Research Article

Phylogeny of the genus Flavivirus using complete coding sequences of arthropod-borne viruses and viruses with no known vector

Journal of General Virology 2000; 81(3):781

PubMed

Abstract

Attempts to define the evolutionary relationships and origins of viruses in the genus Flavivirus are hampered by the lack of genetic information particularly amongst the non-vectored flaviviruses. Using a novel protocol for sequence determination, the first complete coding sequence of St Louis encephalitis virus and those of two representative non-vectored flaviviruses, Rio Bravo (isolated from bat) and Apoi (isolated from rodent), are reported. The encoded polyproteins of Rio Bravo and Apoi virus are the smallest described to date within the genus Flavivirus. The highest similarities with other flaviviruses were found in the NS3 and NS5 genes. The proteolytic cleavage sites for the viral serine protease were highly conserved among the flaviviruses completely sequenced to date. Comparative genetic amino acid alignments revealed that p-distance cut-off values of 0·3300·470 distinguished the arthropod-borne viruses according to their recognized serogroups and Rio Bravo and Apoi virus were assigned to two distinct non-vectored virus groups. Within these serogroups, cladogenesis based on the complete ORF sequence was similar to trees based on envelope and NS5 sequences. In contrast, branching patterns at the deeper nodes of the tree were different from those reported in the previous study of NS5 sequences. The significance of these observations is discussed.
The genus Flavivirus contains viruses transmitted by arthropods and viruses with no known vector (NKV) (Karabatsos, 1995 ). Their natural hosts are mammals and birds and the genus includes major human pathogens such as yellow fever virus, dengue virus, and numerous viruses causing encephalitis, transmitted by either mosquitoes or ticks. Complete or nearly complete genomic sequences have been reported for several tick-borne and mosquito-borne species and for the mosquito cell fusing agent (MCFA), a virus which seems to infect only mosquitoes and is distantly related to the flaviviruses (Cammisa-Parks et al., 1992 ). Phylogenetic analysis of the corresponding partial amino acid sequences in the envelope gene (Marin et al., 1995 ; Zanotto et al., 1996 ) established that mosquito- and tick-borne viruses constituted two different evolutionary lineages. The different arthropod-borne viruses could be assigned to genetic groups that globally corroborate previous serological studies (Monath & Heinz, 1996 ). More recently, the first phylogenetic analysis that included NKV flaviviruses used partial sequences from the polymerase gene. Most of the NKV viruses were assigned to a new and homogeneous phylogenetic group (Kuno et al., 1998 ).

The major factors that limit the quality of phylogenetic analysis with related but widely divergent viruses are the amount of genetic information obtained for each virus, the suitability of the genomic region selected for analysis and the availability of appropriate analytical methods. In the present phylogenetic study of the genus Flavivirus, we have attempted to overcome some of these limiting factors by determining the complete coding and polyprotein sequences of two representative NKV flaviviruses, Rio Bravo virus (RBV) and Apoi virus (APOIV). RBV (also known as US bat salivary gland virus or California bat salivary gland virus) was isolated from the salivary glands of Tadarida brasiliensis mexicana bats captured in California, New Mexico, Texas, USA and Sonora state, Mexico (Burns et al., 1957 ; Johnson, 1957 ; Constantine & Woodall, 1964 ; Sulkin et al., 1966 ; Karabatsos, 1995 ). Later, the virus was isolated from Eptesicus fuscus and Molossus ater bats in California (Karabatsos, 1995 ) and Trinidad (Price, 1978 ), respectively. RBV establishes a chronic infection in bats (Constantine & Woodall, 1964 ; Baer & Woodall, 1966 ) and is supposed to be transmitted by some form of salivary contact (Price, 1978 ). Seven cases of laboratory infection have been reported in man [probably implying aerosol transmission (Sulkin et al., 1962 , cited by Le Lay-Rogues & Chastel, 1986 ; Office of Health and Safety, Centers for Disease Control and Prevention, 1997 )]. RBV was classified as a flavivirus on the basis of its biochemical and biophysical characteristics (Hendricks et al., 1988 ) and on its serological reactivity to other members in this genus (de Madrid et al., 1974 ; Varelas-Wesley & Calisher, 1982 ; Gould et al., 1985 ; Calisher et al., 1989 ). Molecular evidence that RBV is a member of the genus Flavivirus was provided by genetic analysis of the partial polymerase gene sequence (Kuno et al., 1998 ).

APOIV has been isolated in Japan from the spleen of apparently healthy rodents (Apodemus speciosus and Apodemus argentosus hokkaidi) (Karabatsos, 1995 ). The basis for its classification as a flavivirus is the same as that for RBV. In several serological studies, RBV and APOIV were reported to be closely related (Varelas-Wesley & Calisher, 1982 ).

We have also completed the sequence of St Louis encephalitis virus (SLEV), a major human pathogen, the primary transmission cycle of which involves Culex spp. and birds. The role other vectors from which the virus has been isolated, e.g. Aedes spp. (Karabatsos, 1995 ; Monath & Tsai, 1987 ) and Dermacentor variabilis ticks (McLean et al., 1985 ), in virus transmission is still debated. SLEV has been isolated from a large variety of wild vertebrate species including birds, rodents and bats (Allen et al., 1970 ; Sulkin & Allen, 1974 ; Herbold et al., 1983 ). It belongs to the Japanese encephalitis serogroup (Calisher et al., 1989 ) and this is also supported by the results of molecular analyses in the envelope and NS5 genes (Marin et al., 1995 ; Kuno et al., 1998 ).

These molecular data, combined with complete ORF sequences from databases, provided the opportunity for a more robust analysis of the genetic relationships between flaviviruses within the three recognized groups, i.e. mosquito-borne, tick-borne and NKV. The phylogenetic trees were then compared with trees based on flavivirus sequences from specified subgenomic regions.

Virus strains.
RBV strain M-64 (passage level 10 in suckling mouse brain) and APOIV strain Kitaoka (passage level 10 in suckling mouse brain), received from J. Casals (Yale Arbovirus Research Unit, New Haven, CT, USA) and SLEV strain MSI-7 (passage level 3 in Vero cells) received from R. E. Shope (University of Texas, TX, USA) were propagated in Vero cells cultured as monolayers in Eagles minimum essential medium with 10% foetal bovine serum, 100 IU/ml penicillin G, 100 µg/ml streptomycin and 100 µg/ml kanamycin at 37 °C under 5% CO2. Cells and supernatant media were recovered separately at 45 days post-infection, and stored at -80 °C.

Preparation of viral RNAs and cDNAs.
RNA was extracted from the infected cells for SLEV, and from the supernatant medium for RBV and APOIV, using a guanidinium thiocyanate-derived method (RNA Now; Ozyme). The RNA was reverse transcribed using random hexaprimers and MuMLV reverse transcriptase (both from Boehringer Mannheim) under standard conditions, in a final volume of 20 µl.

Genomic amplification.
Three sets of degenerate primers were designed in conserved regions of the viral genomes, using sequences from databases. The first set of primers [Env-S (sense) and Env-R (reverse)] was designed from the alignment of the envelope gene sequence of tick-borne viruses. The second set [NS3-S (sense) and NS3-R (reverse)] was designed from the alignment of the flavivirus NS3 gene sequence. The third set was designed from the 5' part of the NS5 gene [8079-S (sense) and MMG-R (reverse)]. These different degenerate primers were used in combination with specific primers designed either from the sequencing of our PCR products or from the partial NS5 sequences reported by Kuno et al. (1998) as indicated in Table 1.


Table 1. Primers used for the PCR amplification of RBV, APOIV and SLEV


Amplification of the 5' and 3' genomic regions was performed using the anchored PCR method, with one specific primer and a combination of non-specific oligonucleotides, including primers X and Y (see Table 1a). For SLEV, the 5' end of the NS5 region was amplified using a specific PCR primer (sense) designed from the sequence of Kuno et al. (1998) and the 3-NC-R reverse primer (located in a conserved part of the 3' non-coding region). For non-overlapping clones, the precise sequence was determined using specific primers flanking the non-sequenced region (see Fig. 1). All PCR amplifications were achieved under standard conditions using Taq polymerase (Gibco BRL) and 40 cycles including long polymerization steps (13 min depending on the expected size of the amplicons).


Table 1: primers A to I are consensus primers; primers 1 to 6 for SLEV virus and 1 to 10 for RBV and APOIV are specific primers; primers X and Y were used for anchored PCR.


Cloning and sequence determination of PCR products.
PCR products were ligated into the pGEM-T Vector System I (Promega). The recombinant plasmids were transfected into competent E. coli XL-Blue cells. Both strands of cloned PCR products were sequenced using the D-Rhodamine DNA sequencing kit and the ABI PRISM 377 sequence analyser (both from Perkin Elmer).

In the case of RBV and APOIV, verifications of the sequences obtained from viral clones were made by direct sequencing of overlapping PCR products in the envelope, NS3 and NS5 regions. In the E gene, two PCR products were obtained using specific primers [TGCATCGCGGCTCTGATACG (sense) and GTATGTGTCTAGTGCGCATCC (reverse) for RBV and ATTGTGACCTTGATTGTGGC (sense) and TCCCACATCAATCATACATCC (reverse) for APOIV] in combination with degenerate primers A and B. In the NS3, two PCR products were obtained using specific primers [ATGCTTGGAATCAAAAAGTG (sense) and TTTTTGGTACATCAGTCTGGG (reverse) for RBV and ATCTTAGCCCTCAGACAGTG (sense) and CCCTTCATAGAGAAGCTGAAG (reverse) for APOIV] in combination with degenerate primers E and F. In the NS5, PCR products obtained with primer sets G and H on the one hand and 8 and 10 on the other were also directly sequenced on both strands.

Other sequences used.
Full-length coding sequences of the following viruses were retrieved from databases [abbreviations (used in Fig. 3) and GenBank accession numbers are in parentheses]: dengue 1 (DEN1, M87512); dengue 2 (DEN2, AF038403); dengue 3 (DEN3, M93130); dengue 4 (DEN4, M14931); Kunjin (KUN, D00246); Japanese encephalitis (JE, M18370); mosquito cell fusing agent (MCFA, M91671); tick-borne encephalitis (TBE) virus strains Neudoerfl (NEU, U27495) and Hypr (HYPR, U39392); louping ill (LI, Y07863); Langat (LGT, M73835 and M86650); Powassan (POW, L06436); West Nile (WN, M12294); yellow fever (YF, X03700). For Murray Valley encephalitis (MVE, GNWVMV) virus only the amino acid sequence was available. Partial sequences of RBV, APOIV and SLEV were also used (see Table 2).



(13K):

Fig. 3. (a) Phylogenetic tree based on NS3 polyprotein region of 18 flaviviruses by the neighbour-joining method. Bootstrap values correspond to 500 replications. The main vectors or hosts from which viruses were isolated are indicated. Scale bar, distance of approximately 0·13. (b) Phylogenetic tree based on NS5 polyprotein region of 18 flaviviruses by the neighbour-joining method. Bootstrap values correspond to 500 replications. The main vectors or hosts from which viruses were isolated are indicated. Scale bar, distance of approximately 0·1.

Table 2. Flaviviruses used in the phylogenetic study


Genetic analysis.
The alignment of amino acid sequences was generated by the Clustal W (1.74) software program (Thompson et al., 1994 ) using default alignment parameters. Conserved motifs were used as a control of validity for alignments: (i) within the prM, envelope and NS1 genes, 30 conserved cysteine positions; (ii) in the envelope gene, the motif RGWGxxCxxxGxG; (iii) in the NS3 gene, the motifs GxSGSP, HPGxGKT, PTRVV, CHAT, DExH, SIAARG, ATPPG, TDIxEMGAN, QRRGRxGR; (iv) in the NS5 gene, the motifs VSRGxxK, GxVxDxGCGRGG, CDIGES, SRNSxxEMY, ADDxAGWDT, QRGSGQVxTYxLNTxTN and GDD. The alignment was used as produced by Clustal, or after manual modifications (including the alignment of all putative cleavage sites). The alignment of nucleotide sequences was generated either by the Clustal W program (standard alignment) or with the help of the TransAlign (1.0) Java program package (alignment of coding nucleotide sequences according to the amino acid sequence encoded) (Weiller, 1999 ). Nucleotide alignments generated by the TransAlign program were tested before and after exclusion of the third codon position.

Phylogenetic analyses were performed with the help of the software program MEGA 1.01 (Kumar et al., 1993 ). The JukesCantor and gamma distance (a=2) algorithms were used for the determination of genetic distances between nucleotide and amino acid sequences, respectively. Trees were constructed using the neighbour-joining method and either complete or partial sequences (in particular partial amino acid sequences corresponding to the different genes). All trees were constructed with and without the corresponding MCFA sequence. The robustness of the resulting groupings was tested by 500 bootstrap replications and trees were edited with the help of the Tree macro program (Charrel et al., 1999 ). In addition, pairwise genetic distances (p-distance) between virus isolates were calculated.

Sequence determination and analysis
The entire nucleotide sequence of the ORFs and deduced polyprotein sequences of RBV and APOIV virus were determined and submitted to the databases (GenBank accession numbers AF144692 and AF160193).

Comparison of sequences obtained by direct sequencing of PCR products (around 5500 nt for each viral genome or 50% of the complete ORF sequence) did not reveal any difference with the sequence obtained from virus clones.

The RBV ORF sequence was 10140 nt long (including the initial ATG and the terminal stop codon), and encoded a 3379 aa polyprotein. For APOIV, the complete ORF sequence was 10116 nt long, encoding a 3371 aa polyprotein. Based on similarity comparisons with the complete ORF sequences of other flaviviruses (Chambers et al., 1990 ), the probable sites of cleavage of the viral polyproteins were determined and are presented in Table 3(a). The sizes of individual proteins arising from post-translational processing of the polyprotein are presented in Table 3(b).


Table 3. Cleavage sites and protein sizes (amino acids)


In the case of SLEV strain MI-7, the partial nucleotide sequences previously reported (GenBank accession number M16614, positions 14575; and GenBank accession number AF013416, positions 89569990) were extended to obtain the full-length ORF sequence (GenBank accession number AF160194). The sequence was 10290 nt long and encoded a 3429 aa polyprotein. The probable sites of cleavage of the polyprotein and sizes of proteins are included in Table 3.

Genetic analysis
Pairwise distances based on complete ORF sequences between the different virus isolates are presented in Fig. 2. Different cut-off values were tested for the grouping of virus isolates. Values ranging from 0·328 to 0·471 for amino acid alignments (0·348 to 0·419 for nucleotide alignments) distinguished the arthropod-borne viruses according to their recognized serogroups (Calisher et al., 1989 ), i.e. the tick-borne group, the Japanese encephalitis group, the dengue group and the yellow fever group. On this basis, and in agreement with the analysis of frequency distribution histograms (data not shown), RBV and APOIV could be assigned to two distinct NKV groups, since the genetic distance between the amino acid sequences of these viruses was 0·458 (0·392 for nucleotide alignments). This is shown in the top part of Fig. 2 where a cut-off value of 0·450 for amino acid alignments (0·380 for nucleotide alignments) was used. The pairwise genetic distances between viruses of each group (<0·5) are within the tolerable limits for phylogenetic analysis. In contrast, the distances between groups were often above 0·6 (0·7 for MCFA), thereby potentially reducing the bootstrap values of the phylogenetic studies. It is also worth noting that, on the basis of their genetic distances, RBV and APOIV were more closely related to the tick-borne than the mosquito-borne viruses.



(37K):

Fig. 2. Matrix of genetic distances. The top-right matrix represents pairwise distances between standard amino acid alignments. The bottom-left matrix represents pairwise distances between standard nucleotide alignments. Groupings given at the top of were made using 0·450 and 0·380 cut-off values for amino acids and nucleotides, respectively. Distances above 0·450 and 0·380 for amino acids and nucleotides, respectively, are in bold. Correspondence with serocomplexes is indicated. NT*, Not tested.

Phylogenetic trees constructed using the amino acid sequences of either the complete NS3 or the complete NS5 gene were compared (Fig. 3). They produced different branching patterns at the deepest nodes. In the tree based on NS3 sequence data (Fig. 3a), there were two major branches. The mosquito-borne viruses diverged independently of the tick-borne and NKV viruses, which diverged only after the formation of the second branch. The tree based on NS5 data (Fig. 3b), also showed two branches at the deepest node but, in contrast with the NS3 tree, the mosquito- and tick-borne viruses separated along one phylogenetic lineage and the NKV viruses separated along the second branch. In both trees, the remaining branching patterns of the more recent nodes within both the tick- and mosquito-borne groups were identical. Despite the differences in branching patterns at the deeper nodes, both trees showed high bootstrap support.

Phylogenetic trees based on either complete genes or partial gene sequences, were also constructed. Alignments produced using standard programs and manually modified amino acid alignments produced similar results. In the majority of cases, trees resembling either the NS3 or NS5 tree, were observed as summarized in Table 4, which presents the data obtained for a variety of trees constructed using different criteria. However, when amino acid sequences of either the E gene alone, or the entire structural region of the genome were used, and MCFA virus was included, a branching pattern was produced which was very different and not consistent with the serological relationships of the viruses. Moreover, if complete nucleotide sequences of the NS5 gene were used for the analysis with an unrooted tree, the branching pattern at the deepest node showed three equivalent branches corresponding to the tick-borne, mosquito-borne and NKV groups.


Table 4. Phylogenetic patterns in different genomic regions


However, when complete ORF sequences were used, the tree resembled the NS3 branching structure, i.e. tick-borne and NKV viruses diverged together and independently of the mosquito-borne viruses. There was one exception in which the NS5-like tree was produced. Both branching patterns were supported by bootstrap values less than 65%. When trees were constructed without the MCFA sequence, the NS3-like pattern was observed except in the case of nucleotide alignments that used the NS5 gene. Fig. 3 also illustrates the distinct association between the serogroups to which the viruses were assigned, the phylogenetic relationships of the viruses and the major vector with which each virus is associated. In the past, complete polyprotein sequences have been determined for several tick- and mosquito-borne flaviviruses, and in particular for major pathogens such as yellow fever virus, dengue virus and different viruses causing encephalitis. However, for SLEV, which is one of the most important human arbovirus pathogens in the USA and one of the most studied flaviviruses, only partial sequences were available prior to this study. Moreover, within the genus Flavivirus, besides viruses which are obviously arboviruses, many viruses have been isolated from bats or rodents and have no identified arthropod vector. The only available molecular data concerning these viruses are partial NS5 sequences (Kuno et al., 1998 ). In this study, we present the first complete ORF sequences from the NKV group, namely those of RBV (which was isolated from bats) and APOIV (which was isolated from rodents).

The sequence determination of RBV and APOIV showed that the polyproteins of these viruses were the smallest described to date within the genus Flavivirus. In particular, the envelope and NS4A genes appeared to be markedly shorter than the corresponding genes of arthropod-borne flaviviruses. As expected, the complete SLEV polyprotein was very similar in size to those of other members of the Japanese encephalitis serogroup.

Within the viral polyproteins, proteolytic cleavage sites for the viral serine protease appeared to be highly conserved among all flaviviruses studied, including NKV viruses. The prM cleavage site sequence (Arg-X-Arg/Lys-Arg) (Rice, 1996 ) was also conserved in all genomes studied. This cleavage may be mediated by the host enzyme furin or an enzyme of similar specificity (Stadler et al., 1997 ; Steiner et al., 1992 ). The putative sites of other proteolytic cleavages, supposed to be mediated by host signalases, were less conserved, except for the 2K/NS4B cleavage site. They were only determined on the basis of sequence alignment with previously determined cleavage site sequences (Chambers, 1990 ).

The study of genetic distances between the full-length coding sequences or polyproteins globally confirmed previous groupings made on the basis of antigenic relationship or genetic analysis of envelope or NS5 sequences. The use of cut-off values discriminated the major serogroups (tick-borne, yellow fever, dengue and Japanese encephalitis groups) and indicated that RBV and APOIV virus do not belong to either of these groups. Using such cut-off values (0·450 and 0·380 for amino acid and nucleotide sequences, respectively), RBV and APOIV could be assigned to two distinct phylogenetic groups. This contradicts previous serological data which implied that they belong to the same antigenic complex (Calisher et al., 1989 ). These findings suggest the existence of an important genetic diversity between NKV isolates. This was supported by the observation that the genetic distance between RBV and APOIV was comparable to that between dengue and Japanese encephalitis virus.

The genetic distances between the different groups are important, and with the exception of dengue and Japanese encephalitis groups on the one hand, and RBV and APOIV on the other, they were higher than 50%. This is not a favourable situation to analyse the phylogenetic relationships between these groups, and it was therefore not surprising to observe different branching patterns, depending on the genomic region analysed or the methodology used. The most frequently observed phylogenetic tree structure was that typically obtained using alignments which employed sequence data from the NS3 region. This supports the notion of a common ancestor for the tick-borne and NKV viruses, which is in agreement with the fact that, based on genetic distances, tick-borne viruses were found to be more closely related to RBV and APOIV viruses than mosquito-borne viruses. It is also worth noting that some members of the NKV group, such as Phnom-Penh bat virus and Carey Island virus, are serologically related to tick-borne viruses (Calisher et al., 1989 ). Finally, it is interesting to note that a typical Asian tick-borne encephalitis virus strain was recently isolated from Apodemus speciosus (Takeda et al., 1999 ), the natural host of APOIV.

An alternative phylogenetic tree structure was observed from sequence data based on the NS5 region, and is more typical of that reported by Kuno et al. (1998) . In this branching pattern, the NKV group roots the tick- and mosquito-borne groups. The third phylogenetic branching pattern implied a single ancestor for the mosquito-borne, tick-borne and NKV groups. At this stage, despite the high bootstrap values, it is not possible to determine with certainty which profile is the correct one.

In attempts to resolve these difficulties, the phylogeny between complete ORF sequences was tested using different methods and, in all cases except one, the NS3 branching pattern was obtained, but the trees were supported by a bootstrap value which was less than 65%. Thus, a definitive conclusion cannot be made, but the results suggest that the NS3 region is appropriate for comparing the phylogenetic relationships of the flaviviruses. The presence of MCFA in the sequence alignments modified the branching pattern in some of the trees. This is presumably because the genetic distance between MCFA and the other viruses is very high (above 70%). It is therefore difficult to align this virus with the other flaviviruses, except in the NS3 and NS5 genes where there are several highly conserved regions. This was particularly evident when the envelope region was studied and MCFA virus was used to root the tree. The addition of RBV and APOIV sequences in the amino acid alignments resulted in an obviously incorrect phylogenetic tree. In contrast, removal of MCFA as a root created trees that closely resembled those constructed with sequence data from the NS3 gene. It is presumed that such anomalies will become less conspicuous as more sequence data of NKV viruses accumulate.

In contrast with the situation described above, genetic distances within each group, and between the dengue and Japanese encephalitis groups, were less than 50%. As a result of this, the associated branching patterns were very reproducible in all the subgenomic regions studied and were similar to the previously described patterns in the envelope and NS5 regions (Marin et al., 1995 ; Kuno et al., 1998 ).

Finally, although there is clearly a close relationship between the main vectors of virus transmission and the phylogenetic group to which the viruses are assigned, many flaviviruses have been isolated from arthropods other than the recognized major vector. This is the case for yellow fever virus, which is normally associated with Aedes spp. but has also been isolated from ticks (Monath & Heinz, 1996 ); for Saboya virus, which has been isolated from Anopheles and from ticks (Butenko, 1996 ); for SLEV and West Nile virus, which are normally associated with Culex spp. but have also occasionally been isolated from Aedes spp. and ticks (Monath & Tsai, 1987 ). This broad invertebrate host range may reflect the progressive adaptation of viruses to their main vector, but also the conservation for some species of genetic characters inherited from a common ancestor and permitting the infection of a large range of vectors and hosts.

References

Allen, R., Taylor, S. K. & Sulkin, S. E. (1970). Studies of arthropod-borne virus infections in Chiroptera. Evidence of natural St. Louis encephalitis virus infection in bats. American Journal of Tropical Medicine and Hygiene 19, 851-859.

Baer, G. M. & Woodall, D. F. (1966). Bat salivary gland virus carrier state in a naturally infected Mexican free-tail bat.American Journal of Tropical Medicine and Hygiene 15, 769-771.

Burns, K. F., Farmacci, C. J. & Shelton, D. F. (1957). Virus of bats antigenically related to group B arthropod-borne encephalitis viruses. American Journal of Clinical Pathology 27, 257-264.[Medline]

Butenko, A. M. (1996). Arbovirus circulation in the Republic of Guinea. Meditsinskaia Parazitologiia I Parazitarnye Bolezni 2, 40-45.

Calisher, C. H., Karabatsos, N., Dalrymple, J. M., Shope, R. E., Porterfield, J. S., Westaway, E. G. & Brandt, W. E. (1989). Antigenic relationships between flaviviruses as determined by cross-neutralization tests with polyclonal antisera. Journal of General Virology 70, 37-43.[Abstract/Free Full Text]

Cammisa-Parks, H., Cisar, L. A., Kane, A. & Stollar, V. (1992). The complete nucleotide sequence of cell fusing agent (CFA): homology between the nonstructural proteins encoded by CFA and the nonstructural proteins encoded by arthropod-borne flaviviruses. Virology 189, 511-524.[Medline]

Chambers, T. J., Hahn, C. S., Galler, R. & Rice, C. M. (1990). Flavivirus genome organization, expression, and replication. Annual Review of Microbiology 44, 649-688.[Medline]

Charrel, R. N., de Micco, P. & de Lamballerie, X. (1999). A convenient method to improve the graphical quality of phylogenetic trees computed by the MEGA program. BioTechniques 27, 702-704.[Medline]

Constantine, D. G. & Woodall, D. F. (1964). Latent infection of Rio Bravo virus in salivary glands of bats. Public Health Reports 79, 1033-1039.[Medline]

de Madrid, A. T. & Porterfield, J. S. (1974). The flaviviruses (group B arboviruses): a cross-neutralization study. Journal of General Virology 23, 91-96.[Abstract/Free Full Text]

Gould, E. A., Buckley, A., Cammack, N., Barrett, A. D. T., Clegg, J. C. S., Ishak, R. & Varma, M. G. R. (1985). Examination of the immunological relationships between flaviviruses using yellow fever virus monoclonal antibodies. Journal of General Virology 66, 1369-1382.[Abstract/Free Full Text]

Hendricks, D. A., Patick, A. K., Petti, L. M. & Hall, A. J. (1988). Biochemical and biophysical characteristics of Rio Bravo virus (Flaviviridae). Journal of General Virology 69, 337-347.[Abstract/Free Full Text]

Herbold, J. R., Heuschele, W. P., Berry, R. L. & Parsons, M. A. (1983). Reservoir of St. Louis encephalitis virus in Ohio bats. American Journal of Veterinary Research 44, 1889-1893.[Medline]

Johnson, H. N. (1957). The Rio Bravo virus: virus identified with group B arthropod-borne viruses by hemagglutinationinhibition and complement-fixation tests.Proceedings of the Ninth Pacific Science Congress 17, 39.

Karabatsos, N. (1995). International Catalogue of Arboviruses including Certain Other Viruses of Vertebrates. San Antonio/Fort Collins: American Society of Tropical Medicine and Hygiene.

Kumar, S., Tamura, K. & Nei, M. (1993). Molecular Evolutionary Genetics Analysis, version 1.01. Pennsylvania State University.

Kuno, G., Chang, G. J., Tsuchiya, K. R., Karabatsos, N. & Cropp, C. B. (1998). Phylogeny of the genus Flavivirus. Journal of Virology 72, 73-83.[Abstract/Free Full Text]

Le Lay-Rogues, G. & Chastel, C. (1986). Chiroptera viruses transmitted or not transmitted by arthropods. Medicine Tropicale 46, 389-395.

McLean, R. G., Francy, D. B., Monath, T. P., Calisher, C. H. & Trent, D. W. (1985). Isolation of St. Louis encephalitis virus from adult Dermacentor variabilis (Acari: Ixodidae). Journal of Medical Entomology 22, 232-233.[Medline]

Marin, M. S., Zanotto, P. M., Gritsun, T. S. & Gould, E. A. (1995). Phylogeny of TYU, SRE, and CFA virus: different evolutionary rates in the genus Flavivirus. Virology 206, 1133-1139.[Medline]

Monath, T. P. & Tsai, T. F. (1987). St. Louis encephalitis: lessons from the last decade. American Journal of Tropical Medicine and Hygiene 37, 40-59.

Monath, T. P. & Heinz, F. X. (1996). Flaviviruses. In Fields Virology, pp. 961-1034. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.

Office of Health and Safety, Centers for Disease Control and Prevention (1997). Biosafety in Microbiological and Biomedical Laboratories, Section VII. http://www.cdc.gov/od/ohs/biosfty/bmbl/sect7f.htm.

Price, J. L. (1978). Isolation of Rio Bravo and a hitherto undescribed agent, Tamana bat virus, from insectivorous bats in Trinidad, with serological evidence of infection in bats and man. American Journal of Tropical Medicine and Hygiene 27, 153-161.

Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology, pp. 931-959. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.

Stadler, K., Allison, S. L., Schalich, J. & Heinz, F. X. (1997). Proteolytic activation of tick-borne encephalitis virus by furin. Journal of Virology 71, 8475-8481.[Abstract]

Steiner, D. F., Smeekens, S. P., Ohagie, S. & Chan, S. J. (1992). The new enzymology of precursor processing endoproteases. Journal of Biological Chemistry 267, 23435-23438.[Free Full Text]

Sulkin, S. E. & Allen, R. (1974). Virus infections in bats. Monographs in Virology 8, 1-103.[Medline]

Sulkin, S. E., Burns, K. F., Shelton, D. F. & Wallis, S. (1962). Bat salivary gland virus: infections of man and monkey. Texas Reports on Biology and Medicine 20, 113-127.[Medline]

Sulkin, S. E., Sims, R. A. & Allen, R. (1966). Isolation of St. Louis encephalitis virus from bats (Tadarida b. mexicana) in Texas.Science 152, 223-225.[Abstract/Free Full Text]

Takeda, T., Ito, T., Osada, M., Takahashi, K. & Takashima, I. (1999). Isolation of tick-borne encephalitis virus from wild rodents and a seroepizootiologic survey in Hokkaido, Japan. American Journal of Tropical Medicine and Hygiene 60, 287-291.[Abstract]

Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-4680.[Abstract/Free Full Text]

Varelas-Wesley, I. & Calisher, C. H. (1982). Antigenic relationships of flaviviruses with undetermined arthropod-borne status. American Journal of Tropical Medicine and Hygiene 31, 1273-84.

Weiller, G. F. (1999). TransAlign, version 1.0. Research School of Biological Sciences, Canberra, Australia.

Zanotto, P. M., Gould, E. A., Gao, G. F., Harvey, P. H. & Holmes, E. C. (1996). Population dynamics of flaviviruses revealed by molecular phylogenies. Proceedings of the National Academy of Sciences, USA 93, 548-553.[Abstract/Free Full Text]

Received 10 August 1999; accepted 15 November 1999.