Research Article

Genome structure of Sagiyama virus and its relatedness to other alphaviruses

Journal of General Virology 2000; 81(5):1353

PubMed

With thanks to our partners for supporting this archive.

Abstract

Sagiyama virus (SAG) is a member of the genus Alphavirus in the family Togaviridae, isolated in Japan from mosquitoes in 1956. We determined the complete nucleotide sequence of the SAG genomic RNA from the original stock virus which formed a mixture of plaques with different sizes, and that from a full-length cDNA clone, pSAG2, infectious RNA transcripts from which formed uniform large plaques on BHK-21 cells. The SAG genome was 11698 nt in length exclusive of the 3' poly(A) tail. Between the complete nucleotide sequences of the full-length cDNA clone, pSAG2, and the consensus sequence from the original stock virus, there were nine amino acid differences; two each in nsP1, nsP2 and E1, and three in E2, some of which may be responsible for plaque phenotypic variants in the original virus stock. SAG was most closely related to Ross River virus among other alphaviruses fully sequenced, with amino acid sequence identities of 86% in the nonstructural proteins and of 83% in the structural proteins. The 3' terminal 280 nt region of SAG was 82% identical to that of Barmah Forest virus, which was otherwise not closely related to SAG. Comparison of the nucleotide sequence of SAG with partial nucleotide sequences of Getah virus (GET), which was originally isolated in Malaysia in 1955 and is closely related to SAG in serology and in biology, showed near identity between the two viruses, suggesting that SAG is a strain of GET.
Sagiyama virus (SAG) is a member of the genus Alphavirus in the family Togaviridae (Strauss et al., 1995 ). SAG was isolated at a heronry near Tokyo, Japan in 1956 from Culex tritaeniorhynchus mosquitoes (Scherer et al., 1962a , b ). Among other alphaviruses, SAG is most closely related antigenically to Getah virus (GET), a virus that was first isolated in Malaysia in 1955 from Culex gelidus mosquitoes (Berge, 1975 ) and has since been found widely in Southeast Asian countries, Australia and Japan (Kono, 1988 ). SAG and GET can be differentiated by oligonucleotide fingerprinting (Morita & Igarashi, 1984 ) and infectivity for Xenopus cells (Chanas et al., 1977 ), but otherwise the two viruses are quite similar serologically and biologically (Kono, 1988 ). Many strains of SAG and GET have been isolated in Japan from mosquitoes (Scherer et al., 1962a ; Igarashi et al., 1981 ; Kumanomido et al., 1986 ), swine (Nakamura et al., 1967 ) and racehorses (Kamada et al., 1980 ; Sensui & Kono, 1985 ). Antibodies against SAG and GET have been detected in mammals, including humans and domestic animals, and in birds (Scherer et al., 1962a ; Nakamura et al., 1967 ), but there have been no cases of illness caused by either virus (Kono, 1988 ) except for sporadic cases of fever and oedema in racehorses during outbreaks of GET infection in 1978 and 1983 in Japan (Kamada et al., 1980 ; Sensui & Kono, 1985 ).

The genus Alphavirus consists of 26 registered members, with Sindbis virus (SIN) as the type species (Strauss et al., 1995 ). Alphaviruses are divided into seven serocomplexes (Calisher et al., 1980 ) and into three major phylogenetic clusters (Strauss & Strauss, 1994 ). The genome is a positive-stranded RNA with approximately 1112 kb (Strauss & Strauss, 1994 ). The 5' end is capped and the 3' end is polyadenylated. Four nonstructural proteins, nsP1, nsP2, nsP3 and nsP4, which are required for virus RNA replication, are encoded in the 5'-terminal region as a polyprotein, which is proteolytically processed into functional products by the nsP2 proteinase. The five proteins required for mature virion formation, C, E3, E2, 6K and E1, are encoded in the 3'-terminal region and translated from the subgenomic RNA, which is 3' coterminal to the genomic RNA. Complete nucleotide sequences have been published for nine members so far: SIN (Strauss et al., 1984 ), Ockelbo virus (Shirako et al., 1991 ), Aura virus (AURA) (Rumenapf et al., 1995 ), Semliki Forest virus (SF) (Takkinen, 1986 ; Garoff et al., 1980 ), Ross River virus (RR) (Faragher et al., 1988 ), onyong-nyong virus (ONN) (Levinson et al., 1990 ), Venezuelan equine encephalitis virus (VEE) (Kinney et al., 1989 ), eastern equine encephalitis virus (EEE) (Weaver et al., 1993 ) and Barmah Forest virus (BF) (Lee et al., 1997 ). Previously it was reported that SAG is a member of the GET subtype in the SF serocomplex, which also includes RR and Bebaru virus (Calisher et al., 1980 ), but little information on the genome structure has been available, only partial nucleotide sequences of the nsP1 gene and the 3'-untranslated region (Pfeffer et al., 1997 , 1998 ). In this paper, we report the complete nucleotide sequence of the SAG genome from non-plaque-purified stock virus and that from a full-length cDNA clone from which infectious RNA can be transcribed in vitro to reveal the relationship of SAG to the other alphaviruses. Our result suggests that SAG is closely related to RR and can be considered as a strain of GET.

Virus, cells and medium.
SAG virus seed stock (the 18th passage in suckling mouse brain) was obtained from M. Tashiro of the National Institute for Infectious Disease, Tokyo, Japan. Aedes albopictus C6/36 cells were provided by A. Igarashi of the Institute of Tropical Medicine, Nagasaki University, Japan. Chicken embryo fibroblast primary cells were provided by M. Hishiyama and T. Kohama of the National Institute for Infectious Disease, Tokyo, Japan. BHK-21 (C-13) cells were purchased from ATCC. Cells were cultured and maintained in Eagles minimum essential medium (Type 1, Nissui Pharmaceutical) supplemented with 0·03 % glutamine, 0·12% NaHCO3, 5% foetal bovine serum (BioWhittaker) and 1 mM non-essential amino acids (GibcoBRL).

Cloning of random-primed cDNA and determination of the complete consensus nucleotide sequence from the original virus stock.
Virus was propagated in C6/36 cells at 30 °C for 2 days, and purified from the medium by differential centrifugation and sucrose density gradient centrifugation. RNA was extracted by the SDSphenol method and precipitated in ethanol. cDNA to the extracted virus RNA was synthesized with a mixture of random deoxynucleotide hexamers and d(T)17 primers (200:1 in molar ratio), and made double-stranded by the method of Gubler & Hoffman (1983) . After methylation of internal EcoRI sites, ds cDNA was ligated to an EcoRI linker, 5' CGGAATTCCG 3', followed by EcoRI digestion, size-fractionation in a low melting point agarose gel and purification by a spin column (QIAGEN), and cloned into an EcoRI-cut pGEM3Z vector (Promega). These clones were used to transform the MC1061 strain of Escherichia coli. Recombinant plasmid DNA was prepared from transformants by a boiling method and those plasmids containing an insert larger than approximately 0·8 kb were selected (Fig. 1a). The nucleotide sequence of insert DNA was determined from both ends with SP6 and T7 primers up to about 750 nt from the 5' terminus of the primer using a dye terminator cycle sequencing kit (Applied Biosystems International) and an automated DNA sequencer (model 377, ABI). The nucleotide sequences obtained were batch assembled using the AutoAssembler software (ABI) into an 11·7 kb sequence. Nucleotides at all positions were present in at least three overlapping clones including the 3' terminus followed by a poly(A) stretch, except for the 5' terminal 18 nt. Ambiguous nucleotides were resolved by sequencing the region using internal primers designed to anneal about 200 nt upstream or downstream of the region (Fig. 1b). To determine the 5'-terminal nucleotide sequence, cDNA was synthesized using an oligonucleotide TA1 (nt 816832, minus-sense), tailed with dGTP using terminal deoxynucleotidyl transferase (GibcoBRL) and amplified by PCR using d(C)17 primer and TA1 with Taq DNA polymerase (Grade Ex, TaKaRa). The 0·8 kb PCR product was cloned into pGEM3Z and the sequence was determined from three independent clones using primer TA8 (nt 390406, minus-sense). At positions where different nucleotides were present among three or more independent clones, a nucleotide occurring more than half the time was designated as the consensus nucleotide.



(23K):

Fig. 1. SAG genome characterization. (a) Location of random cDNA clones aligned from the 5' end to the 3' end of the genome. Solid lines with arrows at both ends indicate cDNA inserts cloned at the EcoRI site of pGEM3Z. Dashed lines with an arrow at one end indicate the cDNA insert where chimeric and nucleotide sequences were determined only from the arrowed side. (b) Positions of oligonucleotide primers used in this study for sequencing and RTPCR. Oligonucleotides with numbers are referred to in the text. (c) Structure of a full-length cDNA insert in pSAG.ABCD which was entirely derived from RTPCR products. The hatched line shows the 11698 nt SAG genome excluding the 5' cap and the 3' poly(A) tract. (d) Structure of a full-length cDNA insert in pSAG2. pSAG2 was constructed by replacing the sequence between the BamHI site at position 36 and the NsiI site at position 11095 in pSAG.ABCD with ds cDNA.

Construction of full-length cDNA clones.
Based on the consensus nucleotide sequence information, primers were constructed such that cDNA made to the stock viral RNA could be amplified by PCR and cloned downstream of the T7 promoter in the plasmid Proteus1, which is a derivative of pBR322 and had been used for construction of full-length infectious cDNA clones of SIN (Rice et al., 1987 ; McKnight et al., 1996 ), VEE (Davis et al., 1989 ) and RR (Kuhn et al., 1991 ) (Fig. 1c). The details of this construction are described below.

pToto1101, a full-length cDNA clone of SIN (Rice et al., 1987 ), was digested with SacI and XhoI to separate the 1·8 kb vector from the 11·7 kb insert. Two oligonucleotides, 5' ACGCGTGAGAATTCGAAGATCTGACTCGAGGATCTAGA 3' and 5' TCGATCTAGATCCTCGAGTCAGATCTTCGAATTCTCACGCGTAGCT 3', were annealed to each other and ligated to the SacI/XhoI-cut vector to generate a custom cloning vector, pPro.MEBXX, in which the original SacI and XhoI sites were not regenerated but which contained MluI, EcoRI, BglII, XhoI and XbaI sites from the 5' end. In the SAG genome, MluI and XbaI sites are absent and the EcoRI, BglII and XhoI sites are unique, dividing the entire SAG genome into four regions A, B, C and D (Fig. 1c). To clone region A into pPro.MEBXX, cDNA to the stock viral RNA was synthesized using primer TA6 (37133729, minus-sense), and amplified by PCR with a plus-sense primer, 5' GAGACGCGTTAATACGACTCACTATAGATGGCGGACGTGTGACATCACCC 3', in which bold letters indicate an MluI site, italicized letters indicate the T7 promoter, and underlined letters indicate the 5'-terminal 22 nt sequence of the SAG genome, and TA6. The 3·7 kb PCR product was digested with MluI and EcoRI and the 2·2 kb fragment was cloned into MluI/EcoRI-digested pPro.MEBXX to generate pSAG.A. A 2·6 kb insert representing region B was prepared by RTPCR using TA4 (56065722, minus-sense) and TA27 (19852001, plus-sense) and digestion with EcoRI and BglII, and cloned into EcoRI/BglII-digested pSAG.A to generate pSAG.AB. Similarly, a 3·7 kb insert representing region C was prepared by RTPCR using TA29 (85638579, minus-sense) and TA28 (46444660, plus-sense) and digestion with BglII and XhoI, and cloned into BglII/XhoI-digested pSAG.AB to generate pSAG.ABC. Finally, to clone the 3'-terminal, 3·3 kb region D into pSAG.ABC, cDNA was synthesized using 5' GGCTCTAGA(T)43GTAAAATA 3', in which bold letters indicate an XbaI site and underlined letters indicate 8 nt complementary to the 3' terminal sequence of the SAG genome, and amplified by PCR using TA30 (83418357, plus-sense) and the primer used for the cDNA synthesis. The PCR product was digested with XhoI and XbaI and cloned into XhoI/XbaI-cut pSAG.ABC to generate pSAG.ABCD, which should contain from the 5' end between the MluI and XbaI sites, the T7 promoter sequence, an extra G residue for efficient transcription, the 11698 nt sequence of SAG and 43 A residues. Furthermore, to replace almost the entire insert from the BamHI site at nucleotide position 36 to the NsiI site at position 11095 in pSAG.ABCD with ds cDNA, cDNA was synthesized to genomic RNA with 5' GGCTCTAGA(T)43GTAAAATA 3' and made double-stranded by the method of Gubler & Hoffmann (1983) . Nearly full-length ds cDNA was digested with BamHI and NsiI and the resulting 5·1 kb BamHIBamHI fragment and 6·0 kb BamHINsiI fragments were purified after running in a low melting point agarose gel. The 6·0 kb BamHINsiI fragment was cloned into the BamHI/NsiI-cut, 2·5 kb vector prepared from pSAG.ABCD, followed by cloning of the 5·1 kb BamHIBamHI fragment into the BamHI-cut, 8·5 kb vector. The orientation of the BamHIBamHI insert was confirmed by restriction analysis. One of the resultant full-length cDNA clones was designated as pSAG2 (Fig. 1d).

Infectivity assay.
Full-length cDNA clones constructed as above (Fig. 1c, d) were digested with XbaI downstream of the 43-A stretch and transcribed in vitro with T7 RNA polymerase (TaKaRa) in the presence of a cap analogue (New England Biolabs). In vitro transcripts were transfected using DEAE-dextran (Shirako & Strauss, 1994 ) into BHK-21 monolayer cells, which were incubated at 30 °C in a liquid medium for up to 5 days until cytopathic effects were observed. Viable virus was recovered from the medium and used for plaque assay and virus growth analysis.

SAG genome structure and heterogeneity
The genome of SAG was 11698 nt in length excluding the 3' poly(A) tail and had the typical alphavirus genome organization (Fig. 2). A UGA opal termination codon was found 7 aa upstream from the nsP3/nsP4 cleavage site, as has been seen in the majority of alphaviruses sequenced (Strauss & Strauss, 1994 ; Rumenapf et al., 1995 ; Simpson et al., 1996 ; Lee et al., 1997 ).



(7K):

Fig. 2. Genome organization of SAG. Open rectangular boxes indicate ORFs. Vertical bars inside the boxes are proteolytic cleavage sites determined by alignment of the amino acid sequence with that of other alphaviruses with known cleavage sites. A black diamond above the bar near the end of nsP3 indicates a leaky UGA termination codon, which is located 7 aa upstream of the cleavage site. Vertical bars below the boxes indicate locations of nucleotides that differ between the consensus sequence determined from randomly generated cDNA clones and the sequence of the full-length infectious cDNA clone pSAG2. Vertical bars above the boxes indicate locations of amino acids that differ between the two sequences (consensus → SAG2).

In vitro transcripts from pSAG.ABCD were not viable in BHK-21 monolayer cells presumably due to the presence of one or more lethal mutations which had been generated during the PCR amplification. After replacement of nearly the entire insert with ds cDNA, in vitro transcripts from several independent clones were tested for viability. One clone, pSAG2, formed uniformly large plaques on BHK-21 monolayer cells, whereas a few other clones formed minute or small plaques. In this study, pSAG2 was selected for further analysis.

The entire nucleotide sequence of the insert of pSAG2 was determined using internal primers (Fig. 1b). There were 12 nucleotide differences between the consensus sequence determined from random cDNA clones and the pSAG2 insert (Fig. 2). Nine out of 12 nucleotide differences caused amino acid changes; two were in the C-terminal region of nsP1, two were in the C-terminal proteinase domain of nsP2, three were in the E2 glycoprotein and two were in the E1 glycoprotein. Since the original virus stock was not plaque-purified and formed mixtures of plaques with different sizes (data not shown), these amino acid differences together with others that are not located are probably responsible for the minute and small plaque phenotypes. Similar plaque size variants have been reported with GET (Chanas et al., 1977 ; Kimura & Ueba, 1978 ) and appear to be a common phenomenon in SAG and GET populations. Since these viruses had been passaged many times in suckling mouse brain before the plaque assay, these variants could have been either generated during the passage or existed in nature as a mixed population and were tolerated in suckling mouse brain. Although there is no further literature describing mixed populations of plaque phenotypic variants of alphaviruses, this phenomenon may be common among alphaviruses, considering that RNA viruses are quasispecies (Holland et al., 1992 ).

Relatedness of SAG to other alphaviruses
Amino acid sequences of nsP4 and E2 proteins of SAG were compared with those of the other alphaviruses in a pair-wise fashion. These two proteins were chosen for comparisons because nsP4 is the RNA polymerase and resides and functions only in cytoplasm, in which case the environment may not differ much among different hosts, whereas E2, one of the two membrane glycoproteins, is a major determinant of virus antigenicity and is believed to interact with host cell receptors, resulting in more divergence than other viral proteins. As shown in Table 1, SAG was most closely related to RR, with 88% amino acid identity in nsP4 and 80% in E2. Among nine alphaviruses analysed here, SAG was included in a group formed by RR, SF and ONN in both nsP4 and E2. On the other hand, SIN and AURA formed a separate group and so did EEE and VEE, as described previously (Strauss & Strauss, 1994 ). It was peculiar that BF was rather distantly related to the other eight alphaviruses, including SAG, with 6972% identity in nsP4, but that in E2 BF was more closely related to the SAG/RR/SF/ONN group (4749% identity) than to the two other groups (4041% identity), implying that BF may have shared a similar host range with the SAG/RR/SF/ONN group in nature.


Table 1. Percent identities from pair-wise comparisons of amino acid sequences of alphavirus nsP4 and E2 proteins


The entire genome of SAG was compared with that of RR at the nucleotide and amino acid levels (Table 2). The size of the SAG genome was smaller than RR by 155 nt due to the shorter SAG nsP3 C-terminal non-conserved region and the shorter SAG 3'-untranslated region. The 3'-untranslated region of SAG contained three repeated sequence elements about 60 nt long (Fig. 3b, c), whereas that of RR contained four repeated elements separated by up to 100 nt as previously described (Faragher & Dalgarno, 1986 ; Pfeffer et al., 1998 ). Otherwise, the 5'-untranslated region and the 3'-terminal 220 nt region was 88% and 84% identical, respectively, between the two viruses (Fig. 3a, c). In the intergenic region, nucleotide sequence identity was only 67%, although the 24 nt putative promoter sequence for the subgenomic RNA was 89% identical between the two viruses. Overall amino acid sequence identity in the nonstructural proteins and in the structural proteins was 86% and 83%, respectively. These results indicated that SAG and RR evolved from a common ancestral virus.


Table 2. Comparison of the nucleotide and translated amino acid sequences of Sagiyama virus (SAG2) and Ross River virus (T48)



(39K):

Fig. 3. (a) Aligned nucleotide sequences of the 5'-terminal untranslated region of SAG, RR and SF. Dots indicate the same nucleotides as in SAG. Dashes are inserted to maximize the alignment. The numbering is from the 5' terminus. (b) Schematic representation of the 3'-terminal untranslated region of SAG, GET, BF and RR. Hatched rectangular boxes indicate repeated sequence elements common among the four viruses. Shaded rectangular boxes indicate repeated sequence elements only found in BF. Downward triangles indicate the position of the termination codon for the E1 glycoprotein gene. Horizontal bars with arrows at both ends indicate that the nucleotide sequence in these regions was nearly identical. (c) Aligned nucleotide sequences of the 3'-terminal untranslated regions of SAG, GET, BF and RR. The numbering is from the 3' terminus adjacent to the poly(A) tail. With BF and RR, only the 3'-terminal 279 nt and 219 nt were aligned, respectively. The three repeated sequence elements common in SAG, GET, BF and RR are included in boxes.

Besides RR, the 5'-untranslated region of SAG was similar to that of SF, particularly in the terminal 30 nt (Fig. 3a); the first 8 nt were identical between SAG and SF, whereas RR differed by having an extra T residue at the third position. On the other hand, in the 3'-terminal region, SAG was 82% identical to BF in the terminal 280 nt region, which included two of the three consecutive 60 nt repeated sequence elements (Fig. 3b, c), while SF shared similarity with SAG only in the terminal 19 nt region, which is conserved among all alphaviruses and is considered to be a promoter for minus-strand RNA synthesis (Strauss & Strauss, 1994 ).

Partial nucleotide sequences of the nsP1 gene and the 3'-untranslated region of GET (Pfeffer et al., 1997 , 1998 ) were compared with our SAG2 sequence. In the nsP1-coding region (nt 220600 in SAG2), the two viruses were 98% identical at the nucleotide level and totally identical at the amino acid level. In the 3'-terminal untranslated region, the two viruses were 94% identical, with the identical arrangement of the three repeated sequence elements (Fig. 3b, c). These similarities at nucleotide and amino acid levels as well as those in serology and in biology indicate that SAG is a strain of GET.

Virus growth in hamster, mosquito and chicken monolayer cells and its implication
SAG2 virus that was recovered after transfection of pSAG2 transcripts grew well in BHK-21 cells at 37 °C, reaching a titre of up to 5x108 p.f.u./ml within the first 6 h after inoculation (Fig. 4). In C6/36 mosquito cells, SAG2 also grew gradually and well at 30 °C, approaching 109 p.f.u./ml 24 h after inoculation. In chicken embryo fibroblast cells, SAG2 grew about 10% as well as in mosquito cells at 30 °C, reaching 5x107 p.f.u./ml 24 h after inoculation, but only very poorly at 40 °C. To get a maximum titre of the virus, infected BHK-21 cells were incubated at 30 °C for 48 h and titres higher than 2x109 were obtained routinely (data not shown). Although SAG and RR are very similar at the nucleotide and translated amino acid levels, their natural host range as well as their ability to grow in avian cells in culture differ markedly. These differences are probably due to differences in the E2 glycoprotein which affect binding of the virus to host cell receptors. Besides mosquitoes, small native marsupial mammals in Australia are considered to be the primary hosts for RR and BF, whereas pigs appear to be the primary mammalian host for SAG and GET (Nakamura et al., 1967 ; Kono, 1988 ). In addition, SAG and GET are widely distributed along the Asian and Australian side of the Pacific Rim, implying that migrating birds are also involved in circulation in nature, as is the case for SIN isolates (Shirako et al., 1991 ; Norder et al., 1996 ).



(31K):

Fig. 4. Growth curves of SAG2 virus in BHK-21 cells at 37 °C (), in C6/36 mosquito cells at 30 °C (•), in chicken embryo fibroblast cells at 30 °C () and at 40 °C (). Cells were infected at an m.o.i. of 10 and a fraction of the medium was removed immediately after infection and at 3 h (only BHK-21 and C6/36 cells), 6 h, 9 h (only BHK-21 and C6/36 cells), 12 h and 24 h post-infection. The virus titres were determined by plaque assay using BHK-21 monolayer cells incubated at 37 °C for 40 h before staining with neutral red (GibcoBRL).

The fact that SAG and RR were not closely related to BF in the nsP4 amino acid sequence among alphaviruses, but that the 3' terminal 220 nt regions were nearly identical among the three viruses, including the highly conserved repeated sequence element, implies that nsP4 binds only the terminal 19 nt region for initiation of minus-strand RNA synthesis and the rest of the untranslated region containing the repeated sequence elements is important for host factor binding, as proposed by Kuhn et al. (1991) . If so, near identities in the 3'-terminal region among SAG/GET, RR and BF may have resulted from common Culex spp. and Aedes spp. mosquito vectors in their natural circulation. We are grateful to Ellen Strauss for critical reading of this manuscript. This work was supported by a grant-in-aid from the Ministry of Education, Science, Sports and Culture of Japan.

Footnotes

The nucleotide sequence data reported in this paper have been submitted to DDBJ and assigned accession no. AB032553.

References

Berge, T. O. (1975). Getah. In International Catalogue of Arboviruses, 2nd edn, pp. 278279. US Department of Health, Education, and Welfare.

Calisher, C. H., Shope, R. H., Brandt, W., Casals, J., Karabatsos, N., Murphy, F. A., Tesh, R. B. & Wiebe, M. E. (1980). Proposed antigenic classification of registered arboviruses. I. Togaviridae, Alphavirus.Intervirology 14, 229-232.[Medline]

Chanas, A. C., Johnson, B. K. & Simpson, D. I. H. (1977). A comparative study of related alphaviruses a naturally occurring model of antigenic variation in the Getah sub-group.Journal of General Virology 35, 455-462.

Davis, N. L., Willis, L. V., Smith, J. F. & Johnston, R. E. (1989). In vitro synthesis of infectious Venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant.Virology 171, 189-204.[Medline]

Faragher, S. G. & Dalgarno, L. (1986). Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.Journal of Molecular Biology 190, 141-148.[Medline]

Faragher, S. G., Meek, A. D. J., Rice, C. M. & Dalgarno, L. (1988). Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.Virology 163, 509-526.[Medline]

Garoff, H., Frischauf, A. M., Simons, K., Lehrach, H. & Delius, H. (1980). Nucleotide sequence of cDNA coding for Semliki Forest virus membrane glycoproteins.Nature 288, 236-241.[Medline]

Gubler, U. & Hoffman, B. J. (1983). A simple and very efficient method for generating cDNA libraries.Gene 25, 263-269.[Medline]

Holland, J. J., De La Torre, J. C. & Steinhauer, D. A. (1992). RNA virus population as quasispecies.Current Topics in Microbiology and Immunology 176, 1-20.

Igarashi, A., Buei, K., Ueba, N., Yoshida, M., Ito, S., Nakamura, H., Sasao, F. & Fukai, K. (1981). Isolation of viruses from female Culex tritaeniorhynchus in Aedes albopictus cell cultures.American Journal of Tropical Medicine and Hygiene 30, 449-460.

Kamada, M., Ando, Y., Fukunaga, Y., Kumanomido, T., Imagawa, H., Wada, R. & Akiyama, Y. (1980). Equine Getah virus infection: isolation of the virus from racehorses during an enzootic in Japan.American Journal of Tropical Medicine and Hygiene 29, 984-988.

Kimura, T. & Ueba, N. (1978). Some biological and serological properties of large and small plaque variants of Getah virus.Archives of Virology 57, 221-229.[Medline]

Kinney, R. M., Johnson, B. J. B., Welch, J. B., Tsuchiya, K. R. & Trent, D. W. (1989). The full-length nucleotide sequences of the virulent Trinidad donkey strain of Venezuelan equine encephalitis virus and its attenuated vaccine derivative, strain TC-83.Virology 170, 19-30.[Medline]

Kono, Y. (1988). Getah virus disease. In The Arboviruses: Epidemiology and Ecology, pp. 21-36. Edited by T. P. Monath. Boca Raton, FL: CRC Press.

Kuhn, R. J., Niesters, H. G. M., Zhang, H. & Strauss, J. H. (1991). Infectious RNA transcripts from Ross River virus cDNA clones and the construction and characterization of defined chimeras with Sindbis virus.Virology 182, 430-441.[Medline]

Kumanomido, T., Fukunaga, Y., Ando, Y., Kamada, M., Imagawa, H., Wada, R., Akiyama, Y., Tanaka, Y., Kobayashi, M., Ogura, N. & Yamamoto, H. (1986). Getah virus isolations from mosquitoes in an enzootic area in Japan.Japanese Journal of Veterinary Science 48, 1135-1140.

Lee, E., Stocks, C., Lobigs, P., Hislop, A., Straub, J., Marshall, I., Weir, R. & Dalgarno, L. (1997). Nucleotide sequence of the Barmah Forest virus genome.Virology 227, 509-514.[Medline]

Levinson, R. S., Strauss, J. H. & Strauss, E. G. (1990). Complete sequence of the genomic RNA of ONyong-nyong virus and its use in the construction of alphavirus phylogenetic trees.Virology 175, 110-123.[Medline]

McKnight, K. L., Simpson, D. A., Lin, S.-C., Knott, T. A., Polo, J. M., Pence, D. F., Johannsen, D. B., Heidner, H. W., Davis, N. L. & Johnston, R. E. (1996). Deduced consensus sequence of Sindbis virus strain AR339: mutations contained in laboratory strains which affect cell culture and in vivo phenotypes.Journal of Virology 70, 1981-1989.[Abstract]

Morita, K. & Igarashi, A. (1984). Oligonucleotide fingerprint analysis of strains of Getah virus isolated in Japan and Malaysia.Journal of General Virology 65, 1899-1908.[Abstract/Free Full Text]

Nakamura, T., Isahai, K., Matsumoto, M., Matsuyama, T., Oya, A. & Okuno, T. (1967). Antibody responses following natural infection of swine to group A arbovirus Getah and preliminary survey for its antibody among domestic animals.Nihon Koshueisei Zasshi 14, 569-573.

Norder, H., Lundstrom, J. O., Kozuch, O. & Magnius, L. O. (1996). Genetic relatedness of Sindbis virus strains from Europe, Middle East, and Africa.Virology 222, 440-445.[Medline]

Pfeffer, M., Proebster, B., Kinney, R. M. & Kaaden, O. R. (1997). Genus-specific detection of alphaviruses by a semi-nested reverse transcriptionpolymerase chain reaction.American Journal of Tropical Medicine and Hygiene 57, 709-718.

Pfeffer, M., Kinney, R. M. & Kaaden, O. R. (1998). The alphavirus 3'-nontranslated region: size heterogeneity and arrangement of repeated sequence elements.Virology 240, 100-108.[Medline]

Rice, C. M., Levis, R., Strauss, J. H. & Huang, H. V. (1987). Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants.Journal of Virology 61, 3809-3819.[Abstract/Free Full Text]

Rumenapf, T., Strauss, E. G. & Strauss, J. H. (1995). Aura virus is a New World representative of Sindbis-like viruses.Virology 208, 621-633.[Medline]

Scherer, W. F., Funkenbusch, M., Buescher, E. L. & Izumi, T. (1962a). Sagiyama virus, a new group A arthropod-borne virus from Japan. I. Isolation, immunologic classification, and ecologic observations.American Journal of Tropical Medicine and Hygiene 11, 255-268.

Scherer, W. F., Izumi, T., McCown, J. & Hardy, J. L. (1962b). Sagiyama virus. II. Some biologic, physical, chemical and immunologic properties.American Journal of Tropical Medicine and Hygiene 11, 269-282.

Sensui, H. & Kono, Y. (1985). Reappearance of Getah virus infection among horses in Japan.Japanese Journal of Veterinary Science 47, 333-335.

Shirako, Y. & Strauss, J. H. (1994). Regulation of Sindbis virus RNA replication: uncleaved P123 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from P123 are required for efficient plus-strand RNA synthesis.Journal of Virology 68, 1874-1885.[Abstract/Free Full Text]

Shirako, Y., Niklasson, B., Dalrymple, J. M., Strauss, E. G. & Strauss, J. H. (1991). Structure of the Ockelbo virus genome and its relationship to other Sindbis viruses.Virology 182, 753-764.[Medline]

Simpson, D. A., Davis, N. A., Lin, S. C., Russel, D. & Johnston, R. E. (1996). Complete nucleotide sequence and full-length cDNA clone of S.A.AR86, a South African alphavirus related to Sindbis.Virology 222, 464-469.[Medline]

Strauss, J. H. & Strauss, E. G. (1994). The alphaviruses: gene expression, replication, and evolution.Microbiological Review 58, 491-562.

Strauss, E. G., Rice, C. M. & Strauss, J. H. (1984). Complete nucleotide sequence of the genomic RNA of Sindbis virus.Virology 133, 92-110.[Medline]

Strauss, J. H., Calisher, C. H., Dalgarno, L., Dalrymple, J. M., Frey, T. K., Pettersson, R. F., Rice, C. M. & Spaan, W. J. M. (1995). Togaviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp. 428-433. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag.

Takkinen, K. (1986). Complete nucleotide sequence of the nonstructural protein genes of Semliki Forest virus.Nucleic Acids Research 14, 5667-5682.[Abstract/Free Full Text]

Weaver, S. C., Hagenbaugh, A., Bellew, L., Netesov, S. V., Volchkov, V. E., Chang, G. J., Clarke, D. K., Gousset, L., Scott, T. W., Trent, D. W. & Holland, J. J. (1993). A comparison of the nucleotide sequences of eastern and western equine encephalomyelitis viruses with those of other alphaviruses and related RNA viruses.Virology 197, 375-390.[Medline]

Received 9 November 1999; accepted 17 January 2000.