Research Article

Subterminal viral DNA nucleotides as specific recognition signals for human immunodeficiency virus type 1 and visna virus integrases under magnesium-dependent conditions

Journal of General Virology 2000; 81(3):839

PubMed

Abstract

Many reports describe the characteristics of susceptible viral DNA substrates to various retroviral integrases during in vitro reactions in which manganese serves as the divalent cation cofactor for site-specific nicking. However, manganese is known to alter the specificity of some endonucleases and magnesium may be the divalent cation used during retroviral integration in vivo. To address these concerns, we identified conditions under which the integrases of human immunodeficiency virus type 1 and visna virus were optimally active with magnesium (the first time such activity was shown for visna virus integrase) and used these conditions to test the susceptibility of a series of oligodeoxynucleotide substrates. The data show that two base pairs immediately internal to the conserved CA dinucleotide near the termini of retroviral DNA are selectively recognized by the two integrases and that the final six base pairs of viral DNA contain sufficient sequence information for specific recognition and cleavage by each enzyme. The results validate the importance of the subterminal viral DNA positions even in the presence of magnesium and identify viral DNA positions that functionally interact with integrase. The data obtained under magnesium-dependent conditions, which were obtained with substrates containing single and multiple base-pair substitutions and two different retroviral integrases, are consistent with those previously obtained with manganese. Thus, the large body of manganese-dependent data identifying terminal viral DNA positions that are important in substrate recognition by various integrases likely reflects interactions that are biologically relevant.
Integration of a DNA copy of the retroviral genome into host-cell chromosomal DNA is an essential step in retrovirus replication and the pathogenesis of retrovirus-related diseases [see Brown (1997) and Asante-Appiah & Skalka (1997b) for recent reviews of integration]. This recombination event is catalysed by the retroviral integrase (IN), which is an attractive target for the development of specific antiretroviral therapy. The IN enzyme acts on two types of DNA substrates: viral DNA and host DNA. The double-stranded viral DNA, which is copied from the viral RNA genome by reverse transcriptase, has two long terminal repeat (LTR) sequences. Each LTR is comprised of U3, R and U5 regions; thus, the upstream end of viral DNA begins with the U3 region of one LTR and the downstream end terminates with the U5 region of the other LTR (Fig. 1A). To mediate integration, IN catalyses two distinct reactions at each end of the viral DNA. First, IN removes two nucleotides that follow highly conserved CA bases typically located at positions 4 and 3 from the 3' end of each DNA strand to create recessed 3'-hydroxyl ends; this site-specific endonuclease activity is referred to as processing. Next, IN inserts the processed viral DNA ends into host DNA in a sequence-independent manner across a small fixed-length stagger of four to six base pairs; this activity is referred to as DNA joining or strand transfer. Both of these activities can be modelled in vitro by using purified IN proteins and oligodeoxynucleotides designed to mimic either viral DNA end (Fig. 1B). In these systems, IN appropriately removes two nucleotides following the conserved CA (Katzman et al., 1989 ) and inserts the processed ends into various sites of other oligonucleotides that act as surrogates for host DNA (Katz et al., 1990 ; Craigie et al., 1990 ).



(20K):

Fig. 1. Synthetic oligonucleotide substrates and integrase assays. (A) A schematic of unintegrated retroviral DNA is shown, with each LTR consisting of U3, R and U5 regions. Synthetic 18 base pair oligonucleotides that mimic the double-stranded U3 and U5 ends of visna virus or HIV-1 DNA are shown with the positive (+) strand above the negative (-) strand. The numbering used throughout this report is indicated. For the in vitro IN assays, the 5' end of the strand containing the conserved CA (shown in boldface) is radiolabelled (asterisks represent 32P groups). Arrows indicate the sites of specific endonucleolytic cleavage. (B) Schematic of in vitro integrase assays using the 5'-labelled visna virus U5 substrate. The processing activity of IN removes two nucleotides 3' to the conserved CA (boldface) to form a labelled product two nucleotides shorter than the substrate. The DNA joining activity of IN inserts the recessed 3' CAOH terminus of a processed end into various sites on other oligonucleotides, resulting in a set of labelled products longer than the substrate. The target strand may or may not be processed or labelled.

Many investigators have examined the characteristics of susceptible viral DNA substrates to illuminate the specific interactions between IN and the viral DNA termini. Although early studies with avian myeloblastosis virus IN used oligonucleotide-based assays in which magnesium served as the divalent metal cofactor (Katzman et al., 1989 ), integrases subsequently purified from a variety of retrovirus systems often are inactive with Mg2+. Moreover, all integrases exhibit greater activity when manganese is present in standard assays. As a result, there is a large amount of published data describing the requirements for susceptible substrates of human immunodeficiency virus type 1 (HIV-1) and several other integrases using Mn2+ as the divalent cation [reviewed with citations in Katzman & Katz (1999) ]. Given that Mn2+ may alter the specificity of other endonucleases (Hsu & Berg, 1978 ; Vermote & Halford, 1992 ) and that Mg2+ may be the relevant divalent cation within cells (Miller et al., 1995 ; Bujacz et al., 1997 ; Asante-Appiah & Skalka, 1997a ), the biological relevance of these results is unclear. To date, only one publication has described sequence requirements for viral DNA susceptibility to processing by HIV-1 IN under conditions in which Mg2+ served as the cofactor (Esposito & Craigie, 1998 ). In particular, these investigators studied a series of oligonucleotide substrates that contained single base-pair substitutions in the HIV-1 U5 sequence. In the current report, we validate and extend those observations by identifying in vitro conditions under which another retroviral integrase exhibits Mg2+-dependent activity that is comparable to its activity with Mn2+. More importantly, we use these conditions for comparative studies involving two integrases and substrates that contain single or multiple base-pair substitutions, with a particular focus on the viral DNA U3 terminus, and compare the results with those obtained using Mn2+. Together, the data provide a more complete understanding of the roles of subterminal viral DNA positions in recognition by IN. Purified integrases.
Proteins were purified from a bacterial expression system as described previously (Katzman & Sudol, 1994 , 1995 ). The concentrations of the purified HIV-1 and visna virus integrases were 357 ng/µl and 367 ng/µl, respectively, or about 10 pmol/µl for each enzyme, as measured by comparison to Coomassie blue-stained standards following SDSPAGE and densitometry of dried gels.

Oligonucleotides.
All oligodeoxynucleotides used as assay substrates were gel-purified following synthesis and again after being 5'-end-labelled with [γ-32P]ATP by T4 polynucleotide kinase (Katzman & Sudol, 1994 ). Sequences are indicated in the appropriate figures.

In vitro integrase assays.
Double-stranded DNA substrates were prepared by annealing the labelled strand with 4-fold excess unlabelled complementary oligonucleotide (Katzman & Sudol, 1994 ). Standard 10 µl reaction mixtures contained 0·5 pmol of double-stranded DNA, 25 mM TrisHCl (pH 8·0), 10 mM dithiothreitol, 1·0 µl of IN or protein storage buffer, and MnCl2 or MgCl2 as indicated for each experiment. Reaction mixtures were incubated for 90 min at 37 °C, and then stopped by addition of 10 µl loading buffer (95% formamide, 20 mM EDTA, 0·05% bromophenol blue, 0·05% xylene cyanol) and heating at 95 °C for 5 min. Aliquots were loaded onto 20% polyacrylamide (acrylamide to methylene-bisacrylamide ratio, 19:1)7 M urea denaturing gels, followed by electrophoresis at 75 W until the bromophenol blue dye had migrated 21 cm. Wet gels were autoradiographed at -70 °C.

Quantification of results.
The radioactivity of bands in wet gels was quantified with a Betascope (Betagen). Specific viral DNA cleavage, or processing, was calculated as [(c.p.m. of 16-mers)+(c.p.m. of >18-mers)]/(total c.p.m. in lane), with background corrections from analogous parts of a negative control lane; >18-mers refers to products longer than substrate length, which form only following specific cleavage (Katz et al., 1990 ; Craigie et al., 1990 ; Bushman & Craigie, 1991 ). Use of total c.p.m. in the denominator best reflects conversion of substrate to specific product, but yields lower calculated cleavages than would be suggested by merely comparing 16-mer products to the remaining 18-mer substrates.

Conditions under which HIV-1 and visna virus INs are active with magnesium
We previously showed that HIV-1 IN and visna virus IN are highly and comparably active on oligonucleotide substrates derived from the HIV-1 U5 terminus when Mn2+ serves as the cofactor (Katzman & Sudol, 1995 ). Thus, we used this substrate to screen for conditions that would permit Mg2+-dependent activity by each of these enzymes. Mg2+-dependent activity generally is absent or minimal with our preparations of HIV-1 IN and visna virus IN. Although others have reported that polyethylene glycol 8000 (PEG) or zinc can stimulate the Mg2+-dependent activity of HIV-1 IN (Engelman & Craigie, 1995 ; Zheng et al., 1996 ; Lee & Han, 1996 ; Lee et al., 1997 ), we could not demonstrate that our enzyme preparations were stimulated by either of these reagents and found inhibition of activity under some conditions (data not shown). In contrast, dimethyl sulfoxide (DMSO), which also has been reported to enhance Mg2+-dependent activity of HIV-1 IN (Engelman & Craigie, 1995 ; Lee & Han, 1996 ), dramatically stimulated the Mg2+-dependent activity of our HIV-1 and visna virus IN preparations in a dose-dependent manner (Fig. 2). Maximal Mg2+-dependent processing activity for these enzyme preparations was exhibited when reaction mixtures contained 510 mM Mg2+ and 3040% (v/v) DMSO; under these conditions, at least 40% of the 18-mer substrate was converted to the 16-mer product (Fig. 2, lower panel, lanes 7, 8, 15 and 16). This level of activity is comparable to that achieved with Mn2+ (Fig. 2, lower panel, lanes 3 and 11). Minimal or no Mg2+-dependent processing activity was evident in the absence of DMSO (Fig. 2, lower panel, lanes 4 and 12). Titration experiments showed that 0·010·1 mM Mn2+ would need to be present in the final reaction mixture to detect any Mn2+-dependent IN activity; such an amount is unlikely to be provided as a contaminant of the DMSO used in these experiments. Moreover, DMSO alone did not support processing activity by HIV-1 IN or visna virus IN (Fig. 2, lower panel, lanes 2 and 10). This result definitively excludes the possibility that stimulation of Mg2+-dependent activity by DMSO was due to contaminating Mn2+. Addition of PEG or Zn2+ to reactions conducted with Mg2+ and DMSO provided no significant benefit and sometimes diminished activity (data not shown).



(104K):

Fig. 2. Stimulation of Mg2+-dependent activity by DMSO. Autoradiograms of denaturing polyacrylamide gels are shown. The lower panel is a short exposure of the lower part of one gel and the upper panel is a longer exposure of the upper part of the same reaction lanes but from a different gel. The regions overlap because both panels include the 18-mer substrate, as indicated at the left; the 16-mer processing product is indicated also. Double-stranded 18-mers derived from the U5 end of HIV-1 DNA were 5'-labelled on the strand that contains the conserved CA and incubated with protein buffer (lanes 1 and 9), HIV-1 IN (lanes 28) or visna virus IN (lanes 1016). Reactions for lanes 1, 3, 9 and 11 contained 10 mM MnCl2 and no DMSO; reactions for lanes 2 and 10 contained no divalent cation but 30 % DMSO; reactions for lanes 48 contained 7·5 mM MgCl2 and the indicated amounts of DMSO; and reactions for lanes 1216 contained 10 mM MgCl2 and the indicated amounts of DMSO. The smears in the upper portions of lanes 1 and 9 are artefactual; no bands were evident in shorter exposures of these lanes. Prominent strand-transfer products created by HIV-1 IN or visna virus IN are highlighted with asterisks or arrowheads, respectively.

DMSO also stimulated the Mg2+-dependent DNA joining activity of both enzymes to create products longer than substrate length (Fig. 2, upper panel). However, the patterns of strand-transfer products obtained with Mg2+ differed from the patterns obtained with the same enzyme and substrate DNA when Mn2+ served as the divalent cation. For example, note the location of the most prominent band created by HIV-1 IN in the presence of Mn2+ as compared with the most prominent band created with Mg2+ (Fig. 2, upper panel, the asterisks next to lanes 3 and 8, respectively). Similarly, visna virus IN created a predominant band with Mn2+ but two prominent bands with Mg2+ (Fig. 2, upper panel, the arrowheads next to lanes 11 and 16, respectively).

Exploration of one other approach to stimulating the Mg2+-dependent activity of these enzymes provided additional important information. Although we confirmed the work of Lee et al. (1995a , b ) that longer oligonucleotide substrates alter the divalent cation preference of HIV-1 IN, a similar result was not obtained for visna virus IN. In particular, double-stranded 18-mers from the HIV-1 U5 end were more susceptible to HIV-1 IN in the presence of Mn2+ than in the presence of Mg2+ (Fig. 3, lower panel, lanes 2 and 3), whereas 32-mers derived from the same viral DNA end were slightly more susceptible to HIV-1 IN with Mg2+ (Fig. 3, upper panel, lanes 2 and 3). In contrast, visna virus IN was inactive for processing on either substrate with Mg2+, although it preferred the shorter substrate with Mn2+ (Fig. 3, lanes 5 and 6). Thus, lengthening the size of the viral DNA substrate is not sufficient to reveal Mg2+-dependent processing by all integrases. However, addition of DMSO dramatically stimulated the Mg2+-dependent activity of visna virus IN on both substrates, especially the 18-mers (Fig. 3, lane 7). Although DMSO also stimulated the Mg2+-dependent activity of HIV-1 IN on the shorter substrate, it did not do so on the longer one (Fig. 3, lane 4), perhaps because the level of activity on this substrate was high already. Because our preparations of HIV-1 IN and visna virus IN showed greatest Mg2+-dependent activity when the substrates were 18 base pairs long and DMSO was present (Fig. 3, lower panel, lanes 4 and 7), we chose these conditions for subsequent experiments directed at analysing the role of subterminal nucleotides in recognition by IN. These conditions have the additional advantage of permitting direct comparisons with our previous results that were obtained using 18-mer substrates in the presence of Mn2+ (Katzman & Sudol, 1996 ).



(76K):

Fig. 3. Effect of substrate length on divalent cation preferences. Autoradiograms of denaturing polyacrylamide gels are shown, with the relevant parts of the two sets of lanes aligned vertically. Double-stranded substrates derived from the U5 end of HIV-1 DNA were 5' labelled on the strand that contains the conserved CA and incubated with protein buffer (lane 1), HIV-1 IN (lanes 24) or visna virus IN (lanes 57). Reactions for lanes 1, 2 and 5 contained 10 mM Mn2+, reactions for lanes 3 and 4 used 7·5 mM Mg2+, and reactions for lanes 6 and 7 had 10 mM Mg2+. Reactions for lanes 4 and 7 were supplemented with 30% DMSO. The 32-mer substrate and 30-mer product for one set of reactions (upper panel), and the 18-mer substrate and 16-mer product for another set (lower panel), are indicated at the left. Relative processing efficiencies can be appreciated by comparing the amounts of products and substrates in these regions (to compensate for any variability in loading the lanes). The sequence of the plus strand of the 32-mer substrate is 5' CCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT 3'.

Retroviral integrases generally exhibit different levels of activity on substrates derived from the two ends of unintegrated viral DNA, perhaps reflecting a need to process the two viral DNA ends sequentially rather than simultaneously (Kukolj & Skalka, 1995 ). In addition, some integrases are more active on heterologous substrates (Katzman & Sudol, 1995 ; Balakrishnan & Jonsson, 1997 ). Thus, we tested HIV-1 IN and visna virus IN under optimal Mg2+-dependent conditions on all four possible viral DNA substrates, i.e. 18-mers derived from the U3 or U5 ends of HIV-1 or visna virus (as in Fig. 1A). The results were identical to those obtained when Mn2+ served as the divalent cation (Katzman & Sudol, 1995 ). In particular, both enzymes were very active on the HIV-1 U5 substrate (Fig. 4, lower panel, lanes 15) and less active on the visna virus U5 substrate (lanes 1115). In addition, the two U3 substrates clearly differentiated between the two enzymes because each IN was much more active on its cognate U3 substrate (Fig. 4, lower panel, lanes 610 and 1620). Moreover, each enzyme performed DNA joining on all four substrates (Fig. 4, upper panel) to the same extent as observed with Mn2+ (not shown), although the efficiency and strand-transfer patterns were dependent on the particular combination of enzyme and substrate, as observed previously (Katzman & Sudol, 1995 ). As noted above, the patterns of joined products, which reflect the preferential selection of target sites for insertion, also differed as a function of the divalent cation (data not shown). Because the enzymes exhibited markedly different processing efficiencies on the two U3 substrates, manipulation of these sequences offered a way to identify the viral DNA positions that are recognized by IN.



(104K):

Fig. 4. Mg2+-dependent activity of HIV-1 and visna virus INs on substrates from either DNA end of both viruses. The upper panel is a longer autoradiographic exposure of the upper part of a denaturing polyacrylamide gel and the lower panel is a shorter exposure of the lower part of the same gel (both panels include the 18-mer substrates). Each set of five lanes with the indicated substrates includes a negative control reaction incubated with protein buffer (-) and duplicate reactions with HIV-1 IN (H) or visna virus IN (V). Reactions with HIV-1 IN were conducted with 7·5 mM Mg2+ and 30% DMSO and those for visna virus IN or the control buffer had 10 mM Mg2+ and 35% DMSO. The positions of the 18-mer substrates and 16-mer products are indicated for the outer sets of reactions; note that the migration of the various oligonucleotides differs slightly as a function of sequence.

Positions 5 and 6 in U3 substrates act as recognition signals for both INs
Despite the different activities of each enzyme on the two U3 substrates, the U3 sequences differ at only two of their final nine base pairs, i.e. positions 5 and 6 (Figs 1A and 5C). Thus, we tested whether exchanging positions 5 and 6 in the U3 substrates would alter their susceptibility under optimal Mg2+-dependent conditions. The results showed that reciprocal exchange of these two base pairs switched the susceptibility of the substrates. For example, an HIV-1 U3 substrate in which positions 5 and 6 were substituted by the base pairs at positions 5 and 6 from the visna virus U3 end (and designated HIV-1 U3s5,6, where s indicates an exchange substitution) acted identically to the visna virus U3 substrate in processing assays (Fig. 5A, compare lanes 1115 with lanes 610). Similarly, a visna virus U3 substrate with positions 5 and 6 substituted by the corresponding base pairs from HIV-1 U3 (and designated visna U3s5,6) acted identically to the HIV-1 U3 substrate (Fig. 5A, compare lanes 1620 with lanes 15). Each enzyme also catalysed DNA joining with the double-substituted substrates (Fig. 5A, upper parts of lanes). Furthermore, the relative amounts of strand-transfer products (but not the patterns) were similar for substrates that match at the final nine positions. Substrate sequences and quantitative results of multiple reactions performed at various times are summarized in Fig. 5(C). The graphic display also demonstrates that the patterns of relative susceptibility to the two integrases were similar for substrates that share the final nine positions, i.e. HIV-1 U3 and visna U3s5,6 (the first and fourth entries in Fig. 5C) and visna U3 and HIV-1 U3s5,6 (the second and third entries in Fig. 5C).



(81K):

Fig. 5. Effects of U3 base substitutions. (A, B) Autoradiograms of denaturing polyacrylamide gels are shown for IN assays using the indicated substrates. Details are as in the legend to Fig. 4. (C) Quantification of results from multiple experiments. Sequences and numbering of substrates, as described in the text, are shown for the strand that contains the CA dinucleotide (shown in boldface). Upper-case letters indicate wild-type sequence or exchange substitutions, lower-case letters are used for other mutations, and dashes denote identity to the base in the HIV-1 U3 sequence. Specific cleavage measured in replicate experiments is shown as the mean±standard error (error bar); each reaction was conducted an average of seven times.

The above data demonstrate that positions 5 and 6 act as recognition signals for HIV-1 and visna virus integrases in the context of the U3 termini when Mg2+ serves as the cofactor, much as they were previously shown to function in the presence of Mn2+ (Katzman & Sudol, 1996 ). These data also suggest that only the last nine base pairs specifically interact with IN. However, positions 11 and 14 of the two wild-type U3 sequences are the same (Figs 1A and 5C) and may have contributed to the susceptibility of the various substrates to the enzymes. To exclude a sequence-specific role for the latter two positions, we mutated them in the context of the HIV U3s5,6 sequence (designated HIV U3s5,6,m11,14, where m indicates a mutation rather than exchange substitution). This substrate was processed similarly to the visna U3 and the HIV U3s5,6 substrates when tested against the two integrases in the presence of Mg2+ (the last entry in Fig. 5C). Thus, positions 11 and 14 did not interact with these enzymes in a sequence-specific manner. We conclude from the data of Fig. 5, combined with the observation that the wild-type U3 substrates differ at positions 10, 12, 13 and 1518, that all of the specific U3 information necessary for Mg2+-dependent processing by either enzyme is contained in the last nine base pairs of the substrate. Furthermore, positions 5 and 6 are particularly important for recognition.

Positions 5 and 6 in U3 substrates are recognized differently by the two INs
To ascertain whether positions 5 and 6 played equal roles in Mg2+-dependent recognition and cleavage by IN, these positions were independently exchanged between the HIV-1 and visna virus U3 substrates. The results of testing these substrates revealed that visna virus IN was more sensitive to changes in position 5, immediately adjacent to the invariant CA bases, whereas HIV-1 IN was more sensitive to changes in position 6. Thus, a substrate in which position 5 in the visna virus U3 substrate was substituted by the corresponding HIV-1 U3 base pair (designated visna U3s5) was processed significantly less efficiently by visna virus IN, and a substrate in which position 6 was substituted (designated visna U3s6) remained highly susceptible to this enzyme (Fig. 5B, lanes 14/15 and 19/20 compared with Fig. 5A, lanes 9/10). In contrast, the analogous HIV-1 U3s5 was not as hindered for susceptibility to HIV-1 IN as was the HIV-1 U3s6 substrate (Fig. 5B, lanes 2/3 and 7/8 compared with Fig. 5A, lanes 2/3; the differences are more evident when quantified and presented as in Fig. 5C, as discussed below). Note that the HIV-1 U3s5 and visna U3s6 substrates share the final nine positions and acted similarly in these assays (Fig. 5B, lanes 15 and 1620). Similarly, HIV-1 U3s6 and visna U3s5 share their final nine positions and exhibited the same pattern of susceptibility to the two enzymes (Fig. 5B, lanes 610 and 1115). The amounts (but not the patterns) of strand-transfer products were similar for substrates that matched at the final nine positions also (Fig. 5B, upper parts of lanes). The sequences of the singly substituted DNA substrates and quantification of multiple replicate reactions performed on different days are shown in Fig. 5C. This presentation highlights that the patterns of relative susceptibility to the two integrases are similar for HIV-1 U3s5 and visna U3s6 (the fifth and eighth entries in the figure), as well as for HIV-1 U3s6 and visna U3s5 (the sixth and seventh entries). Moreover, comparing results for a single enzyme on different substrates clearly demonstrates that visna virus IN was more dependent on position 5 than position 6 (compare its activity on visna U3, visna U3s5, and visna U3s6), whereas HIV-1 IN interacted more critically with position 6 (compare its activity on HIV-1 U3, HIV-1 U3s5, and HIV-1 U3s6). These results are identical to those obtained with Mn2+ as the divalent cation (Katzman & Sudol, 1996 ).

Substitutions in U5 substrates
The above results reveal the importance of the final nine positions at the viral DNA U3 terminus for Mg2+-dependent functional interactions with IN. To assess the importance of the final nine positions in the context of the U5 terminus when Mg2+ serves as the cofactor, we tested an HIV-1 U5-derived oligonucleotide substrate in which positions 1018 were mutated to base pairs found at none of the terminal DNA sequences from either virus (as shown in Fig. 1A). We found that this substrate (designated HIV-1 U5m1018), as was the wild-type HIV-1 U5 sequence, was highly susceptible to both integrases (Fig. 6A). We then used a substrate in which every position but the final six was mutated (designated HIV-1 U5m718). This substrate also was susceptible to both integrases (Fig. 6B). Thus, as was observed with Mn2+ (Katzman & Sudol, 1996 ), the final six base pairs contain sufficient information for specific processing by either IN. Nonetheless, the latter substrate was less susceptible than the wild-type sequence (compare Fig. 6B with Fig. 4, lanes 15, lower panel) and the susceptibility to visna virus IN was affected to a greater extent. Although these observations also were true for reactions conducted with Mn2+ (Katzman & Sudol, 1996 ), the difference for visna virus IN was greater with Mg2+. The sequences of the substrates and the results of multiple replicate reactions are summarized in Fig. 6(C).



(38K):

Fig. 6. Effects of U5 base substitutions. (A, B) Autoradiograms of denaturing polyacrylamide gels are shown for IN assays using the indicated substrates. Similar reactions for the wild-type HIV-1 U5 sequence (as in Fig. 4) are not shown. Details are as in the legend to Fig. 4. (C) Quantification of results from multiple experiments. Sequences of substrates are shown relative to the HIV-1 U5 sequence; details are as in the legend to Fig. 5(C). Specific cleavage measured in replicate experiments is shown as the mean±standard error (error bar); each reaction was conducted an average of nine times.
Understanding how IN recognizes its DNA substrates is important for modelling retroviral integration and for suggesting new targets for antiretroviral therapy. Most published studies of specific recognition of the viral DNA termini by HIV-1 IN used Mn2+ as the divalent cation for the simple reason that many preparations of HIV-1 IN have little or no activity with Mg2+ when assayed under standard reaction conditions. However, Mg2+ is more abundant within cells and may be the relevant divalent cation in vivo. In addition, Mg2+ supports integration activity by preintegration complexes extracted from cells infected with HIV-1 (Farnet & Haseltine, 1990 ; Ellison et al., 1990 ) or murine leukaemia virus (Brown et al., 1987 ; Fujiwara & Mizuuchi, 1988 ). Moreover, Mn2+ can relax or alter the specificity of restriction endonucleases (Hsu & Berg, 1978 ; Vermote & Halford, 1992 ). These facts could raise questions about the biological relevance of much of the published data that have defined functional interactions between IN and particular positions at the ends of viral DNA. This report should allay many of these concerns. Our new data obtained with Mg2+ as the divalent cation confirm the key results previously demonstrated with Mn2+, i.e. two base pairs just internal to the invariant CA bases near the ends of viral DNA act as specific recognition signals for two different lentiviral integrases.

Recently, several groups identified conditions under which HIV-1 IN has enhanced activity with Mg2+. In addition to DMSO, factors reported to increase the Mg2+-dependent activity of HIV-1 IN include: use of longer oligonucleotide substrates (Engelman & Craigie, 1995 ; Lee et al., 1995a , b ), high enzyme:substrate ratios (Engelman & Craigie, 1995 ; Esposito & Craigie, 1998 ), or the presence of PEG (Engelman & Craigie, 1995 ), zinc (Zheng et al., 1996 ; Lee & Han, 1996 ; Lee et al., 1997 ), dioxane (Goodarzi et al., 1995 ), or the HIV-1 nucleocapsid protein (Carteau et al., 1997 ). Our results indicate that these conditions may not be uniformly effective for revealing activity by different integrases or enzyme preparations with Mg2+. Although we confirmed that longer substrates enhance the Mg2+-dependent activity of HIV-1 IN, a similar effect was not observed for visna virus IN (Fig. 3). We also were unable to stimulate the Mg2+-dependent activity of our HIV-1 or visna virus enzyme preparations with PEG or Zn2+ and found that these reagents inhibited activity in some reactions. Others have presented evidence that PEG can inhibit activity with Mn2+ (Engelman & Craigie, 1995 ; Lee & Han, 1996 ) and that Zn2+ inhibits the DNA joining activity of HIV-1 IN (Wolfe et al., 1996 ) and a nicking activity of avian sarcoma virus IN (Bujacz et al., 1997 ). In contrast, the organic solvent DMSO dramatically stimulated the Mg2+-dependent processing and joining activity of both of our enzymes. In fact, 3040% DMSO supported activity with Mg2+ comparable to what is typically obtained with Mn2+ (Fig. 2). These data represent the first demonstration that Mg2+ can support activity by visna virus IN, a protein that has proven useful for constructing chimeric enzymes with HIV-1 IN (Katzman & Sudol, 1995 , 1998 ). Others have noted that 1020% DMSO can slightly enhance the Mg2+-dependent processing activity of HIV-1 IN (Engelman & Craigie, 1995 ; Lee & Han, 1996 ) and feline immunodeficiency virus IN (Shibagaki et al., 1997 ). Interestingly, the HIV-1 IN preparation used by Esposito & Craigie (1998) readily exhibited Mg2+-dependent processing with only 5% DMSO (along with 5% PEG). DMSO has also been reported to stimulate the Mg2+-dependent integration activity of HIV-1 IN (Goodarzi et al., 1995 ; Miller et al., 1995 ), avian myeloblastosis virus IN (Fitzgerald et al., 1992 ; Vora & Grandgenett, 1995 ) and murine leukaemia virus IN (Fujiwara & Craigie, 1989 ).

How DMSO (or any of the other manoeuvres) promotes IN activity with Mg2+ is unknown. DMSO can affect protein secondary structure by two possible mechanisms (Jackson & Mantsch, 1991 ; Huang et al., 1995 ). When DMSO replaces solvent water molecules, the proteins environment becomes less polar and hydrophobic interactions between nonpolar amino acid residues may be weakened. In addition, DMSOIN interactions may replace hydrogen bonds at the protein surface or within interior cavities. Resulting effects on protein conformation may influence metal coordination by the enzymes active site residues (Maignan et al., 1998 ; Goldgur et al., 1998 ) or the stability of INsubstrate interactions in the presence of Mg2+ (Pemberton et al., 1996 ). Whatever the mechanism, it is significant that IN retains high specificity for the processing site near viral DNA ends in reactions conducted with DMSO and Mg2+ (Fig. 2). The true biological relevance of various reaction conditions is unclear because the environment in which IN operates within the cell is poorly defined. For example, the dilute aqueous reaction conditions typically used in vitro are unlikely to mimic intracellular conditions (Fulton, 1982 ; Zimmerman & Minton, 1993 ; Knull & Minton, 1996 ). Although we do not claim that the presence of 3040% DMSO is physiological, it is noteworthy that proteins may constitute a similar percentage of the weight of the cytoplasm in some cells (Fulton, 1982 ). Given the complexity of the intracellular milieu, the effects of molecular crowding on IN function deserve further study (Zimmerman & Minton, 1993 ; Minton, 1998 ). Nonetheless, the important point is that conditions were identified that provided a useful and productive means to investigate the role of subterminal viral DNA nucleotides as specific recognition signals for the HIV-1 and visna virus integrases in the presence of Mg2+. The data demonstrate that this particular parameter (i.e. the choice of divalent cation) does not affect recognition of certain key elements of the viral DNA substrate.

A major result from these experiments is that exchange of positions 5 and 6 between U3 substrates switched the patterns of susceptibility to two lentiviral integrases (Fig. 5). Positions 5 and 6 were also important for Mg2+-dependent oligonucleotide processing by avian retroviral IN (Katzman et al., 1989 ; Cobrinik et al., 1991 ). Thus, interaction with these positions may be a general feature of retroviral integrases. However, integrases can differ with respect to the importance of these positions, as HIV-1 IN was more sensitive to substitution of U3 position 6 and visna virus IN was more dependent on position 5. These results complement those of Esposito & Craigie (1998) , who found that the two base pairs just internal to the conserved CA bases play an important role in processing of U5 substrates by HIV-1 IN, that this effect was independent of the choice of divalent cation, and that position 6 had a greater influence on susceptibility to HIV-1 IN. Thus, IN likely interacts with positions 5 and 6 at both viral DNA termini in a similar fashion. Of note, Esposito & Craigie (1998) found that positions approximately one turn along the DNA helix from the conserved CA also affected susceptibility, but only when Mg2+ was the divalent cation. Their results from an in vitro selection assay and photocross-linking studies also suggested roles for these more-internal positions only when Mg2+ was present. Our data also suggest that positions 718 of viral DNA can influence the activity of IN, an effect that was greatest for visna virus IN with Mg2+ (Fig. 6) compared with Mn2+ (Katzman & Sudol, 1996 ). One difference between our results is that Esposito & Craigie found a large effect on Mg2+-dependent processing when HIV-1 U5 position 12 or 13 (using our numbering) was substituted, whereas we found only minor effects when these positions, along with several others, were simultaneously replaced in the HIV U5m1018 substrate (Fig. 6). This result suggests that other positions within this region can compensate for any effects on susceptibility to IN. It is not surprising that positions outside the terminal six base pairs can affect the extent of the reaction because at least 15 base pairs of substrate DNA are needed for optimal IN activity (Katzman et al., 1989 ; LaFemina et al., 1991 ; Sherman et al., 1992 ). Nonetheless, the final six U5 base pairs of viral DNA contain sufficient sequence information for specific recognition and cleavage in reactions conducted with Mg2+ (Fig. 6), Mn2+ (Katzman & Sudol, 1996 ) or both Mg2+ and Mn2+ (Sherman et al., 1992 ).

In contrast to the above findings, the choice of divalent cation appears to have a larger effect on interactions with the target for viral DNA insertion. Thus, the patterns of joined products for a given enzyme, donor DNA and target DNA sequence differed as a function of the metal (Fig. 2). The data of other groups also demonstrate that the strand-transfer patterns created by HIV-1 IN depend on whether Mg2+ or Mn2+ serves as the cofactor (Engelman & Craigie, 1995 ; Lee et al., 1995b ; Lee & Han, 1996 ); a similar result occurred with feline immunodeficiency virus IN (Shibagaki et al., 1997 ). Moreover, when we used a PCR-based assay to monitor insertion of processed viral DNA ends into a plasmid DNA target, the insertion patterns created by HIV-1 IN and visna virus IN differed for reactions conducted with Mn2+ compared with those conducted with Mg2+ (data not shown). That the nature of the divalent cation differentially affects interactions with viral DNA and host DNA suggests that IN has different binding sites for these substrates.

The most important finding in this study is that the role of subterminal viral DNA positions in recognition by the integrases of HIV-1 and visna virus was confirmed when Mg2+ substituted for Mn2+ during in vitro reactions. Thus, the choice of divalent cation is not critical for interactions between IN and positions close to the conserved CA bases at the viral DNA termini. The generalizability of our findings is strengthened by the use of substrates that contained single and multiple base substitutions, sequences derived from either end of unintegrated viral DNA, and two different retroviral systems. Thus, the large body of Mn2+-dependent biochemical data identifying terminal viral DNA positions that are important in substrate recognition by various integrases likely describe biologically relevant interactions. The only caveat, as originally suggested by Esposito & Craigie (1998) , is that the role of more-internal viral DNA positions may have been underestimated in reactions conducted with Mn2+. These functional data will permit correlations with structural information when the viral DNA binding site of IN is identified.

This work was supported by W. W. Smith Charitable Trust Research Grants A9701 and A9804 and by the Julius H. Caplan foundation (in honour of Helen Caplan). We thank John W. Wills for review of this manuscript.

References

Asante-Appiah, E. & Skalka, A. M. (1997a). A metal-induced conformational change and activation of HIV-1 integrase. Journal of Biological Chemistry 272, 16196-16205.[Abstract/Free Full Text]

Asante-Appiah, E. & Skalka, A. M. (1997b). Molecular mechanisms in retrovirus DNA integration. Antiviral Research 36(3), 139156.

Balakrishnan, M. & Jonsson, C. B. (1997). Functional identification of nucleotides conferring substrate specificity to retroviral integrase reactions. Journal of Virology 71, 1025-1035.[Abstract]

Brown, P. O. (1997). Integration. In Retroviruses, pp. 161-203. Edited by J. M. Coffin, S. H. Hughes & H. E. Varmus. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Brown, P. O., Bowerman, B., Varmus, H. E. & Bishop, J. M. (1987). Correct integration of retroviral DNA in vitro. Cell 49, 347-356.[Medline]

Bujacz, G., Alexandratos, J., Wlodawer, A., Merkel, G., Andrake, M., Katz, R. A. & Skalka, A. M. (1997). Binding of different divalent cations to the active site of avian sarcoma virus integrase and their effects on enzymatic activity. Journal of Biological Chemistry 272, 18161-18168.[Abstract/Free Full Text]

Bushman, F. D. & Craigie, R. (1991). Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proceedings of the National Academy of Sciences, USA 88, 1339-1343.[Abstract/Free Full Text]

Carteau, S., Batson, S. C., Poljak, L., Mouscadet, J.-F., de Rocquigny, H., Darlix, J.-L., Roques, B. P., Kas, E. & Auclair, C. (1997). Human immunodeficiency virus type 1 nucleocapsid protein specifically stimulates Mg2+-dependent DNA integration in vitro. Journal of Virology 71, 6225-6229.[Abstract]

Cobrinik, D. A., Aiyar, A., Ge, Z., Katzman, M., Huang, H. & Leis, J. (1991). Overlapping retrovirus U5 sequence elements are required for efficient integration and initiation of reverse transcription. Journal of Virology 65, 3864-3872.[Abstract/Free Full Text]

Craigie, R., Fujiwara, T. & Bushman, F. (1990). The IN protein of Moloney murine leukemia virus processes the viral DNA ends and accomplishes their integration in vitro. Cell 62, 829-837.[Medline]

Ellison, V., Abrams, H., Roe, T., Lifson, J. & Brown, P. (1990). Human immunodeficiency virus integration in a cell-free system. Journal of Virology 64, 2711-2715.[Abstract/Free Full Text]

Engelman, A. & Craigie, R. (1995). Efficient magnesium-dependent human immunodeficiency virus type 1 integrase activity. Journal of Virology 69, 5908-5911.[Abstract]

Esposito, D. & Craigie, R. (1998). Sequence specificity of viral end DNA binding by HIV-1 integrase reveals critical regions for proteinDNA interaction. EMBO Journal 17, 5832-5843.[Medline]

Farnet, C. M. & Haseltine, W. A. (1990). Integration of human immunodeficiency virus type 1 DNA in vitro. Proceedings of the National Academy of Sciences, USA 87, 4164-4168.[Abstract/Free Full Text]

Fitzgerald, M. L., Vora, A. C., Zeh, W. G. & Grandgenett, D. P. (1992). Concerted integration of viral DNA termini by purified avian myeloblastosis virus integrase. Journal of Virology 66, 6257-6263.[Abstract/Free Full Text]

Fujiwara, T. & Mizuuchi, K. (1988). Retroviral DNA integration: structure of an integration intermediate. Cell 54, 497-504.[Medline]

Fujiwara, T. & Craigie, R. (1989). Integration of mini-retroviral DNA: a cell-free reaction for biochemical analysis of retroviral integration. Proceedings of the National Academy of Sciences, USA 86, 3065-3069.[Abstract/Free Full Text]

Fulton, A. B. (1982). How crowded is the cytoplasm? Cell 30, 345-347.[Medline]

Goldgur, Y., Dyda, F., Hickman, A. B., Jenkins, T. M., Craigie, R. & Davies, D. R. (1998). Three new structures of the core domain of HIV-1 integrase: an active site that binds magnesium. Proceedings of the National Academy of Sciences, USA 95, 9150-9154.[Abstract/Free Full Text]

Goodarzi, G., Im, G.-J., Brackmann, K. & Grandgenett, D. (1995). Concerted integration of retrovirus-like DNA by human immunodeficiency virus type 1 integrase. Journal of Virology 69, 6090-6097.[Abstract]

Hsu, M. & Berg, P. (1978). Altering the specificity of restriction endonuclease: effect of replacing Mg2+ with Mn2+. Biochemistry 17, 131-138.[Medline]

Huang, P., Dong, A. & Caughey, W. S. (1995). Effects of dimethyl sulfoxide, glycerol, and ethylene glycol on secondary structure of cytochrome c and lysozyme as observed by infrared spectroscopy. Journal of Pharmaceutical Sciences 84, 387-392.[Medline]

Jackson, M. & Mantsch, H. H. (1991). Beware of proteins in DMSO. Biochimica et Biophysica Acta 1078, 231-235.[Medline]

Katz, R. A., Merkel, G., Kulkosky, J., Leis, J. & Skalka, A. M. (1990). The avian retroviral IN protein is both necessary and sufficient for integrative recombination in vitro. Cell 63, 87-95.[Medline]

Katzman, M. & Katz, R. A. (1999). Substrate recognition by retroviral integrases. Advances in Virus Research 52, 371-395.[Medline]

Katzman, M. & Sudol, M. (1994). In vitro activities of purified visna virus integrase. Journal of Virology 68, 3558-3569.[Abstract/Free Full Text]

Katzman, M. & Sudol, M. (1995). Mapping domains of retroviral integrase responsible for viral DNA specificity and target site selection by analysis of chimeras between human immunodeficiency virus type 1 and visna virus integrases. Journal of Virology 69, 5687-5696.[Abstract]

Katzman, M. & Sudol, M. (1996). Influence of subterminal viral DNA nucleotides on differential susceptibility to cleavage by human immunodeficiency virus type 1 and visna virus integrases. Journal of Virology 70, 9069-9073.[Abstract]

Katzman, M. & Sudol, M. (1998). Mapping viral DNA specificity to the central region of integrase by using functional human immunodeficiency virus type 1/visna virus chimeric proteins. Journal of Virology 72, 1744-1753.[Abstract/Free Full Text]

Katzman, M., Katz, R. A., Skalka, A. M. & Leis, J. (1989). The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration. Journal of Virology 63, 5319-5327.[Abstract/Free Full Text]

Knull, H. & Minton, A. P. (1996). Structure within eukaryotic cytoplasm and its relationship to glycolytic metabolism.Cell Biochemistry and Function 14, 237-248.[Medline]

Kukolj, G. & Skalka, A. M. (1995). Enhanced and coordinated processing of synapsed viral DNA ends by retroviral integrases in vitro. Genes & Development 9, 2556-2567.[Abstract/Free Full Text]

LaFemina, R. L., Callahan, P. L. & Cordingly, M. G. (1991). Substrate specificity of recombinant human immunodeficiency virus integrase protein. Journal of Virology 65, 5624-5630.[Abstract/Free Full Text]

Lee, S. P. & Han, M. K. (1996). Zinc stimulates Mg2+-dependent 3'-processing activity of human immunodeficiency virus type 1 integrase in vitro. Biochemistry 35, 3837-3844.[Medline]

Lee, S. P., Kin, H. G., Censullo, M. L. & Han, M. K. (1995a). Characterization of Mg2+-dependent 3'-processing activity for human immunodeficiency virus type 1 integrase in vitro: Real-time kinetic studies using fluorescence resonance energy transfer. Biochemistry 34, 10205-10214.[Medline]

Lee, S. P., Censullo, M. L., Kim, H. G. & Han, M. K. (1995b). Substrate-length-dependent activities of human immunodeficiency virus type 1 integrase in vitro: differential DNA binding affinities associated with different lengths of substrates. Biochemistry 34, 10215-10223.[Medline]

Lee, S. P., Xiao, J., Knutson, J. R., Lewis, M. S. & Han, M. K. (1997). Zn2+ promotes the self-association of human immunodeficiency virus type-1 integrase in vitro. Biochemistry 36, 173-180.[Medline]

Maignan, S., Guilloteau, J.-P., Zhou-Liu, Q., Clément-Mella, C. & Mikol, V. (1998). Crystal structures of the catalytic domain of HIV-1 integrase free and complexed with its metal cofactor: high level of similarity of the active site with other viral integrases. Journal of Molecular Biology 282, 359-368.[Medline]

Miller, M. D., Bor, Y.-C. & Bushman, F. (1995). Target DNA capture by HIV-1 integration complexes. Current Biology 5, 1047-1055.[Medline]

Minton, A. P. (1998). Molecular crowding: analysis of effects of high concentrations of inert cosolutes on biochemical equilibria and rates in terms of volume exclusion. Methods in Enzymology 295, 127-149.[Medline]

Pemberton, I. K., Buckle, M. & Buc, H. (1996). The metal ion-induced cooperative binding of HIV-1 integrase to DNA exhibits a marked preference for Mn(II) rather than Mg(II). Journal of Biological Chemistry 271, 1498-1506.[Abstract/Free Full Text]

Sherman, P. A., Dickson, M. L. & Fyfe, J. A. (1992). Human immunodeficiency virus type 1 integration protein: DNA sequence requirements for cleaving and joining reactions. Journal of Virology 66, 3593-3601.[Abstract/Free Full Text]

Shibagaki, Y., Holmes, M. L., Appa, R. S. & Chow, S. A. (1997). Characterization of feline immunodeficiency virus integrase and analysis of functional domains. Virology 230, 1-10.[Medline]

Vermote, C. L. M. & Halford, S. E. (1992). EcoRV restriction endonuclease: communication between catalytic metal ions and DNA recognition. Biochemistry 31, 6082-6089.[Medline]

Vora, A. C. & Grandgenett, D. P. (1995). Assembly and catalytic properties of retrovirus integrase-DNA complexes capable of efficiently performing concerted integration. Journal of Virology 69, 7483-7488.[Abstract]

Wolfe, A. L., Felock, P. J., Hastings, J. C., Uncapher Blau, C. & Hazuda, D. J. (1996). The role of manganese in promoting multimerization and assembly of human immunodeficiency virus type 1 integrase as a catalytically active complex on immobilized long terminal repeat substrates. Journal of Virology 70, 1424-1432.[Abstract]

Zheng, R., Jenkins, T. M. & Craigie, R. (1996). Zinc folds the N-terminal domain of HIV-1 integrase, promotes multimerization, and enhances catalytic activity. Proceedings of the National Academy of Sciences, USA 93, 13659-13664.[Abstract/Free Full Text]

Zimmerman, S. B. & Minton, A. P. (1993). Macromolecular crowding: biochemical, biophysical, and physiological consequences.Annual Review of Biophysics and Biomolecular Structure 22, 27-65.[Medline]

Received 2 September 1999; accepted 8 November 1999.