method described by Ni & Barrett (1995) . An RTPCR assay was utilized for the synthesis and amplification of S cDNA using primers ORO1A (5' AGTAGTGTACTCCACTAT 3') and ORO2S (5' AGTAGTGTGGCTCCACAT 3'). These primers corresponded to the highly conserved termini of the S RNA segment of viruses belonging to the genus Bunyavirus, as described by Dunn et al. (1994) . Reverse transcription was carried out in a 10 µl reaction including 5 µl viral RNA, 0·5 µg primer ORO1A, 50 mM TrisHCl, pH 8·3, 75 mM KCl, 3·0 mM MgCl2, 2 mM DTT, 20 U RNasin RNase inhibitor (Promega), 1 mM each of dATP, dGTP, dTTP, dCTP (Boerhinger Mannheim) and 6 U RAV-2 reverse transcriptase (Amersham). The reaction was carried out for 24 h at 52 °C. PCR was carried out in a 50 µl volume by mixing the cDNA above with 0·5 µg of primer ORO2S, 1 mM each of dATP, dGTP, dTTP, dCTP, 10 mM TrisHCl, 1·5 mM MgCl2, 50 mM KCl, pH 8·3, and 2·5 U Taq DNA polymerase (Boerhinger Mannheim). Thirty cycles, each consisting of 95 °C for 40 s, 52 °C for 40 s and 72 °C for 4 min., were carried out in a thermal cycler (GeneAmp 9600, Perkin-Elmer). The PCR product was analysed by electrophoresis through an agarose gel, and the cDNA band was extracted from the gel using the Qiagen gel extraction kit according to the manufacturers instructions. The purified amplicon was ligated to a bacterial cloning vector (pCRII, Invitrogen), amplified in bacteria and recovered using the S.N.A.P plasmid miniprep kit (Invitrogen). Subsequently, the nucleotide sequence of the cloned cDNA was determined by the dideoxy chain termination method using a dye primer cycle sequencing kit (Applied Biosystems) and resolved in an ABI 377 DNA sequencer. Both cDNA strands were sequenced for at least three plasmid clones. The amplified cDNA was found to be 754 nucleotides in length. Analysis of the nucleotide sequence data revealed that in the virion-complementary orientation it contained a 44 nucleotide long 5' non-coding region (corresponding to the 3' non-coding region of viral RNA), followed by two overlapping open reading frames (ORFs). The larger ORF corresponded to the N protein-coding region and consisted of 693 nucleotides (nucleotides 45737), while the smaller ORF corresponded to the NSs protein-coding region and consisted of 273 nucleotide (nucleotides 67339). The N and NSs ORFs were predicted to encode polypeptides of 231 and 91 amino acids, respectively. Following the two ORFs, there was a very short 3' NCR (corresponding to the 5' NCR in viral RNA) only 17 nucleotides in length, including the primer binding sequence. This short sequence contrasts with other members of the genus Bunyavirus, including other Simbu serogroup viruses that have been sequenced, in which the corresponding 3' NCR is much longer (100 or more nucleotides in length). In order to determine whether the cloned cDNA faithfully represented the 5' NCR of the ORO viral RNA a number of approaches were used. First, the RTPCR was carried out using primers AKSRS and AKSRL, described by Akashi et al. (1997b) for the cloning and sequencing of S cDNA of Akabane virus. Second, purified ORO viral RNA was subjected to chemical denaturation using methylmercury hydroxide, as described by Bowen et al. (1995) , prior to RTPCR, which was carried out incorporating either ORO1A/ORO2S or AKSRS/AKSRL primer pairs. Finally, RACE (rapid amplification of cDNA ends), a technique specifically designed to clone the terminal sequences, was carried out with either purified viral RNA or total RNA from ORO-infected Vero cells, using a 5' RACE kit (Gibco-BRL), according to the manufacturers instructions. The cDNA obtained by each of the above methods was cloned into pGEMT-easy vector (Promega) and T7 and SP6 promoter primers, directed towards the regions flanking the cDNA cloning site, were used for nucleotide sequencing, which revealed that each cDNA had the exact same 3'-terminal sequence (corresponding to the 5' NCR of viral RNA) as was previously determined. Thus, our sequence data suggested that the genetic organization of ORO virus S RNA segment was similar to that of other bunyaviruses, except that it had a smaller 5' NCR.
Table 1. Geographical origins, years and sources of isolation of ORO virus strains
Comparison of the N gene nucleotide sequence of ORO virus with those of Simbu, California and Bunyamwera serogroup viruses showed that ORO virus is related to, but genetically distinct from Simbu serogroup viruses Akabane (AKA), Tinaroo (TIN) and Aino, which exhibited closer relationship among themselves (Table 2). All four Simbu serogroup viruses were distantly related to California encephalitis (California serogroup) and Bunyamwera (Bunyamwera serogroup) viruses. Similar relationships were revealed when deduced N protein amino acid sequences were compared among these viruses (Table 2). These data, therefore, suggested that within the Simbu serogroup AKA, TIN and Aino viruses were more closely related to each other than they are to ORO virus. Based on complement fixation tests (which measure the product of N gene), Kinney & Calisher (1981) classified the Simbu serogroup into five serocomplexes. In this classification scheme, TIN, AKA and Aino viruses were grouped together in a single serocomplex while ORO virus was a member of a different serocomplex. Thus, our genetic data were consistent with the serological data and supported the proposed classification scheme.
Table 2. Percentage identity amongst N ORF sequences of Simbu, California and Bunyamwera serogroup viruses
The predicted NSs proteins were much less conserved among the above six viruses and displayed greater divergence than the N proteins (data not shown). Bowen et al. (1995) noted a similar situation among members of the California serogroup. Their analysis suggested that the faster NSs evolution was driven by the high average frequency of accumulation of substitutions in the second codon position of the NSs ORF, which corresponds to the third codon position in the N ORF. An interesting feature noted for certain ORO virus strains (Peru92a, Peru92b, Peru93, Peru97, Brazil91b and Brazil91c) was the presence of two successive ATG codons at the beginning of the NSs ORF. This feature is characteristic of viruses belonging to California (Bowen et al., 1995 ; Huang et al., 1996 ) and Bunyamwera (Elliott, 1989 ) serogroups and is absent in Simbu serogroup viruses sequenced previously (Akashi et al., 1984 , 1997a , b ). The functional and/or evolutionary significance of this characteristic is unclear.
A set of two oligonucleotide primers, ORON5 (5' AAAGAGGATCCAATAATGTCAGAGTTCATTT 3') and ORON3 (5' GTGAATTCCACTATATGCCAATTCCGAATT 3), flanking the N ORF was designed from the nucleotide sequence data obtained for the S RNA segment of the prototype ORO virus strain. These primers were used to amplify the N ORF of 27 additional ORO virus isolates, representing a 42-year-interval and a wide geographical range in South America, using RTPCR as above, except that RT was carried out at 55 °C, and PCR primer annealing was performed at 60 °C. The PCR product was subjected directly to sequencing as described above. Sequencing was carried out in both directions using the same primers. Nucleotide sequences (GenBank accession nos AF164531164558) were compared using the NALIGN and CLUSTAL programs of the PC gene software package (Bairoch, 1995 ). These analyses revealed that among 28 ORO virus strains the genetic variability ranged from 1 to 8%, which is similar to that reported for strains of AKA virus (07%; Akashi et al., 1997b ). However, unlike several AKA virus strains, no two ORO virus strains examined were identical in their N gene nucleotide sequence and most isolates exhibited a difference of 57%. In contrast, only two Australian strains of AKA virus exhibited maximum genetic diversity (7 %) when compared with the Japanese strains, while the maximum genetic diversity among the Japanese strains of AKA virus was no more than 3%. Bowen et al. (1995) analysed the N gene sequence of two strains each of California encephalitis (CE), Jamestown Canyon (JC) and LaCrosse (LAC) viruses. Their results revealed very little genetic variation between strains (1·1% between strains of CE, 0·3% between strains of JC and 0·01% between strains of LAC viruses). Thus, it appears that ORO virus isolates exhibit greater genetic diversity than previously observed for strains of other members of the genus Bunyavirus sequenced to date. Moreover, 8% nucleotide sequence difference observed among the N gene sequences of some ORO virus isolates is notable and comparable to the differences seen among some distinct viruses in the California serogroup (Bowen et al., 1995 ).
For phylogenetic analyses, nucleotide sequences of the N gene of 28 ORO virus strains and corresponding N gene sequences of AINO, AKA and TIN viruses (GenBank accession nos M2201, AB000851 and AB000819, respecively; Akashi et al., 1984 , 1997a , b ) were aligned using PileUp program of the University of Wisconsin Genetics Computer Group (UWGCG) package using default gap penalties (Devereux et al., 1984 ). Phylogenetic analyses were carried out using neighbour-joining (NJ; Saitou & Nei, 1987 ) and maximum parsimony (MP) methods implemented in PAUP 4.0b2 (Swofford, 1999 ) software. For NJ analysis, a distance matrix was calculated from the aligned sequences using the Kimura two-parameter formula. For MP analysis, a weight of 4 for transitions vs 1 for transversions was assigned. Nucleotide characters were assigned equal weights. A search for the most parsimonious tree was performed using the heuristic algorithm. Bootstrap analysis (Felsenstein, 1985 ) was carried out on 1000 pseudoreplicate data sets generated from the original aligned sequences. Sequences of AKA, TIN and AINO viruses were used as an outgroup to root the tree. Both NJ and MP methods resulted in trees with similar topology; however, bootstrap supports were slightly lower for the MP consensus tree. The tree obtained by neighbour-joining analysis is shown in Fig. 1, and revealed that all 28 ORO virus isolates form a monophyletic group that could be divided into three distinct phylogenetic lineages. The first lineage (I) contained the prototype strain (TRVL 9760, Trinidad55) and most of the Brazilian strains, including the first Brazilian isolate (BeAn 19991, Brazil60). The second lineage (II) included six strains from Peru, isolated between 1992 and 1998, and two isolates from Brazil, isolated in 1991. All four Panamian isolates grouped together to form the third (III) lineage. Lineages I and III were supported with high boostrap values (98 and 100%, respectively), while the bootstrap support for lineage II was relatively low (67%). Exclusion of Peru98a from lineage II increased the bootstrap support to a moderate level (75%). The two Brazilian strains (Brazil91b and Brazil91c), which were included in lineage II, were obtained during the 1991 outbreak in the state of Rondonia. Epidemiological investigations revealed certain differences between the Rondonian outbreak and other outbreaks in Brazil. For example, it was noted that the haemagglutination-inhibition antibody titres were much less in individuals infected during the Ronodonian outbreak as compared to what has been observed for individuals infected during other Brazilian outbreaks (A.P.A. Travassos da Rosa, Instituto Evandro Chagas, Belem, Brazil, personal communication). Rondonia is located in the southwestern part of Brazil and is closer to Madre de Dios, Peru (Peru1993a) than to most of the other localities represented in lineage I, which are in northern Brazil. Thus, the three lineages occur in separate regions within tropical America; lineages I and II are prevalent in the eastern and western regions of South America, respectively, while lineage III occurs in Panama. Trinidad55 is the prototype strain of ORO virus, and Brazil60 is considered the first ORO strain from Brazil. Both these strains are represented in lineage I. Clearly, these strains are not representative of the other two lineages. It is considered that the three lineages represent, at the very least, distinct genotypes of ORO virus. These data may have some clinical and epidemiological relevance since the disease severity and epidemiological features of ORO fever have been noted to be different in Brazil and Peru (Watts et al., 1997 ).
Table 1, GenBank accession nos AF164531AF164558), Akabane (Obe-1, GenBank accession no. AB000851), Tinaroo (CSIRO153, GenBank accession no. AB000819) and Aino (GenBank accession no. M2201) viruses were aligned using the PileUp program of the UWGCG package (Devereux et al., 1984 ). Distance matrix was calculated by the Kimura two-parameter formula with a transition/transversion ratio of 4·0 (Kimura, 1980 ) and the tree was constructed by the neighbour-joining method (Saitou & Nei, 1987 ) using programs implemented in PAUP 4.0b2 software (Swofford, 1999 ). Nucleotide sequences of Aino, AKA and TIN viruses were used as an outgroup to root the tree. Bootstrap analysis (Felsenstein, 1985 ) was carried out on 1000 pseudoreplicate data sets generated from the original sequence alignment and a bootstrap consensus tree was generated. Percentage bootstrap values are indicated above the internal nodes. Scale represents 10% nucleotide sequence divergence.
The opinions and assertions contained herein are the private ones of the writers and are not to be construed as official or as reflecting the views of the Navy Department or the Naval Service at large.
Footnotes
GenBank accession numbers for the nucleotide sequences reported here are AF164531164558.References
Akashi, H., Kaku, Y., Kong, X.-G. & Pang, H. (1997a). Antigenic and genetic comparison of Japanese and Australian Simbu serogroup viruses: evidence for the recovery of natural virus reassortants. Virus Research 50, 205-213.[Medline]
Akashi, H., Kaku, Y., Kong, X.-G. & Pang, H. (1997b). Sequence determination and phylogenetic analysis of Akabane bunyavirus S RNA genome segment. Journal of General Virology 78, 2845-2851.
Anderson, C. R., Spence, L., Downs, W. G. & Aitken, T. H. G. (1961). Oropouche virus: a new human disease agent from Trinidad, West Indies. American Journal of Tropical Medicine and Hygiene 10, 574-578.
Bairoch, A. (1995). PC/Gene: the nucleic acid and protein sequence analysis software, release 6.85. University of Geneva, Switzerland: Inteligenetics Inc.
Bowen, M. D., Jackson, A. O., Bruns, T. D., Hacker, D. L. & Hardy, J. L. (1995). Determination and comparative analysis of the small RNA genomic sequences of California encephalitis, Jamestown Canyon, Jerry Slough, Melao, Keystone and Trivittatus viruses (Bunyaviridae, genus Bunyavirus, California serogroup). Journal of General Virology 76, 559-572.
Devereux, J., Haeberli, P. & Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387-395.
Dunn, E. F., Pritlove, D. C. & Elliott, R. M. (1994). The S RNA genome segments of Batai, Cache Valley, Guaroa, Kairi, Lumbo, Main Drain and Northway bunyaviruses: sequence determination and analysis. Journal of General Virology 75, 597-608.
Elliott, R. M. (1989). Nucleotide sequence analysis of the small (S) RNA segment of Bunyamwera virus, the prototype of the family Bunyaviridae. Journal of General Virology 70, 1281-1285.
Elliott, R. M. (1990). Molecular biology of Bunyaviridae. Journal of General Virology 71, 501-522.
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Huang, C., Shope, R. E., Spargo, B. & Campbell, W. P. (1996). The S RNA genomic sequences of Inkoo, San Angelo, Serra do Navio, South River and Tahyna bunyaviruses. Journal of General Virology 77, 1761-1768.
Kimura, M. (1980). A simple method for estimating evolutionary rate of base substitution through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 111-120.[Medline]
Kinney, R. M. & Calisher, C. H. (1981). Antigenic relationships among Simbu serogroup (Bunyaviridae) viruses. American Journal of Tropical Medicine and Hygiene 30, 1307-1318.
LeDuc, J. W. & Pinheiro, F. P. (1989). Oropouche fever. In The Arboviruses: Epidemiology and Ecology , pp. 1-14. Edited by T. P. Monath. Boca Raton: CRC Press.
Ni, H. & Barrett, A. D. T. (1995). Nucleotide and amino acid differences of the structural protein genes of Japanese encephalitis virus from different geographical locations. Journal of General Virology 76, 401-407.
Pinheiro, F. P., Pinheiro, M., Bensabath, G., Causey, O. R. & Shope, R. E. (1962). Epidemia de virus Oropouche em Belem. Revista de Servico Especial de Saude Publica 12, 15-23.
Pinheiro, F. P., Travassos da Rosa, A. P. A. & Vasconcelos, P. F. C. (1998). An overview of Oropouche fever epidemics in Brazil and neighbouring countries. In An Overview of Arbovirology in Brazil and Neighbouring Countries, pp. 186-192. Edited by A. P. A. Travassos da Rosa, P. F. C. Vasconcelos & J. F. S. Travassos da Rosa. Instituto Evandro Chagas: Belem, Brazil.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]
Swofford, D. L. (1999). PAUP*: Phylogenetic Analysis Using Parsimony (and other methods), version 4. Sunderland, MA: Sinauer Associates.
Watts, D. M., Phillips, I., Calahan, J. D., Griebenow, W., Hyams, K. C. & Hayes, C. G. (1997). Oropouche virus transmission in the Amazon River basin of Peru. American Journal of Tropical Medicine and Hygiene 56, 148-152.
Received 1 November 1999; accepted 26 November 1999.