Research Article

Biochemical characterization of salmon pancreas disease virus

Journal of General Virology 2000; 81(3):813

PubMed

With thanks to our partners for supporting this archive.

Abstract

Salmon pancreas disease virus (SPDV) has been shown to cause severe economic losses in farmed Atlantic salmon (Salmo salar) and has been reported to occur in Europe, Scandinavia and the United States. This paper describes the biochemical characterization of SPDV in terms of its RNA and protein composition. SPDV was purified by precipitation from infected Chinook salmon embryo (CHSE-214) cell-culture supernatant and sucrose density-gradient centrifugation. Fractions containing virus were identified by an immunodot blot assay using an SPDV-specific MAb. Two major proteins with molecular masses of approximately 55 and 50 kDa, putatively identified as the E1 and E2 alphavirus glycoproteins respectively, were detected when purified virus preparations were analysed by PAGE. Radiolabelling experiments indicated that SPDV infection of CHSE-214 cells did not shut-off host-cell protein synthesis, making attempts to identify virus-specific proteins unsuccessful. However, radioimmunoprecipitation assay (RIPA) experiments showed that two SPDV-specific MAbs reacted with a protein in the 5055 kDa range. Northern blot hybridization with cloned cDNA probes indicated that infected cells contained RNA species of approximately 11·4 and 4 kb, which correspond to the genomic and subgenomic RNAs specified by SPDV. The results described are consistent with SPDV being characterized as an alphavirus.
Pancreas disease of farmed Atlantic Salmon was first described in Scotland in 1984 (Munro et al., 1984 ), and similar disease syndromes have since been reported in North America (Kent & Elston, 1987 ), Norway (Poppe et al., 1989 ) and several European countries (Murphy et al., 1992 ; Raynard et al., 1992 ). The disease causes major economic losses with up to 50% mortality in first-year salmon smolts in Ireland (Menzies et al., 1996 ; Wheatley, 1994 ). Post-smolt salmon infected with pancreas disease appear runted and histological lesions are detected in the pancreas, heart and muscle. The first cell-culture isolation of a virus, designated salmon pancreas disease virus (SPDV), and later shown to be the causal agent of the disease (McLoughlin et al., 1996 ), was made in our laboratory from disease-affected fish (Nelson et al., 1995 ). The virus has since been isolated from diseased salmon in Norway (Christie et al., 1998 ) and Scotland (Rowley et al., 1998 ). On the basis of its physiochemical characteristics and structural morphology SPDV was tentatively classified as a toga-like virus (Nelson et al., 1995 ).

We have recently reported the production of cDNA clones specific to SPDV RNA and, on the basis of sequence analysis of the 5·2 kb region at the 3' terminus of the SPDV genome, we have identified SPDV as an alphavirus, the first reported in fish (Weston et al., 1999 ). This sequence analysis indicated that, like other alphaviruses, the strategy of replication used by SPDV would probably involve the synthesis of a subgenomic RNA species and that proteins equivalent to alphavirus capsid, E3, E2, 6K and E1 would be encoded. In this paper we report the biochemical characterization of the virus in terms of its RNA and protein composition.

Virus and cell culture.
The F93-125 isolate of SPDV was grown in CHSE-214 cells as previously described (Nelson et al., 1995 ). Briefly, CHSE-214 cells were cultured in 75 cm2 flasks at 20 °C in 15 ml Eagles Minimum Essential Medium with Earles salts (MEM) supplemented with 200 mM L-glutamine, 0·22% (w/v) sodium bicarbonate, penicillin (100 IU/ml), streptomycin (100 µg/ml), non-essential amino acids (1%), HEPES buffer (10 mM), and containing 10% foetal calf serum (FCS) (Gibco). All virus and cell cultures were propagated in sealed flasks or in tissue culture plates in a 5% CO2 environment. For virus purification purposes, monolayer cultures of CHSE-214 grown to ~80% confluence in 75 cm2 flasks were inoculated with 1 ml virus to give an m.o.i. of approximately 1 TCID50 per cell. After 1 h adsorption, an additional 14 ml of supplemented MEM (without FCS) was added to flasks (Nelson et al., 1995 ). Virus-infected flask cultures were incubated at 15 °C for 78 days, when virus-induced cytopathic effect (CPE) was evident, and the supernatant was collected. Infectious SPDV, present in virus preparations, was titrated in CHSE-214 cells grown in 24-well plates. This involved inoculating cells with 0·1 ml of a log10 virus dilution, prepared in supplemented MEM medium containing 2% FCS. After incubation for 7 days at 15 °C, the presence of virus was detected by the observation of virus-induced CPE or using immunoperoxidase (IP) labelling as previously described (Rowley et al., 1998 ).

Mouse immunization.
Mice were immunized for the production of SPDV-specific MAbs using a protocol for tolerization immunization similar to a method described by Tateishi et al. (1979) . The control tolerization antigen was prepared by conjugating a sonically disrupted CHSE-214 cell lysate preparation with a copolymer of D-glutamic acid:D-lysine (DGL) (ratio 6:4) (Baxter et al., 1996 ). SPDV antigen was prepared for immunization by ultracentrifugation (Beckman L7-65, type 35 rotor; 70000 g for 3 h at 4 °C) of infected culture supernatant, which had been clarified by centrifugation at 1400 g for 30 min at 4 °C. Crude virus pellets, produced from ~350 ml supernatant, were resuspended in PBS (1 ml) and stored at -20 °C. Four BALB/c Fx1 female mice, 12 weeks of age, were given a tolerization immunization of 1 mg DGL-conjugated CHSE-214 antigen 72 h prior to inoculation with 150 µg of virus preparation in complete Freunds adjuvant. Booster immunizations with virus antigen (150 µg) were given at 3 weeks in incomplete Freunds adjuvant and at 6 weeks in PBS. All immunizations were given intraperitoneally.

MAb production.
Four weeks after primary immunization with virus antigen, serum samples were tested by indirect immunofluorescence (IIF) for SPDV antibodies. Test-bleed samples were also adsorbed with CHSE-214 cell lysate antigen before screening. The mouse (M4) displaying antiviral activity was boosted at week 6 followed at 72 h by serum harvest and spleen removal for fusion with NSO myeloma cells for hybridoma and ascites production (McHugh et al., 1988 ). The sera from mice (M1M3) that displayed only CHSE-214 reactivity were harvested as control sera for the detection of cellular antigens. Mouse ascites preparations were partially purified by ammonium sulphate precipitation as described previously (McNulty & Allan, 1984 ).

Immunofluorescence.
IIF tests for the detection of SPDV-specific antibodies were developed using acetone-fixed SPDV-infected and uninfected CHSE-214 cells grown on multiwell slides. Initially serum samples from salmon that had been identified as positive or negative for SPDV antibodies by the virus serum neutralization test (Nelson et al., 1995 ) were tested on multispot slides in order to determine typical SPDV-specific fluorescence staining patterns. Specific binding of salmon antibodies was determined using an anti-salmonid MAb, 4C10 (1/100) (Thuvander et al., 1990 ), followed by incubation with a goat anti-mouse IgG FITC (GAMFITC) conjugate (Sigma). A polyvalent GAMFITC (specificity mouse IgA, IgG and IgM; Sigma) was used, in conjunction with the acetone-fixed SPDV-infected and uninfected CHSE-214 cells, to detect SPDV-specific mouse immunoglobulins in test bleeds and hybridoma cultures. All incubations were at 37 °C for 1 h, with a 10 min PBS wash following antibody incubation steps. Slides were mounted in Citifluor and observed by UV microscopy.

Virus purification.
Supernatants from virus-infected CHSE-214 cells were initially clarified by centrifugation (1400 g for 15 min at 4 °C). SPDV was then concentrated from the supernatant by precipitation with 2·2% NaCl and polyethylene glycol (PEG-8000; 6%, w/v) (Sigma) for 18 h at 4 °C with stirring. The PEG precipitate was collected by centrifugation at 1400 g for 90 min at 4 °C, and pellets were resuspended in TNE buffer (0·01 M TrisHCl pH 7·5; 0·1 M NaCl; 1 mM EDTA). PEG precipitates were also prepared from control, uninfected CHSE-214 cultures. To compensate for the higher levels of cellular proteins in the supernatants collected from virus-infected cells, one-quarter of the uninfected cell cultures used to produce the control supernatants were disrupted by freezing and thawing.

SPDV present in the resuspended PEG precipitate was fractionated by equilibrium sucrose density-gradient centrifugation. Initially, discontinuous gradients were prepared by layering 2 ml volumes of 60, 50, 40, 30 and 20% (w/w) sucrose in TNE buffer into 12 ml polyallomer tubes (Beckman). Continuous 2060% or 2550% (w/w in TNE) sucrose gradients were prepared using a gradient mixer. Gradients were stored at 4 °C for 1 h before addition of 1·5 ml of resuspended PEG precipitate. After ultracentrifugation (SW-40 rotor; 50000 g for 18 h at 4 °C) 1ml fractions were collected from the bottom of tubes and tested for virus and antigen by titration of virus infectivity in CHSE-214 cultures and by the immunodot blot assay respectively. For further virus purification, fractions containing peak virus (as determined by the immunodot blot assay) were diluted in TNE buffer and layered onto continuous 2550% sucrose gradients prior to ultracentrifugation as described.

Immunodot blot assay.
Aliquots of virus suspensions and sucrose gradient fractions diluted 1/10 in PBS were firstly adsorbed onto 0·45 µm pore nitrocellulose membrane (Bio-Rad) under vacuum using a 96-well microfiltration blotting system (Bio-Rad) (100200 µl per well). Specific antibody preparations were then used to detect bound antigen using the Bio-Rad Immun-Blot Assay kit (according to the manufacturers instructions). Briefly, antigen-blotted membranes were blocked with 3% gelatine in Tris-buffered saline (TBS) (0·02 M TrisHCl pH 7·5, 500 mM NaCl) for 30 min, followed by addition of antibodies and conjugates. The SPDV-specific MAb 2D9 present as ascites fluid was used at a dilution of 1:10000, while salmon sera were used at 1:30 dilution. Mouse MAbs were then detected with the test kit goat anti-mousealkaline phosphatase conjugate (GAMAP). Salmon serum was assayed using the anti-salmonid MAb 4C10 at 1/50 dilution, followed by detection with the GAMAP conjugate. All antibody preparations were diluted in TBS containing 1% gelatine and 0·05% Tween 20, and incubated for 1 h at room temperature, followed by 2x5 min washes in TBS containing 0·05% Tween 20. After the final wash, membrane strips were rinsed in TBS before addition of the AP substrate, 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT). The development reaction was stopped after 30 min with three washes of distilled water.

SDSPAGE.
The proteins present in sucrose gradient fractions (12 µg antigen) were analysed by SDSPAGE (Laemmli, 1970 ) on a Bio-Rad Protean-II gel apparatus with 4% stacking and 10% resolving gel at 35 mA, 350 V for 5 h. Samples were first boiled for 3 min in loading buffer (0·15 M TrisHCl pH 6·8, 6%, w/v, SDS, 15% 2-mercaptoethanol, 30% glycerol, bromophenol blue to colour). Gels were fixed in methanolacetic acidwater (30:10:60, by vol.) overnight and then silver stained using the Sigma AG-25 kit according to the manufacturers instructions.

Metabolic radiolabelling.
CHSE-214 cells grown to 90% confluency in six-well plates were mock-inoculated with medium or inoculated with SPDV at an m.o.i. of 10 TCID50 per cell for 1 h before removal of inoculum and addition of 3 ml of maintenance medium (containing 2% FCS). The infection regimes for radiolabelling experiments were optimized and the proportion of SPDV-infected cells was found to be 90% by 34 days post-infection (p.i.) as determined by IIF. Cultures were incubated at 15 °C, radiolabelled and harvested at various time-points up to 8 days. Before radiolabelling, cell layers were rinsed (x3) with methionine-free (Me-free) medium and starved for 1 h in Me-free medium±Actinomycin D (Act-D; 5 µg/ml) (Sigma). Inhibition of CHSE-214 cell metabolism was also attempted by hypertonic initiation block (HIB) of cellular message initiation of translation, using excess NaCl (75300 mM excess) culture conditions (Donis & Dubovi, 1987 ). After starvation, cells were labelled for 20 h by replacing medium with 1 ml Me-free medium containing 25 µCi [35S]methionine ([35S]Me)±Actinomycin D or ±excess NaCl. Samples were harvested by rinsing cell layers twice with cold PBS and solublized for 20 min in 500 µl radioimmunoprecipitation (RIPA) lysis buffer [0·15 M NaCl, 1% sodium deoxycholate, 1% Triton X-100, 0·1% SDS, 0·1 M TrisHCl pH 7·4, and protease inhibitors PMSF (1 mM) and Aprotinin (0·24 TIU/ml) (Sigma)]. Cell lysates were aspirated through a 23 gauge needle, and centrifuged at 10000 g (4 °C for 10 min), with supernatants being stored at -20 °C. Samples were analysed by SDSPAGE and visualized by autoradiography, after fixation of gels in isopropanolacetic acidwater (25:10:65, by vol.) and drying under vacuum.

Radioimmunoprecipitation.
RIPA was performed essentially as described by Paterson & Lamb (1993) . CHSE-214 cells, grown in 75 cm2 flasks, were infected with SPDV at an m.o.i. of 10 TCID50 per cell and incubated at 20 °C overnight before transfer to 15 °C for the remainder of culture. Cells were rinsed and starved with Me-free medium as above, and then labelled with 150 µCi [35S]Me (in 6 ml Me-free medium) at 48 h, and again with a further 150 µCi [35S]Me at 72 h p.i. Mock-infected cultures were similarly labelled. For harvesting (day 4), cells were scraped into the culture medium, pelleted and washed once with 10 ml PBS by centrifugation (1400 g, 15 min). Cell pellets collected from a 75 cm2 flask were solubilized in 1·5 ml RIPA lysis buffer as above. Monoclonal and polyclonal mouse antibodies were prepared in PBS to a dilution 200 times lower than the IIF titre (50% endpoint). The immunoprecipitation reaction consisted of 250 µl of RIPA cell lysate and 50 µl of antibody, which was incubated for 3 h at 4 °C with occasional agitation. Washed (x2 in 0·1 M TrisHCl pH 7·4) Sepharose-4Bprotein G (Sigma) was added (50 µl) to the immunoreaction mixture and incubation continued at 4 °C for 1 h on a rotator. After this incubation samples were washed twice with RIPA wash buffer I (lysis buffer with 0·3 M NaCl and no protease inhibitors), twice with lysis buffer (without protease inhibitors) and once with RIPA wash buffer II (50 mM TrisHCl pH 7·4; 150 mM NaCl; 2·5 mM EDTA). Protein G and RIPA reaction mixes were washed by centrifugation at 15000 g for 30 s. Finally, the washed protein G-precipitated complexes were analysed under reducing conditions by SDSPAGE and visualized by autoradiography.

Electroporation of CHSE-214 cells.
RNA was extracted from control or SPDV-infected CHSE-214 cells at 7 days p.i. using RNA-Isolator (Genosys). Extracted samples were digested with RNase (10 µg/ml) and DNase (10 U/µg DNA). Electroporation of CHSE-214 cells with RNA was performed essentially as described by Phenix et al. (2000) . Briefly, suspensions of CHSE-214 cells (2x106 per sample) were washed and resuspended in 800 µl PBS-A (without Mg2+ and Ca2+). Cell suspensions were added to 30 µl (110 µg) RNA sample, mixed and transferred to an electroporation cuvette and pulsed twice at 0·65 kV (1·625 V/cm) and 25 µF. Cells were immediately placed into growth medium and seeded at several dilutions into 24-well plates, which were incubated overnight at 20 °C before transfer to 15 °C. At days 3 and 7 post-electroporation, cells were examined visually for signs of SPDV-induced CPE and then fixed for IP staining. Supernatants from electroporated cultures were harvested at days 3 and 7, and virus infectivity was assessed.

Northern blot hybridization.
RNA was extracted from SPDV that had been purified by one cycle of sucrose gradient centrifugation using RNA-Isolator. This method was also used to extract RNA from both uninfected and SPDV-infected CHSE-214 cells at 7 days p.i., after inoculation of cultures at an m.o.i. of 10 TCID50 per cell. For Northern hybridizations RNA was subjected to electrophoresis on 1·2% denaturing gels containing 0·5% formaldehyde prior to blotting and cross-linking to nylon membranes (Boehringer Mannheim) (Strauss & Strauss, 1994 ). 32P-labelled probes were prepared from SPDV-specific cDNA by the random primer method (Feinberg & Vogelstein, 1984 ). SPDV-specific cDNA was produced by RTPCR using primers designed to amplify a 514 bp region within the SPDV E1 glycoprotein gene (Weston et al., 1999 ). First strand synthesis was carried out using primer E13' (5' TCGCAGCTGTCCACCACGCAT 3') followed by second strand synthesis and PCR amplification using primer E15' (5' GAAGTGGTGACGGCAGTCCAC 3') for 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1min. Prehybridization and hybridization were carried out using 6x SSC, 50% deionized formamide, 5x Denhardts solution, 0·5% SDS and 0·1 mg/ml salmon sperm. Hybridization was performed for 1216 h at 42 °C followed by one wash in 2x SSC for 5 min at room temperature, two washes in 2x SSC and 1% SDS for 0·5 h at 65 °C and two washes in 0·1x SSC and 1% SDS for 0·5 h at room temperature. SPDV-specific RNAs bound to the membrane were visualized by autoradiography.

Production of SPDV-specific mouse MAbs
Earlier work demonstrated that serum samples from mice immunized with crude virus pellets, obtained by differential ultracentrifugation, did not contain SPDV-specific antibody as determined by IIF. Following the use of the tolerization immunization procedure, IIF testing of serum samples, collected at week 4 of the immunization regime, indicated that all four immunized mice contained antibodies against CHSE-214 cellular antigens with titres in excess of 1:10000. After adsorption with CHSE-214 cells, serum from one mouse (M4) was found to contain virus-specific antibodies (detectable to a dilution of 1:2000). Mouse M4 was selected for MAb production and was further immunized with SPDV antigen. Of over 600 hybridomas that were screened by IIF, only three (2D9, 5D3 and 1A9) were identified as secreting SPDV-specific antibody. These hybridomas were cloned by limiting dilution and produced as ascites fluid. All of these MAbs and the M4 serum reacted in the immunodot blot test with SPDV antigen and 2D9 was chosen for use in purification experiments.

Fig. 1(a) shows the fluorescent staining patterns observed with salmon SPDV convalescent sera, which gave a more uniform cytoplasmic staining pattern than the MAbs (Fig. 1b, c). MAbs 2D9, 5D3, 1A9 and the polyclonal serum M4 all gave similar cytoplasmic labelling in SPDV-infected CHSE-214 cells. The most prominent feature observed by IIF using the MAbs was the intensely labelled area close to the nucleus (Fig. 1b, arrow). This is the first area in which reactivity of the MAbs was observed post-inoculation (day 3) of cultures and may represent reactivity with a virus glycoprotein trafficking through the Golgi apparatus. At time-points prior to 3 days p.i., staining of infected cells was rarely observed even at high m.o.i. (up to 10 TCID50 per cell), and may indicate a slow growth cycle p.i. for SPDV. Infected cells maintained their normal morphology during the early stages of infection, up to day 4 p.i., after which time infected cells displayed a relatively uniform cytoplasmic IIF staining pattern with finger-like projections extending from some infected cells (Fig. 1c). By days 67 p.i. a proportion of infected cells had become rounded to produce the typical SPDV CPE as normally associated with foci of infected cells observed by light microscopy in tissue culture.



(54K):

Fig. 1. IIF staining of SPDV-infected CHSE-214 cells. Acetone-fixed virus-infected cells were labelled with salmon SPDV convalescent serum [(a) 3 days p.i.;x400] and MAb 2D9 [(b) 3 days p.i., (c) 5 days p.i.; x250)]. MAbs 5D3 and 1A9, and the polyclonal M4 serum, all gave similar staining patterns. Bound salmon serum immunoglobulin was detected with anti-salmonid immunoglobulin MAb 4C10, and mouse antibodies were detected using a GAMFITC conjugate.

The salmon SPDV convalescent serum and the virus-specific MAbs did not show any reactivity with uninfected CHSE-214 cells by IIF. Salmon serum negative for SPDV antibodies, the 4C10 anti-salmonid MAb and the GAMFITC conjugate did not show any non-specific labelling against virus-infected or uninfected CHSE-214 cells.

Virus purification
Since high levels of virus infectivity (107108 TCID50/ml) were routinely detected in virus culture supernatants at 67 days p.i., it was considered that this material would be more suitable as a source of virus for purification than intracellular virus released from the cells by freezethaw cycles, which is likely to be heavily contaminated with cellular material. The first stage of purification was the concentration of virus from culture supernatants. Experiments indicated that PEG-8000 was more efficient in precipitating infectious SPDV from supernatants than PEG-17500, and when PEG-8000 precipitates were resuspended in 0·5% of the original volume, virus infectivities of approximately 109 TCID50/ml were recorded.

Preliminary experiments using discontinuous gradients indicated that peaks of infectious virus and antigen could be recovered at densities close to 40% sucrose (data not shown). As a consequence, in subsequent experiments, PEG-precipitated virus preparations were subjected to equilibrium centrifugation using continuous 2060% sucrose density-gradients. After centrifugation, an opalescent band was detected just below the middle of the gradient. Application of the immunodot blot assay using a CHSE-214 cell-specific mouse polyclonal serum (M2) indicated that although most cellular antigens were located at the top of the gradient (fractions 10 and 11), fraction 5, which contained the opalescent band, also produced a positive response (Fig. 2a). When the SPDV-specific MAb 2D9 and SPDV convalescent salmon serum were used in the assay it was demonstrated that fraction 7 contained the peak amount of virus antigen, and virus infectivity titration also indicated that this fraction contained the highest level of infectious virus (108·5 TCID50/ml) (Fig. 2a).



(46K):

Fig. 2. Immunodot blot detection of SPDV and CHSE-214 cellular antigens. (a) Fractionation of PEG-precipitated SPDV on a 2060% sucrose gradient (Fraction 1, 60% sucrose; fraction 10, 20% sucrose). Antigens present in each of the gradient fractions were reacted separately with SPDV-specific MAb 2D9, polyclonal anti-CHSE-214 M2 serum and salmon convalescent SPDV antiserum. Bound salmon serum antibodies were detected with anti-salmonid immunoglobulin MAb 4C10, and mouse antibodies were detected using a GAMAP conjugate. The control lane shows no non-specific reactivity of the 4C10 MAb or the GAMAP conjugate with antigens present in the gradient. Infectivity of gradient fractions was assessed by titration on CHSE-214 cells. (b) Further purification of SPDV was achieved by fractionating peak SPDV-containing fractions (fractions 6, 7 and 8 from 2060% sucrose gradients) shown in (a) on a 2550% sucrose gradient (Fraction 1, 50% sucrose; fraction 10, 25% sucrose). Antigens present in each of the gradient fractions were reacted separately with SPDV-specific MAb 2D9 and polyclonal anti-CHSE-214 M2 serum. Bound mouse antibodies were detected using a GAMAP conjugate.

To achieve greater purification, the peak virus-containing fractions were diluted in TNE buffer and layered onto a 2550% sucrose gradient prior to a second cycle of equilibrium centrifugation. On this occasion, immunodot blot analysis of the fractions indicated that fraction 7 contained virus antigen but no detectable cellular antigen (Fig. 2b).

Virus proteins
The protein composition of SPDV was determined by subjecting aliquots of virus that had been purified by two cycles of sucrose density-gradient centrifugation to analysis by SDSPAGE. After silver staining only two major bands, corresponding to molecular masses of 55 and 50 kDa, were consistently detected (Fig. 3). Additional minor bands with molecular masses of approximately 105, 70 and 43 kDa were also observed in some but not all analyses. No capsid protein with the expected molecular mass of ~31 kDa was observed on any SDSPAGE analysis which had prominent 55 and 50 kDa bands after silver staining. All of the MAbs and the polyclonal M4 serum were also tested by Western blot, but showed no reactivity with any SPDV preparations (data not shown).



(40K):

Fig. 3. SDSPAGE analysis of SPDV structural proteins. Lane 1, molecular mass markers. Lane 2, virus purified by PEG precipitation and two cycles of equilibrium sucrose density-gradient centrifugation (peak virus-containing fraction 7 from 2550% sucrose gradient, Fig. 2b). Two major protein bands with molecular masses of 50 and 55 kDa are detected after silver staining.

Attempts to identify virus-specific proteins by an in vitro radiolabelling procedure, involving exposure of virus-infected cells at different times p.i. to [35S]methionine, were unsuccessful. SDSPAGE analysis/autoradiography indicated that over an 8 day infectious cycle time-course, most radiolabel became incorporated into cellular proteins which migrated to all areas of the gel, making it impossible to identify virus-induced proteins (data not shown). No shut-off of host-cell protein synthesis was observed over the SPDV infection time-course, even though >90% of the cells became infected by 34 days p.i. Additional attempts to preferentially label virus-specified proteins by inhibiting cellular protein synthesis with HIB and Actinomycin D treatments were also unsuccessful.

The RIPA procedure was used to provide additional information about SPDV-specific proteins. Using RIPA, MAbs 2D9 and 5D3 reacted with a virus protein in the molecular mass range 5055 kDa, but MAb 1A9 failed to precipitate any SPDV proteins under these conditions (Fig. 4). This 5055 kDa protein was also the only virus protein precipitated by the M4 polyclonal anti-SPDV serum, after adsorption of this antiserum with CHSE-214 cells.



(85K):

Fig. 4. RIPA of SPDV-specific proteins. Control (C) and virus (V)-inoculated CHSE-214 cultures were radiolabelled with [35S]methionine. After labelling and lysis of cultures, the lysates were immunoprecipitated with MAbs 2D9, 5D3 and 1A9 and polyclonal anti-SPDV mouse serum M4. Immune complexes were captured with protein G, analysed by SDSPAGE and visualized by autoradiography. Radiolabelled molecular mass markers were included in the first lane. Inoculation of cultures under these conditions consistently resulted in >90% infection with SPDV as determined by IIF.

Virus RNA
Northern blot hybridization analysis of RNA extracted from SPDV-infected CHSE-214 cells, using a probe specific to the putative SPDV E1 glycoprotein, identified a genomic RNA band at approximately 11·4 kb and a subgenomic RNA band at 4 kb (Fig. 5). The probe reacted more strongly with the subgenomic RNA at 4 kb due to the higher copy number present within infected cells, with degraded subgenomic RNA appearing below this band. No hybridization signals were detected with RNA from uninfected cells.



(59K):

Fig. 5. Northern blot hybridization of SPDV-specific RNA. RNA extracted from virus-infected cells was fractionated by denaturing gel agarose electrophoresis and, after Northern blotting, membranes containing immobilized RNA were hybridized to a 32P-labelled DNA probe specific to the E1 gene region of the SPDV genome. The positions of the SPDV genomic (11·4 kb) and subgenomic (4·0 kb) RNA species, detected after autoradiography, are shown. The positions of the RNA size markers are also indicated.

Infectious RNA
RNA extracts prepared from SPDV-infected cell cultures or sucrose-purified virus were infectious following electroporation transfection (EPT) of CHSE-214 cells, as determined by IP labelling for the detection of SPDV. DNase digestion of samples prior to EPT had no effect on the infectivity of RNA extracts whereas RNase digestion abrogated infectivity. IP labelling identified typical foci of SPDV infection in cell monolayers as early as day 3 (<0·1% cells infected) post-EPT, with the virus spreading to permit antigen detection in approximately 1% of the cell monolayer by day 7. The supernatants collected from EPT cultures at 7 days, when inoculated onto CHSE-214 cultures, resulted in widespread infection of cells (>20%) by 6 days p.i., indicating that the RNA extracts were capable of transfecting cells leading to the production and release of viable infectious virus from transfected cells. In this paper we describe the purification and biochemical characterization of SPDV, which, on the basis of a sequence analysis of a 5·2 kb fragment at the 3' terminus of the genome, we have recently identified as the first alphavirus recognized in fish (Weston et al., 1999 ). The RNA and protein composition of SPDV reported in the present paper are consistent with this classification.

The biochemical characterization of SPDV was made possible by the availability of an effective virus purification method. Early attempts at purification, which depended on the virus infectivity assay to identify fractions containing peak amounts of virus, did not satisfactorily differentiate between virus that was associated with cellular material and virus that was largely free of such contamination. In addition, since the development of CPE can take up to 10 days and infectivity assays are very time-consuming and labour-intensive, the numbers of purification methods that can be evaluated by infectivity assays are limited. The purification method described in this paper relied on virus detection using an SPDV-specific MAb, 2D9, in an immunodot blot assay.

The SPDV-specific MAbs were generated using a tolerization procedure, since previous attempts to immunize mice with unpurified virus that had been concentrated by differential centrifugation were unsuccessful in stimulating virus-specific antibody. The low yield of virus-reactive MAbs may indicate poor immunogenicity of SPDV proteins in the mouse, and explain the difficulties encountered in producing anti-SPDV monoclonals. The reactivity of the M4 polyclonal mouse serum with a single protein in the RIPA experiments may also imply low immunogenicity of the other SPDV proteins. MAbs 2D9, 5D3 and 1A9 were considered specific because they produced virus-specific IIF staining patterns that were considered similar to those obtained with salmon SPDV convalescent antisera and, when used in RIPA, MAbs 2D9 and 5D3 were shown to be reactive with a 5055 kDa protein which was present in virus-infected cells but not in uninfected cells. When used in conjunction with the virus-specific 2D9 MAb and a polyclonal mouse antiserum (M2) that contained anti-CHSE-214 antibodies, the immunodot blot assay allowed sucrose fractions rich in virus and free of cellular antigens to be identified. The presence of peak virus levels was also demonstrated by a virus infectivity assay.

Protein analysis of gradient-purified virus preparations by SDSPAGE indicated the presence of two major proteins with molecular masses of 55 and 50 kDa. On the basis of their predicted sizes, it is probable that these proteins correspond to the E1 and E2 SPDV glycoproteins respectively. Previous sequence analysis indicated that the putative E1 and E2 coding regions possess 461 and 438 amino acids and one or two potential N-linked glycosylation sites. However, at this stage, the possibility that the silver-stained protein bands represent uncleaved combinations of E2 with E3 or the 6K protein and E1 with the 6K protein cannot be ruled out. More extensive research involving the use of antisera raised separately to the E1 and E2 proteins expressed by an appropriate expression vector or antisera raised to synthetic peptides specified by E1 and E2 gene sequences would be required before it can be established whether SPDV proteins are processed in an identical manner to those of other alphaviruses.

RIPA experiments performed with lysates of infected cells indicated that the 2D9 and 5D3 MAbs were reactive with a single protein with a molecular mass in the 5055 kDa range. Reactivity of MAb 2D9 in the immunodot blot test with gradient-purified virions would suggest that this MAb reacts with an epitope on one of the structural proteins of SPDV. The IIF staining patterns, which showed intense staining of an area close to the nucleus at early times p.i., are suggestive that MAbs 2D9 and 5D3 may react with virus glycoproteins trafficking through the Golgi apparatus. It is therefore likely that the SPDV protein reactive by RIPA corresponds to one of the two structural glycoproteins. However, because the molecular mass markers used in the RIPA and SDSPAGE experiments were different, we have found it difficult to determine whether the molecular mass of the RIPA-precipitated protein corresponds to that of the faster or slower migrating structural protein.

So far, we have been unsuccessful in all of our attempts at detecting the SPDV capsid protein, which has a predicted molecular mass of approximately 31 kDa (282 amino acids) (Weston et al., 1999 ). The absence of a detectable capsid protein band could possibly be explained if insufficient virus was available for analysis. However, since 12 µg of gradient-purified virus possessing high levels of virus infectivity were loaded onto gels for SDSPAGE analysis, then sufficient virus protein should have been present to allow visualization of the capsid protein by silver staining. As the 50 and 55 kDa envelope proteins were readily visible on the SDSPAGE gels, this is further support that sufficient virus antigen was loaded to allow identification of the SPDV nucleocapsid. It may be possible that the SPDV capsid protein binds disproportionately less silver stain than its larger glycoprotein counterparts. It would have been useful to treat SPDV with a non-ionic detergent and demonstrate the presence of the nucleocapsid on a sucrose gradient, but no means were available to identify the nucleocapsid with the anti-SPDV antibody reagents that were available. The lack of capsid protein apparent in these experiments, while concerning, highlights the difficult nature of working with SPDV as it does not readily lend itself to study as easily as other alphaviruses.

Attempts to identify the SPDV-specific structural and non-structural proteins within infected cells were unsuccessful due to the growth characteristics of SPDV in CHSE-214 cells and, more specifically, to the apparent failure of this virus to cause shut-off of host-cell protein synthesis. In these aspects, SPDV differs from the more extensively studied alphaviruses, where inhibition of host-cell metabolism begins around 3 h with degeneration of the host cell by 1020 h p.i. (Strauss & Strauss, 1994 ). Even when a relatively high m.o.i. (10 TCID50 per cell) is used, infection of CHSE-214 cells does not cause widespread CPE. Indeed monolayers, in which the majority (>80%) of cells are infected as indicated by IIF, can persist beyond 2 weeks p.i. We have also found that the yield of infectious virus harvested in the maintenance medium collected after 1 week is similar to that found in the replacement medium, added 1 week p.i. and collected at 2 weeks p.i., an observation that suggests that SPDV may be a slow-growing virus (unpublished results). Work in this laboratory has shown that Semliki Forest virus (SFV) causes widespread cell lysis when it replicates in CHSE-214 cells maintained at 25 °C (Phenix et al., 2000 ). This finding supports the view that persistence is a feature of SPDV virus rather than a characteristic of the cell.

In this investigation, Northern blot hybridization analysis has been used to show that two major SPDV-specific RNA species can be extracted in virus-infected CHSE-214 cells. The sizes of these species, approximately 11·4 and 4·0 kb, strongly suggest that they represent the genomic and subgenomic viral RNAs and are close to those reported for animal alphaviruses (Strauss & Strauss, 1994 ). This result provides evidence that, as has been found with animal alphaviruses, SPDV utilizes a replication strategy involving a subgenomic species. Using electroporation of RNA extracted from purified virus and virus-infected infected cells, we have additionally shown that, as would be expected for an alphavirus, the SPDV genome is infectious.

In conclusion, this paper reports that in terms of its protein and RNA composition SPDV shares many of the characteristics possessed by animal alphaviruses. The protein composition reported is consistent with that found for alphaviruses and, provided that the immune system of salmonid fish responds in a manner similar to those of animals, it is likely that the envelope glycoproteins may constitute the basis for the development of a recombinant vaccine and a diagnostic test for detecting SPDV antibodies. The ability to produce purified SPDV, as described in this paper, should overcome some of the difficulties that we have encountered when immunizing mice against SPDV and hence allow the production of additional polyclonal and monoclonal antibodies, which may find application as tools for the study of SPDV pathogenesis and molecular biology.

This work was funded by Intervet-International, Boxmeer, The Netherlands. We would like to thank A. Baxter for the antigen conjugations, D. Pollock for his expertise in mouse monoclonal antibody production and C. Mason for the photography and image preparation.

References

Baxter, G. A., Elliott, C. T., Crooks, S. R. H. & McCaughey, W. J. (1996). Specificity enhancement of polyclonal antisera by induction of tolerance to unwanted cross-reacting determinants. Food & Agricultural Immunology 8, 85-95.

Christie, K. E., Fyrand, K., Holtet, L. & Rowley, H. M. (1998). Isolation of pancreas disease virus from farmed Atlantic salmon Salmo salar L., in Norway. Journal of Fish Diseases 21, 391-394.

Donis, R. O. & Dubovi, E. J. (1987). Characterization of bovine viral diarrhoea-mucosal disease virus-specific proteins in bovine cells. Journal of General Virology 68, 1597-1605.[Abstract/Free Full Text]

Feinberg, A. P. & Vogelstein, B. (1984). A technique for radio-labelling DNA restriction endonuclease fragments to high specific activity.Annals of Biochemistry 137, 266-267.

Kent, M. L. & Elston, R. A. (1987). Pancreas disease in pen reared Atlantic salmon in North America. Bulletin of the European Association of Fish Pathologists 7, 29-31.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]

McHugh, P. H., Mackie, D. P., McNulty, M. S. & McFerran, J. B. (1988). Production of monoclonal antibodies to bovine virus diarrhoea virus and their reactivity with selected pestivirus isolates. Journal of Veterinary Medicine 35, 207-213.

McLoughlin, M. F., Nelson, R. T., Rowley, H. M., Cox, D. I. & Grant, A. N. (1996). Experimental pancreas disease in Atlantic salmon Salmo salar post-smolts induced by salmon pancreas disease virus (SPDV). Diseases of Aquatic Organisms 26, 117-124.

McNulty, M. S. & Allan, G. M. (1984). Application of immunofluorescence in veterinary viral diagnosis. In Recent Advances in Virus Diagnosis, pp. 15-26. Edited by M. S. McNulty & J. B. McFarran. The Hague: Martinus Nijhoff.

Menzies, F. D., Wheatley, S. B., Goodall, E. A. & McLoughlin, M. F. (1996). Development of a computerised information retrieval system for Atlantic salmon (Salmo salar). Aquatic Research 27, 183-190.

Munro, A. L. S., Ellis, A. E., McVicar, A. H. & McLay, H. A. (1984). An exocrine pancreas disease of farmed Atlantic salmon in Scotland. Helgolander Wissenschaftliche Meeresuntersuchungen. Marine Investigations 37, 571-586.

Murphy, T. M., Rodger, H. D., Drinan, E. M., Gannon, F., Kruse, P. & Korting, W. (1992). The sequential pathology of pancreas disease in Atlantic salmon farms in Ireland.Journal of Fish Diseases 15, 401-408.

Nelson, R. T., McLoughlin, M. F., Rowley, H. M., Platten, M. A. & McCormick, J. I. (1995). Isolation of a toga-like virus from farmed Atlantic salmon Salmo salar with pancreas disease. Diseases of Aquatic Organisms 22, 25-32.

Paterson, R. G. & Lamb, R. A. (1993). The molecular biology of influenza viruses and paramyxoviruses. In Molecular Virology, A Practical Approach, pp. 35-73. Edited by A. J. Davison & R. M. Elliott. Oxford: IRL Press.

Phenix, K. V., McKenna, B. M., Fitzpatrick, R., Vaughan, L., Atkins, G., Liljestrom, P. & Todd, D. (2000). Cell culture evaluation of the Semliki Forest virus expression as a novel approach for antigen delivery and expression in fish. Marine Biotechnology (in press).

Poppe, T., Rimstad, E. & Hyllseth, B. (1989). Pancreas disease in Atlantic salmon (Salmo salar) post smolts infected with infectious pancreatic necrosis virus (IPNV). Bulletin of the European Association of Fish Pathologists 9, 83-85.

Raynard, R. S., Houghton, G. & Munro, A. L. S. (1992). Pancreas disease of Atlantic salmon: proceedings of a European Commission workshop. Scottish Office Aquaculture Report, The Scottish Office Agriculture and Fisheries Department, Aberdeen, No. 1, 24.

Rowley, H. M., Doherty, C. E., McLoughlin, M. F. & Welsh, M. D. (1998). Isolation of salmon pancreas disease virus (SPDV) from farmed Atlantic salmon (Salmo salar L.) in Scotland.Journal of Fish Diseases 21, 469-471.

Strauss, J. H. & Strauss, E. G. (1994). The alphaviruses: gene expression, replication and evolution. Microbiological Reviews 58, 491-562.[Abstract/Free Full Text]

Tateishi, K., Hamaoka, T., Takatsu, K. & Hayashi, C. (1979). A novel immunization procedure for production of anti-testosterone and anti-5a-dihydrotestosterone antisera of low cross-reactivity. Journal of Steroid Biochemistry 13, 951-959.

Thuvander, A., Fossum, C. & Lorenzen, N. (1990). Monoclonal antibodies to salmonid immunoglobulin: characterization and applicability in immunoassays.Developmental & Comparative Immunology 14, 415-423.

Weston, J. H., Welsh, M. D., McLoughlin, M. F. & Todd, D. (1999). Salmon pancreas disease virus, an alphavirus infecting farmed Atlantic salmon, Salmo salar.Virology 256, 188-195.[Medline]

Wheatley, S. B. (1994). Epidemiological investigations of Atlantic salmon production using a computerised database system. PhD thesis. The Queens University of Belfast, UK.

Received 4 August 1999; accepted 5 November 1999.