Research Article

Homologous and heterologous interference requires bovine herpesvirus-1 glycoprotein D at the cell surface during virus entry

Journal of General Virology 2000; 81(4):1041

PubMed

With thanks to our partners for supporting this archive.

Abstract

Expression of glycoprotein D (gD) of alphaherpesviruses protects cells from superinfection by homologous and heterologous viruses by a mechanism termed interference. We recently showed that MDBK cells expressing bovine herpesvirus (BHV)-1gD (MDBKgD) resist BHV-1, pseudorabies virus (PRV) and herpes simplex virus-1 (HSV-1) but not the more closely related BHV-5 infection as determined by the number of plaques produced. However, the plaque size is reduced in all four viral infections suggesting a block in cell-to-cell transmission. Here, we show that MDBK cells expressing truncated BHV-1 gD, designated MDBKt-gD, secreted soluble gD and were fully susceptible to infection by all the four viruses when the cells were washed prior to infection. When MDBK cells or MDBKt-gD cells were treated with medium containing truncated gD prior to infection, they partially resisted BHV-1, PRV and HSV-1 but not BHV-5. Interestingly, both BHV-1 and BHV-5 formed normal-sized plaques in MDBKt-gD cells suggesting that the viruses were able to spread efficiently. Thus BHV-1 gD is required at the cell surface at the time of infection in order to block BHV-1, HSV-1 and PRV infections, consistent with a common coreceptor for the three gDs.
Alphaherpesvirus entry is complex and involves an initial attachment mediated by viral glycoprotein/s (gB or gC or both) binding to cellular glycosaminoglycans (Spear et al., 1992 ) followed by penetration of the virus by pH-independent fusion of the viral and cellular membranes mediated by at least five viral envelope glycoproteins, gB, gD, gH, gL and gK (reviewed by Spear 1993a , b ). Glycoprotein D (gD) is essential for penetration (Ligas & Johnson, 1988 ; Rauh & Mettenleiter, 1991 ; Fehler et al., 1992 ) and cells expressing gD are resistant to infection by the homologous virus, a phenomenon termed interference (Campadelli-Fiume et al., 1988 ; Johnson & Spear, 1989 ; Chase et al., 1990 ; Chase & Letchworth, 1994 ; Tikoo et al., 1990 ; Petrovskis et al., 1988 ). Interference against heterologous viruses, termed cross-interference, usually suggests a common receptor pathway for entry (Weiss, 1993 ).

Cross-interference between herpes simplex virus (HSV)-1 and pseudorabies virus (PRV) (Petrovskis et al., 1988 ) and between bovine herpesvirus (BHV)-1 and HSV-1 (Chase et al., 1990 , 1993 ; Tikoo et al., 1990 ) supports the common receptor hypothesis. The observation that the truncated (soluble) gDs of HSV-1 and BHV-1 bind a limited number of cell membrane sites (4x1051x106 per cell) with comparable affinities (Kd10-7 M) and partially block homologous infections (Johnson et al., 1990 ; Li et al., 1995 ) is consistent with the hypothesis but it is not known if HSV-1 and BHV-1 gDs bind the same site(s) on MDBK cells. Recent identification of several human cellular coreceptors for gD (HveA, B, C, D and HIgR), only some of which serve as common receptors for specific alphaherpesviruses, provides further support to the common receptor hypothesis (Montgomery et al., 1996 ; Whitbeck et al., 1997 ; Geraghty et al., 1998 ; Warner et al., 1998 ; Krummenacher et al., 1998 ; Cocchi et al., 1998 ) but it is not known if their animal homologues exist and serve as receptors for HSV. However, certain observations are difficult to explain using the common receptor hypothesis. Firstly, bovine cells expressing BHV-1 gD are resistant to BHV-1, HSV-1 and PRV but cells expressing PRV gD are fully permissive to BHV-1 infection (Chase et al., 1993 ). Second, several other candidate receptors for HSV-1 gD identified earlier (Brunetti et al., 1994 , 1995 ; Huang & Campadelli-Fiume, 1996 ) may be different from the putative BHV-1 gD receptor identified on MDBK cells (Thaker et al., 1994 ). However, the exact role of these proteins in infection remains unclear. Thirdly, viruses selected for their ability to grow on gD-expressing cells may carry wild-type gDs (Dean et al., 1995 ; G. K. Dasika & G. J. Letchworth, unpublished results). Additionally, mutations in gD of some interference-resistant viruses may not be sufficient for the unrestricted phenotype (Brandimarti et al., 1994 ), suggesting that other viral proteins may also participate in gD-mediated interference. Lastly, a point mutation in HSV-1 gD (L25 to P25) enabled mutant HSV-1 to infect cells expressing wild-type HSV-1 gD, but the mutant protein expressed in cells was unable to interfere with wild-type or mutant HSV-1 infection (Campadelli-Fiume et al., 1990 ). This led the authors to propose an alternative mechanism involving unfavourable interaction between cellular gD and viral gD (or another viral protein) resulting in interference (Campadelli-Fiume et al., 1990 ; Dean et al., 1994 ). Recent evidence suggests that an L25 to P25 mutation in gD precludes the use of HveA but the mutant virus utilizes HveC, a coreceptor for HSV-2, BHV-1 and PRV (Geraghty et al., 1998 ).

The alphaherpesvirus BHV-1 infects cattle worldwide and causes a variety of clinical syndromes (Yates, 1982 ; Ludwig, 1983 ). On the basis of apparently different clinical manifestations, BHV-1 isolates were classified into respiratory (BHV-1.1), genital (BHV-1.2) and encephalitic (BHV-1.3) subtypes (Engels et al., 1986 ). The neurovirulent virus (BHV-1.3) was reclassified as a separate type, BHV-5 (Roizman et al., 1992 ), based on the distinct restriction digest profiles of the genomes although BHV-1.1 and BHV-5 DNAs are 85% hybridizable (Engels et al., 1986 ). The BHV-5 gD protein shares 86% amino acid identity with BHV-1 gD (Tikoo et al., 1990 ; Abdelmagid et al., 1995 ).

We recently showed that full-length BHV-1.1 gD (referred to as BHV-1 gD here) interfered with infection by the distantly related viruses HSV-1 and PRV, but not with the closely related BHV-5, as determined by the number of plaques produced (Dasika & Letchworth, 1999 ). However, full-length BHV-1 gD expressed in MDBK cells inhibited cell-to-cell transmission of both BHV-1 and BHV-5 (Dasika & Letchworth, 1999 ). Since the exact mechanism of gD-mediated interference has not yet been fully elucidated and both truncated (soluble) (Johnson et al., 1990 ; Li et al., 1995 ; Nicola et al., 1996 ) and full-length gDs (Campadelli-Fiume et al., 1988 ; Chase et al., 1990 ; Dasika & Letchworth, 1999 ; Fehler et al., 1992 ; Johnson & Spear, 1989 ; Petrovskis et al., 1988 ; Tikoo et al., 1990 ) have been shown separately to interfere with infection by the homologous virus, we hypothesized that if truncated gD interferes with virus infection by a process analogous to full-length gD, truncated BHV-1 gD should block BHV-1, HSV-1 and PRV but not BHV-5 infections. Our results showed the hypothesis to be correct.

Cells and viruses.
All the cell lines and viruses used in this study have been described previously (Dasika & Letchworth, 1999 ) except MDBKt-gD and MDBKt-control (described below). Growth medium for MDBKgD, MDBKt-gD and MDBKt-control cells was supplemented with G418 (200 µg/ml, GIBCO-BRL) and replaced with serum-free medium (GIBCO-BRL) at the times indicated prior to collection of the supernatant. MDBKgD cells express full-length BHV-1 gD (Dasika & Letchworth, 1999 ) and MDBKt-gD cells express truncated BHV-1 gD.

Construction of expression plasmids for transfection.
The plasmids p-gDt and p-controlt were constructed as follows (Fig. 1). To construct p-gDt, an opal codon was inserted into the BHV-1 gD open reading frame (ORF) (Tikoo et al., 1990 ) at position 1077 by PCR amplification with a mutagenic 3' oligonucleotide primer 1161R*gD (5' GCCGAGCTCAGTCGGGGGCCGCGGGCGTA 3') and a wild-type 5' primer (72FgD) including the start codon (5' CGAGCGGGCGAACATGCAAGG 3'). Amplification was done in a programmable tempcycler (model 50 Tempcycler, Coy Laboratory Prod. Inc.) with an initial denaturation at 95 °C for 5 min, followed by 30 cycles through 95 °C for 1 min, 60 °C for 1 min, 72 °C for 1·5 min and terminated by a final extension step at 72 °C for 10 min. The PCR product was purified with the Geneclean II kit (Bio 101), after isolation of the 1098 bp band from low melting temperature gel electrophoresis (Sea Plaque GTG Agarose, FMC Bioproducts) and cloned into PCRII (Invitrogen) to create the plasmid p-TAgDt. The truncated gD gene with EcoRI ends was then transferred to pcDNA3 (Invitrogen) to create the plasmid p-gDt, such that gDt had a CMV promoter upstream and BGH poly(A) signals downstream from the gene. To construct the plasmid p-controlt, the plasmid p-TAgDt was digested with SalI and religated thereby releasing a 786 bp fragment from the gDt ORF. Truncated gD with a SalI deletion was then transferred to pcDNA3 in the opposite orientation.



(32K):

Fig. 1. Construction of expression plasmids used for transfection. To construct the truncated gD expression plasmid, DNA encoding the ectodomain domain of BHV-1 gD was PCR amplified using primers 72FgD and 1161R*gD. The amplified product was purified and ligated into PCRII plasmid (Invitrogen) to generate PCR.gDt. The t-gD ORF contained in a 1·1 kb EcoRI fragment was then transferred into pcDNA3 plasmid to yield pcDNA3-gDt. To construct the control plasmid, PCR.gDt was digested with SalI and religated releasing a 786 bp SalI fragment from the t-gD ORF. Truncated gD ORF with an internal SalI deletion was then transferred to pcDNA3 in the opposite orientation to create the control plasmid designated pcDNA3-control.

Construction of cell lines.
The plasmids p-gDt and p-controlt (Fig. 1) were transfected into subconfluent MDBK cells using Lipofectin (GIBCO-BRL) and selected for G418 resistance as described previously (Dasika & Letchworth, 1999 ). G418-resistant clones were tested for truncated gD (t-gD) expression in the supernatants using immunodot blots and Western blots using polyclonal (a kind gift from X. Zhu) and monoclonal antibodies (Marshall et al., 1986 ) against BHV-1 gD. Affinity purified BHV-1 gD (Zhu & Letchworth, 1996 ) was used as the positive control in immunodot blots. One representative clonal line that expressed t-gD was designated MDBKt-gD and a negative control line (MDBKt-control) that was transfected with the plasmid p-controlt and selected for G418 resistance was used in these studies.

SDSPAGE and Western blot analysis.
Immunodot blots were performed as an initial screen to pick t-gD-expressing and control non-expressing clones. None of the clones that resulted from p-control transfection expressed t-gD. G418-resistant clones were grown to confluency in 24-well plates (Costar); the cells were then washed with MEM and the medium replaced with 1 ml serum-free MEM. An aliquot (200 µl) from the supernatant was made to bind to nitrocellulose through negative pressure and screened for the presence of gD using polyclonal or monoclonal anti-BHV-1 gD MAb (3402) as described for Western blots (Dasika & Letchworth, 1999 ).

Estimation of truncated BHV-1 gD concentration.
In order to estimate the concentration of gD in the supernatant, serum-free supernatant (10 ml) from 75 cm2 flasks was collected after 24 h and 25 µl of serial twofold dilutions was separated by SDSPAGE on an 8% gel and stained with Coomassie blue (see Fig. 3). Undiluted control supernatant (25 µl) was also run on a similar gel alongside. Serial dilutions of BSA run on a similar gel and stained with Coomassie blue (data not shown) was used as a standard for visual comparison and estimation of the concentration of t-gD.



(39K):

Fig. 3. Estimation of truncated gD concentration in the supernatant. The concentration of t-gD in the supernatant was estimated by visual comparison of Coomassie blue-stained gels of serial twofold dilutions of serum-free t-gD supernatants and a similarly stained gel containing known amounts of BSA used as a standard (not shown). Undiluted supernatant from MDBKt-control cells electrophoresed and stained similarly is also shown (right).

Blocking assay with truncated BHV-1 gD.
The blocking assay was similar to that developed by Johnson et al. (1990) with minor modifications. Briefly, MDBK or MDBKt-gD cells grown overnight in 24-well plates (1x105 cells per well) were rinsed twice with MEM and treated with 500 µl of supernatant containing truncated gD (200 µg) or control supernatant for 1 h at 4 °C. Approximately 100 p.f.u. of each virus was added in duplicates on cells (MDBK or MDBKt-gD) and incubated for an additional hour at 4 °C. Supernatant containing the unbound proteins and virus was removed and the cells were overlaid with MEM containing agarose (medium EEO, Sigma) as described previously (Dasika & Letchworth, 1999 ). Three days after infection, the cells were fixed, stained and the plaques were counted. The number of plaques in control treated cells was normalized to 100 and means and standard deviations were calculated.

Effect of truncated gD on plaque size.
Approximately 100 p.f.u. of each virus (BHV-1, BHV-5, PRV and HSV-1) was used to infect confluent MDBKt-gD or MDBK (control) monolayers in a 24-well plate in duplicates after rinsing the cells with MEM twice. After incubating at 37 °C for 1 h the cells were washed with MEM and overlaid with MEM containing 0·5% agarose (Fisher Scientific) supplemented with 5% FBS, and then placed in an incubator at 37 °C with 5% CO2. Monolayers were fixed with 10% formaldehyde 3 days after infection and stained with crystal violet. The diameters of 3740 random isolated plaques from each virus-infected monolayer were measured under a microscope (Olympus 10x magnification) using an ocular micrometer, and the mean and standard deviations were calculated.

MDBKt-gD cells secreted truncated BHV-1 gD
Immunodot blot assay revealed BHV-1 gD expression in several of the clones transfected with plasmid p-gDt, but not in supernatant from MDBKt-control cells (data not shown). The level of t-gD expression varied among different clones and a positive clone (clone 1.2) that expressed high levels was chosen and analysed further. Western blot analysis of the supernatant from MDBKt-gD demonstrated the presence of t-gD that migrated faster (at 64 kDa) than full-length BHV-1 gD from MDBKgD cells (Dasika & Letchworth, 1999 ) used as control (Fig. 2). At least one of the two additional bands, at 140 kDa, is probably a homodimer of gD since it reacted with MAb 3402. As expected, the control supernatant did not contain truncated BHV-1 gD.



(60K):

Fig. 2. Cells expressing truncated gD secrete soluble gD. Western blot demonstrating the secretion of soluble truncated gD from MDBKt-gD cells. Supernatants from MDBKt-gD, MDBKt-control cells and MDBKgD cell lysate were resolved on an 8% gel (SDSPAGE) and transferred to nitrocellulose membrane. The membrane was probed with BHV-1 gD-specific MAb 3402 as described in Methods.

The concentration of t-gD (mol. mass64 kDa) in supernatant from MDBKt-gD was estimated to be 100120 µg/ml (Fig. 3, see Methods). The 64 kDa band was absent in control supernatant although two other protein bands at 100 kDa and 120 kDa were present. The concentration of t-gD in the same supernatant could be increased to about 450500 µg/ml by collecting the supernatant after 34 days. If the supernatant was not replaced with fresh medium, the cells showed cytotoxic effects after 56 days as evidenced by vacuolation, rounding off and detaching from the surface similar to MDBKgD cells upon induction (Dasika & Letchworth, 1999 ). Such an effect was not seen in MDBKt-control cells and replacing the medium from MDBKt-gD cells restored the cells to normal, suggesting that accumulation of gD caused the toxic effects.

Truncated BHV-1 gD blocked BHV-1, HSV-1 and PRV but not BHV-5 infection
Supernatant containing about 200 µg of gD was sufficient to partially block infection with BHV-1 (Fig. 4a) suggesting that t-gD was functional in a blocking assay. A similar effect was not seen with 200 µg of BSA and truncated gD did not inhibit vesicular stomatitis virus (VSV) infection (not shown). Additionally, supernatant containing truncated BHV-1 gD specifically inhibited BHV-1, HSV-1 and PRV plaques (60%). There was no apparent reduction in BHV-5 plaque numbers, consistent with the results obtained with MDBK cells expressing full-length BHV-1 gD (Dasika & Letchworth, 1999 ).



(14K):

Fig. 4. Truncated gD blocks specific herpesviral infections and is required at the cell membrane. (a) Inhibition of specific herpesviral infections by truncated gD. Incubation of MDBK cells with truncated gD-containing medium but not control medium inhibited plaque formation by HSV-1, PRV and BHV-1 as evidenced by the reduction in plaque numbers. No inhibitory effect was evident upon BHV-5 infection. The plaque numbers from control medium-treated duplicate cultures were normalized to 100 and the relative number of plaques in t-gD-treated cultures is shown. (b) Prior incubation of MDBKt-gD cells with t-gD medium restores interference. Incubation of MDBKt-gD cells with truncated gD-containing medium but not control medium inhibited plaque formation by HSV-1, PRV and BHV-1 as evidenced by the reduction in plaque numbers. No inhibitory effect was evident upon BHV-5 infection. The plaque numbers from duplicate cultures treated with control medium were normalized to 100 and the relative number of plaques in t-gD treated cultures is shown.

MDBKt-gD cells support herpesvirus replication and form normal-sized plaques
Since MDBK cells that expressed full-length BHV-1 gD were partially resistant to BHV-1 infection and formed tiny plaques on infection with BHV-1 or BHV-5 (Dasika & Letchworth, 1999 ), we tested if MDBKt-gD cells were resistant to superinfection and compared the plaque sizes of BHV-1 and BHV-5 on MDBKt-gD and MDBK cells. We also wished to rule out the possibility that MDBKt-gD cells were inherently resistant to specific herpesviral infections by some unknown mechanism. When the cells were washed and infected with the herpesviruses used in this study without prior incubation with t-gD-containing supernatant, the number of plaques in MDBKt-gD cells and MDBK cells was approximately the same, suggesting that MDBKt-gD cells were not resistant to superinfection and that sufficient t-gD was not retained on the cell membrane of MDBKt-gD cells after washing with MEM. Infection of MDBKt-gD cells in the presence of t-gD-containing, but not control, supernatant resulted in a 4055% reduction (P<0·01) in plaque numbers of BHV-1, PRV and HSV-1 but not BHV-5 (Fig. 4b).

Since MDBKt-gD cells were continuously producing t-gD, we tested if cell-to-cell transmission of BHV-1 or BHV-5 was affected in these cells by measuring the sizes of plaques of BHV-1 and BHV-5 on MDBKt-gD cells and control MDBK cells. The plaque sizes were virtually identical in both the cell types with either virus (data not shown), suggesting that there was no significant inhibition of cell-to-cell transmission.

Since truncated gD from HSV-1 or BHV-1 blocks superinfection by the homologous virus (Ligas & Johnson, 1988 ; Li et al., 1995 ), we attempted to confirm this and extend it to heterologous viruses. Cell culture supernatant containing about 200 µg of gD was sufficient to partially block plaque formation by BHV-1 (Fig. 4a). A similar effect was not seen with 200 µg/ml of BSA nor did a similar concentration of truncated gD inhibit VSV infection (data not shown). Additionally, supernatant containing about 200 µg of t-gD specifically inhibited the formation of BHV-1, HSV-1 and PRV plaques (P<0·001) (60%) but had no apparent effect on BHV-5. This is consistent with our results obtained with MDBK cells expressing full-length BHV-1 gD (Dasika & Letchworth, 1999 ), indirectly suggesting that BHV-5 may utilize alternative gD coreceptors for entry in MDBK cells. The reduced level of inhibition of specific herpesviral infections by truncated gD when compared to that of full-length gD may at least in part be due to a possible monomeric interaction of the former with cellular receptor(s) as opposed to a multimeric interaction of the latter.

The interference function required gD to be on the cell surface at the time of infection. Since MDBKt-gD and MDBKgD were constructed from the same parent cells and since both these cell lines express different forms of the same gD and the former unlike the latter are fully susceptible to infection, we conclude that truncation of gD resulted in loss of the interference function. Since pre-incubation of the susceptible MDBKt-gD cells with gD-containing medium partially restored the ability to resist infection (Fig. 4b), it appears that retention of gD in/on the cells may be a prerequisite for interference. Studies with truncated HSV-1 gD demonstrated that incubation of HSV-1 with t-gD does not reduce the infectivity of the virus (Johnson et al., 1990 ). Taken together, it appears that gD acts at the cell membrane possibly blocking a receptor at the time of infection to mediate a block. If the blocking function of gD is same as the interference function, these data suggest that the carboxyl 58 amino acids of gD may not be absolutely required (Fig. 4a). Truncated gD was able to block herpesviral infections only to about 40% of the controls in MDBKt-gD cells when compared to 60% in MDBK cells. This is consistent with the speculation that gD receptors in MDBKt-gD may be slightly upregulated but the exact reason is unknown. Additionally, MDBKt-gD cells formed normal-size plaques, suggesting that there was no apparent block in cell-to-cell transmission. This is in contrast to our results with MDBKgD cells, which formed tiny plaques when infected with BHV-1 as well as BHV-5 (Dasika & Letchworth, 1999 ). Several factors could have contributed to this result. The transmembrane (TM) and/or cytoplasmic (cyt) domain of gD may be required to inhibit cell-to-cell transmission. Since the m.o.i. was <0·01 and the cells neighbouring a particular infected cell would have continued to produce truncated gD even if host-cell protein synthesis was shut off in infected cells, and since the level of truncated gD was much higher than that of full-length gD in MDBKgD cells (Fig. 2 and data not shown), it can be speculated that truncation of gD eliminated the block in cell-to-cell transmission. Alternatively, since the level of inhibition of infection mediated by truncated gD is only a fraction of the interference due to full-length gD, then if the inhibition during cell-to-cell spread is proportionately less, our assay may not have been able to detect it. If the TM and cyt domains indeed code for a function associated with cell-to-cell transmission, it can be tested by constructing cells expressing chimeric gD that carry TM and cyt domains of heterologous glycoproteins, e.g. VSV G protein. We speculate that the block in cell-to-cell transmission mediated by full-length BHV-1 gD in MDBK cells is dependent on basolateral sorting of gD similar to HSV-1 gD, and truncation at amino acid 359 may have deleted the sorting signals of BHV-1 gD resulting in apical secretion of truncated gD from MDBKt-gD cells. Indeed we discovered a putative basolateral-targeting signal in the carboxyl terminus of gD (Table 1). This would conceivably result in lack of t-gD at the basolateral surface resulting in no block in cell-to-cell transmission.


Table 1. Cytoplasmic basolateral-sorting signals include a critical tyrosine residue


Epithelial cells are polarized with spatially and functionally asymmetric apical and basolateral membranes separated by tight junctions (zonulae occludentes) (reviewed by Le Gall et al., 1995 ). MDBK cells, like other kidney cells, are polarized and HSV glycoproteins including gD sort to the basolateral surface (Srinivas et al., 1986 ). Basolateral-sorting signals usually include a critical tyrosine residue (Y-X-X-hydrophobic) (reviewed by Rodriguez-Boulan & Zurzolo, 1993 ). Computer predictions and structural analysis of peptides have shown that they form a beta turn, suggesting that such a loop structure may interact with other factors responsible for proper translocation (Collawn et al., 1990 ; Eberle et al., 1991 ). The tyrosine is critical both for internalization and basolateral transport for several proteins including viral haemagglutinin (HA). HA is an apical protein, but mutation at position 543 from C→Y in the cytoplasmic domain targets it to the basolateral membrane where it is rapidly internalized through coated pits (Brewer & Roth, 1991 ). VSV G protein uses the classic Y-X-X-aliphatic motif (YTDI) to mediate its basolateral sorting in MDCK cells (Thomas et al., 1993 ). Interestingly, BHV-1, BHV-5, PRV and HSV-1 gDs have tyrosine in their cytoplasmic tails, which could potentially be a part of the sorting signal (Table 1). Bovine herpesvirus gDs and PRV gD have the classic Y-X-X-L motif, which is very likely a basolateral-sorting signal for gD. Consistent with this hypothesis, upon induction for overexpression, we observed accumulation of BHV-1 gD in the cytoplasm of cells expressing full-length BHV-1 gD (Dasika & Letchworth, 1999 ), possibly due to overwhelming of the sorting machinery from trans-Golgi to the plasma membrane. However, this needs to be experimentally demonstrated, e.g. by mutating the putative critical tyrosine to alanine. Thus it is possible that t-gD was unable to block cell-to-cell transmission in MDBKt-gD due to apical delivery of the protein in the absence of basolateral-sorting signals (Fig. 5).



(21K):

Fig. 5. Hypothetical model for cell membrane localization of gD in polarized cells. Schematic representation (adapted from Le Gall et al., 1995 ) of predicted polarized targeting of truncated and full-length gD in MDBK cells. Also shown above is the primary sequence of BHV-1 gD cytoplasmic tail with putative sorting signals (NLS, nuclear localization signal; BTS, basolateral targeting signal) marked. Abbreviations: TJ, tight junction or zonulae occludentes; TGN, trans-Golgi network; ER, endoplasmic reticulum; BLE, basolateral endosome; Lys, lysosome.

More basic information about BHV-1 gD synthesis, processing and sorting is required for proper interpretation of experimental observations and understanding of gD function. We conclude the following. (a) The extracellular domain of BHV-1 gD is sufficient to block infection both against homologous and heterologous viruses. Although the level of inhibition is several-fold lower when compared with interference mediated by full-length gD, the specificity of block mediated by truncated BHV-1 gD is qualitatively similar to the interference function of full-length BHV-1 gD. The amount of BHV-1 gD sufficient to block BHV-1, HSV-1 and PRV infection is unable to block the closely related BHV-5. (b) Cells expressing truncated gD are fully susceptible to infection unless pre-incubated with truncated gD and form normal-sized plaques, suggesting that retention of gD in/on the cells may be required for inhibition of infection and cell-to-cell transmission. Thus gD acts at the level of cell membrane at the time of membrane penetration.

We speculate that MDBKt-gD cells were improperly targeting t-gD to the apical surface and thus there was no block in cell-to-cell transmission despite secretion of high levels of t-gD. Similarly, significantly more BHV-1 gD may be required to block BHV-5 and due to preferential basolateral sorting of gD (if true), MDBKgD cells were able to block cell-to-cell transmission of BHV-5 but not the initial infection. Construction of gD-expressing cell lines with a mutation in the putative basolateral targeting signal (Y-S-A-L) should allow us to define if the gD-mediated block in cell-to-cell transmission is dependent on basolateral targeting or if another functional domain in the TM or cyt domain is responsible. Similar to the proposed mechanism of gD-mediated interference, the gD-mediated block in cell-to-cell transmission may involve sequestering or blocking of a cellular factor present in the region of cell-to-cell contact that may or may not be identical to the cellular receptor/s required for initial entry.

This work was supported by U.S. Department of Agriculture Special Research Grant 89-34116-4853, U.S. Department of Agriculture National Research Initiative Grant 94-37204-0857, scholarship support to G.K.D from the state of Wisconsin, and a Milwaukee foundation Shaw Scholarship to G.J.L. We thank Drs C. Brandt (for HSV-1 KOS), S. I. Chowdhury (for BHV-5), X. Zhu (for purified BHV-1 gD and anti-BHV-1 gD polyclonal antibody); and C. Lohff, J. Fishel and M. Hancock for their help.

References

Abdelmagid, O. Y., Minocha, H. C., Collins, J. K. & Chowdhury, S. I. (1995). Fine mapping of bovine herpesvirus-1 (BHV-1) glycoprotein D (gD) neutralizing epitopes by type-specific monoclonal antibodies and sequence comparison with BHV-5 gD. Virology 206, 242-253.[Medline]

Brandimarti, R., Huang, T., Roizman, B. & Campadelli-Fiume, G. (1994). Mapping of herpes simplex virus 1 genes with mutations which overcome host restrictions to infection. Proceedings of the National Academy of Sciences, USA 91, 5406-5410.[Abstract/Free Full Text]

Brewer, C. B. & Roth, M. G. (1991). A single amino acid change in the cytoplasmic domain alters the polarized delivery of influenza viral hemagglutinin. Journal of Cell Biology 114, 413-421.[Abstract/Free Full Text]

Brunetti, C. R., Burke, R. L., Kornfeld, S., Gregory, W., Dingwell, K. S., Masiarz, F. & Johnson, D. C. (1994). Herpes simplex virus glycoprotein D acquires mannose 6-phosphate residues and binds to mannose 6-phosphate receptors. Journal of Biological Chemistry 269, 17067-17074.[Abstract/Free Full Text]

Brunetti, C. R., Burke, R. L., Hoflack, B., Ludwig, T., Dingwell, K. S. & Johnson, D. C. (1995). Role of mannose 6-phosphate receptors in herpes simplex virus entry into cells and cell-to-cell transmission. Journal of Virology 69, 3517-3528.[Abstract]

Campadelli-Fiume, G., Arsenakis, M., Farabegoli, F. & Roizman, B. (1988). Entry of herpes simplex virus 1 in BJ cells that constitutively express viral glycoprotein D is by endocytosis and results in degradation of the virus. Journal of Virology 62, 159-167.[Abstract/Free Full Text]

Campadelli-Fiume, G., Qi, S., Avitabile, E., Foa-Tomasi, L., Brandimarti, R. & Roizman, B. (1990). Glycoprotein D of herpes simplex virus encodes a domain which precludes penetration of cells expressing the glycoprotein by superinfecting herpes simplex virus. Journal of Virology 64, 6070-6079.[Abstract/Free Full Text]

Chase, C. C. L. & Letchworth, G. J. (1994). Bovine herpesvirus 1 gIV-expressing cells resist virus penetration. Journal of General Virology 75, 177-181.[Abstract/Free Full Text]

Chase, C. C. L., Carter-Allen, K., Lohff, C. & Letchworth, G. J. (1990). Bovine cells expressing bovine herpesvirus 1 (BHV1) glycoprotein IV resist infection by BHV1, herpes simplex virus and pseudorabies virus. Journal of Virology 64, 4866-4872.[Abstract/Free Full Text]

Chase, C. C. L., Lohff, C. & Letchworth, G. J. (1993). Resistance and susceptibility of bovine cells expressing herpesviral glycoprotein D homologs to herpesviral infection. Virology 194, 365-369.[Medline]

Cocchi, F., Menotti, L., Mirandola, P., Lopez, M. & Campadelli-Fiume, G. (1998). The ectodomain of a novel member of the immunoglobulin subfamily related to the poliovirus receptor has the attributes of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells. Journal of Virology 72, 9992-10002.[Abstract/Free Full Text]

Collawn, J. F., Stangel, M., Kuhn, L. A., Esekogwu, V., Jing, S., Trowbridge, I. S. & Tainer, J. A. (1990). Transferrin receptor internalization sequence YXRF implicates a tight turn as the structural recognition motif for endocytosis. Cell 63, 1061-1072.[Medline]

Dasika, G. K. & Letchworth, G. J. (1999). Cellular expression of bovine herpesvirus 1 gD inhibits cell-to-cell spread of two closely related viruses without blocking their primary infection. Virology 254, 24-36.[Medline]

Dean, H. J., Terhune, S., Sheih, M.-T., Susmarski, N. & Spear, P. G. (1994). Single amino acid substitutions in gD of herpes simplex virus 1 confer resistance to gD-mediated interference and cause cell type-dependent alterations in infectivity. Virology 199, 67-80.[Medline]

Dean, H. J., Warner, M. S., Terhune, S. S., Johnson, R. M. & Spear, P. G. (1995). Viral determinants of the variable sensitivity of herpes simplex virus strains to gD-mediated interference. Journal of Virology 69, 5171-5176.[Abstract]

Eberle, W., Sander, C., Klaus, W., Schmidt, B., von Figura, K. & Peters, C. (1991). The essential tyrosine of the internalization signal in lysosomal acid phosphatase is part of a beta turn. Cell 67, 1203-1209.[Medline]

Engels, M., Giuliani, C., Wild, P., Beck, T. M., Loepfe, E. & Wyler, R. (1986). The genome of bovine herpesvirus 1 (BHV-1) exhibiting a neuropathogenic potential compared to known BHV-1 strains by restriction site mapping and cross-hybridization. Virus Research 6, 57-73.[Medline]

Fehler, F., Herrmann, J. M., Saalmuller, A., Mettenleiter, T. C. & Keil, G. M. (1992). glycoprotein IV of bovine herpesvirus 1-expressing cell line complements and rescues a conditionally lethal viral mutant. Journal of Virology 66, 831-839.[Abstract/Free Full Text]

Geraghty, R. J., Krummenacher, C., Cohen, G. H., Eisenberg, R. J. & Spear, P. G. (1998). Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280, 1618-1620.[Abstract/Free Full Text]

Huang, T. & Campadelli-Fiume, G. (1996). Anti-idiotypic antibodies mimicking glycoprotein D of herpes simplex virus identify a cellular protein required for virus spread from cell to cell and virus induced polykaryocytosis. Proceedings of the National Academy of Sciences, USA 93, 1836-1840.[Abstract/Free Full Text]

Johnson, R. M. & Spear, P. G. (1989). Herpes simplex virus glycoprotein D mediates interference with herpes simplex virus infection. Journal of Virology 63, 819-827.[Abstract/Free Full Text]

Johnson, D. C., Burke, R. L. & Gregory, T. (1990). Soluble forms of herpes simplex virus glycoprotein D bind to a limited number of cell surface receptors and inhibit virus entry into cells. Journal of Virology 64, 2569-2576.[Abstract/Free Full Text]

Krummenacher, C., Nicola, A. V., Whitbeck, J. C., Lou, H., Hou, W., Lambris, J. D., Geraghty, R. J., Spear, P. G., Cohen, G. H. & Eisenberg, R. J. (1998). Herpes simplex virus glycoprotein D can bind to poliovirus receptor-related protein 1 or herpesvirus entry mediator, two structurally unrelated mediators of virus entry. Journal of Virology 72, 7064-7074.[Abstract/Free Full Text]

Le Gall, A. H., Yeaman, C., Muesch, A. & Rodriguez-Boulan, E. (1995). Epithelial cell polarity: new perspectives. Seminars in Nephrology 15, 272-284.[Medline]

Li, Y., van Drunen Littel-van den Hurk, S., Babiuk, L. A. & Liang, X. (1995). Characterization of cell-binding properties of bovine herpesvirus 1 glycoproteins B, C, and D: identification of a dual cell-binding function of gB. Journal of Virology 69, 4758-4768.[Abstract]

Ligas, M. W. & Johnson, D. C. (1988). A herpes simplex virus mutant in which glycoprotein D sequences are replaced by β galactosidase sequences binds to but is unable to penetrate into cells. Journal of Virology 62, 1486-1494.[Abstract/Free Full Text]

Ludwig, H. (1983). Bovine herpesviruses. In The Herpesviruses, pp. 135-214. Edited by B. Roizman. New York: Plenum.

Marshall, R. L., Rodriguez, L. L. & Letchworth, G. J. (1986). Characterization of the envelope proteins of infectious bovine rhinotracheitis virus (bovine herpesvirus 1) by biochemical and immunological methods. Journal of Virology 57, 745-753.[Abstract/Free Full Text]

Montgomery, R. I., Warner, M. S., Lum, B. J. & Spear, P. G. (1996). Herpes simplex virus entry into cells mediated by a novel member of the TNF/NGF receptor family. Cell 87, 427-436.[Medline]

Nicola, A. V., Willis, S. H., Naidoo, N. A., Eisenberg, R. J. & Cohen, G. H. (1996). Structure-function analysis of soluble forms of herpes simplex virus glycoprotein D. Journal of Virology 70, 3815-3822.[Abstract]

Petrovskis, E. A., Meyer, A. L. & Post, L. E. (1988). Reduced yield of infectious pseudorabies virus and herpes simplex virus from cell lines producing viral glycoprotein gp50. Journal of Virology 62, 2196-2199.[Abstract/Free Full Text]

Rauh, I. & Mettenleiter, T. C. (1991). Pseudorabies virus glycoproteins gII and gp50 are essential for virus penetration. Virology 65, 5348-5356.

Rodriguez-Boulan, E. & Zurzolo, C. (1993). Polarity signals in epithelial cells. Journal of Cell Science (Suppl.)17, 912.

Roizman, B., Desrosiers, R. C., Fleckenstein, B., Loprez, C., Minson, A. C. & Studdert, M. J. (1992). The family herpesviridae, an update. Archives of Virology 123, 425-449.[Medline]

Spear, P. G. (1993a). Entry of alphaherpesviruses into cells. Seminars in Virology 4, 167-180.

Spear, P. G. (1993b). Membrane fusion induced by herpes simplex virus. In Viral Fusion Mechanisms, pp. 201-232. Edited by J. Bentz. Boca Raton: CRC Press.

Spear, P. G., Shieh, M.-T., Herold, B. C., WuDunn, D. & Koshy, T. I. (1992). Heparan sulfate glycosaminoglycans as primary cell surface receptors for herpes simplex virus. In Heparin and Related Polysaccharides, pp. 341-353. Edited by D. A. Lane. New York: Plenum.

Srinivas, R. V., Balachandran, N., Alonso-Caplen, F. V. & Compans, R. W. (1986). Expression of herpes simplex virus glycoproteins in polarized epithelial cells. Journal of Virology 58, 689-693.[Abstract/Free Full Text]

Thaker, S. R., Stine, D. L., Zamb, T. J. & Srikumaran, S. (1994). Identification of a putative cellular receptor for bovine herpesvirus 1. Journal of General Virology 75, 2303-2309.[Abstract/Free Full Text]

Thomas, D. C., Brewer, C. B. & Roth, M. G. (1993). Vesicular stomatitis virus glycoprotein contains a dominant cytoplasmic basolateral sorting signal critically dependent upon a tyrosine. Journal of Biological Chemistry 268, 3313-3320.[Abstract/Free Full Text]

Tikoo, S. K., Fitzpatrick, D. R., Babiuk, L. A. & Zamb, T. J. (1990). Molecular cloning, sequencing, and expression of functional bovine herpesvirus 1 glycoprotein IV in transfected bovine cells. Journal of Virology 64, 5132-5142.[Abstract/Free Full Text]

Warner, M. S., Geraghty, R. J., Martinez, W. M., Montgomery, R. I., Whitbeck, J. C., Xu, R., Eisenberg, R. J., Cohen, G. H. & Spear, P. G. (1998). A cell surface protein with herpesvirus entry activity (HveB) confers susceptibility to infection by mutants of herpes simplex virus type 1, herpes simplex virus type 2, and pseudorabies virus. Virology 246, 179-189.[Medline]

Weiss, R. A. (1993). Cellular receptors and viral glycoproteins involved in retrovirus entry. In The Retroviridae, pp. 1-108. Edited by J. Levy. New York: Plenum.

Whitbeck, J. C., Peng, C., Lou, H., Xu, R., Willis, S. H., Ponce de Leon, M., Peng, T., Nicola, A. V., Montgomery, R. I., Warner, M. S., Soulika, A. M., Spruce, L. A., Moore, W. T., Lambris, J. D., Spear, P. G., Cohen, G. H. & Eisenberg, R. J. (1997). Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the tumor necrosis factor receptor superfamily and a mediator of HSV entry. Journal of Virology 71, 6083-6093.[Abstract]

Yates, W. D. G. (1982). A review of infectious bovine rhinotracheitis, shipping fever pneumonia and viralbacterial synergism in respiratory disease of cattle. Canadian Journal of Comparative Medicine 46, 225-263.

Zhu, X. & Letchworth, G. J. (1996). Mucosal and systemic immunity to bovine herpesvirus-1 glycoprotein D confer resistance to viral replication and latency. Vaccine 14, 61-69.[Medline]

Received 5 August 1999; accepted 10 December 1999.