Abstract
The C-terminal region of NS3 has polynucleotide-stimulated NTPase activity (Suzich et al., 1993 ; Gwack et al., 1995 ; Preugschat et al., 1996 ; Porter, 1998 ; Gallinari et al., 1998 ), duplex unwinding activity (Kim et al., 1995 ; Jin & Peterson, 1995 ; Preugschat et al., 1996 ; Tai et al., 1996 ; Gwack et al., 1996 ; Porter, 1998 ; Gallinari et al., 1998 ) and single-stranded polynucleotide binding activity (Tai et al., 1996 ; Gwack et al., 1996 ; Kanai et al., 1995 ; Gallinari et al., 1998 ). The minimal requirement for these activities lies within the C-terminal 465 amino acids of NS3, which represent a functionally and structurally separate domain (Kim et al., 1995 ). Helicases are enzymes capable of unwinding duplex DNA or RNA (Lohman & Bjornson, 1996 ) in a reaction coupled with the hydrolysis of NTP, which is required to generate the energy needed to disrupt the hydrogen bonds that keep the two polynucleotide strands annealed. Accordingly, all helicases characterized to date possess polynucleotide-stimulated NTPase activity. The helicase protein family includes members from both prokaryotic and eukaryotic cells as well as from numerous DNA or RNA viruses. Proteins of this family play various roles in different biochemical processes involved in DNA metabolism (replication, repair and genome recombination) (Lohman & Bjornson, 1996 ; Matson et al., 1994 ) and RNA metabolism (transcription, splicing or processing, transport and translation initiation of RNA) (Lüking et al., 1998 ). Helicases may also play critical roles in various processes involved in the life-cycle of many DNA and RNA viruses, including genome replication and recombination, RNA transcription and translation (Gorbalenya & Koonin, 1993 ; Kadaré & Haenni, 1997 ).
The HCV NS3 helicase has some unique properties: it can unwind dsRNA as well as dsDNA and RNA/DNA heteroduplexes in the 3' to 5' direction using any NTP or dNTP as the energy source (Tai et al., 1996 ). Like the other members of the so-called DEXH family (Gorbalenya et al., 1989 , 1990 ), NS3 helicase contains six conserved sequence motifs (numbered I to VI). Several mutational studies (Heilek & Peterson, 1997 ; Kim et al., 1997 ; Wardell et al., 1999 ) related to recently acquired structural information (Yao et al., 1997 ; Kim et al., 1998 ) have demonstrated a defined function for four of these motifs in the NS3 helicase. Motif I (GSGKT, or Walker motif A) is involved in binding the terminal phosphate groups of the nucleotide cofactor, whereas the acidic residues of motif II (DECH, or Walker motif B) are responsible for chelating the Mg2+ ion of the MgNTP complex. The histidine residue of motif II together with motif III (TAT box) and the conserved glutamine and arginine residues of motif VI (QRXGRXGR) are implicated in coupling NTP hydrolysis to nucleic acid unwinding. Three different crystal structures of the isolated NS3 helicase domain have been determined to date (Yao et al., 1997 ; Kim et al., 1998 ; Cho et al., 1998 ). On the basis of these studies, NS3 can be considered to be part of a large class of helicases that have a 3' to 5' directionality and share a number of structural features, despite the low identity in their primary amino acid sequences. Other representative members of this class include Rep and PcrA bacterial DNA helicases, for which a large amount of structural data has become available in recent years (Subramanya et al., 1996 ; Korolev et al., 1997 ; Velankar et al., 1999 ). For all three helicases, the NTP-binding site is situated in a cleft between domains 1 and 2 that is lined with the conserved motifs I to VI. Three different models for the mechanism of NS3 helicase have been proposed, one for each of the published crystal structures. To get a greater insight on the overall mechanism of unwinding, a mutationalfunctional study of full-length (FL) NS3 was performed. This analysis was based on an original molecular model of NS3 helicase domain bound to ssDNA, largely confirmed by the recently published crystal structure of the NS3 helicase(dU)8 complex (Kim et al., 1998 ). We have expressed in Escherichia coli and purified to homogeneity three FL-NS3 mutated proteins containing Y(392)A, V(432)G and W(501)A single substitutions, respectively, and a Y(392)A/W(501)A double-substituted protein. Their enzymatic properties, in terms of unwinding capability, binding to RNA, processivity, basal and RNA-induced ATPase activity and proteolytic efficiency were analysed and compared to those of wild-type (wt) FL-NS3. While the results obtained with W(501)A and V(432)G single-point mutants are in agreement with a recently proposed model for NS3 unwinding activity on the basis of the three-dimensional structure of the NS3ssDNA complex (Kim et al., 1998 ), the mutant phenotype of the Y(392)A and Y(392)A/W(501)A enzymes represents a completely novel finding.
Construction of a model for the NS3ssDNA complex.Since the coordinates of the RepssDNA complex (Korolev et al., 1997 ) were initially not available, a model of a PcrAssDNA complex was constructed, taking advantage of the high sequence identity between PcrA and Rep. This model was then manually superimposed onto the NS3 helicase domain. To obtain an approximate model of the NS3ssDNA complex, the conformation of the oligo(dT) substrate from the PcrAssDNA model was then adjusted to bind the NS3 domain as shown in Fig. 1(a). Coordinates used were 1HEI (Yao et al., 1997 ) for NS3 and 1PJR (Subramanya et al., 1996 ) for PcrA from the PDB database (http://www.rcsb.org/pdb/). All modelling was performed using the INSIGHT II software (MSI, San Diego, US).
|
Construction of plasmids and site-directed mutagenesis.
The cDNA fragment encoding wt FL-NS3 (residues 10271657 of the BK strain HCV polyprotein) was cloned in the pET14b expression vector (Novagen) as described (Paolini et al., 2000 ). The resulting plasmid (pET-NS3 wt) was used as a template for PCR-mediated site-directed mutagenesis. The Y(392)A and W(501)A single-mutant DNA fragments were obtained using the following pairs of oligo primers: (1) 5' GTGCGACGAGCTCGCCGCAAAGCTGTCAGGCCTCGGAATCAACGCTGTGGGTATGCCCGG 3', carrying the TAC to GCC mutated codon for Y(392)A, and (2) 5' CCGGGGTGAGCTCGTACCAAGCACAGCCCGCGTCATAGCAC 3', wt; (3) 5' GTGCGACGAGCTCGCCGCAAAGCTGTCAGGCCTCGGAATCAACG CTGTGGGTATTACCGG 3', wt; and (4) 5' CCGGGGTGAGCTCGTACGCAGCACAGCCCGCGTCATAGCAC 3', carrying the CCA to CGC complementary mutated codon for W(501)A. The Y(392)A/W(501)A double-mutant DNA fragment was obtained using oligo primers (1) and (4). The PCR-amplified DNA fragments were digested with SacI and inserted into the SacI site of pET-NS3 wt. The V(432)G single-mutant DNA fragment was obtained using the oligo primers (5) 5' GGACCGTTTACCATGGTGCTGGCTCAAAGACC 3', wt; and (6) 5' GGTGGGATCCAAGCTGAAGTCGACTGTCTGGGTGCCAC 3', carrying the GAC to GCC complementary mutated codon for V(432)G. The PCR-amplified DNA fragment was digested with BstXI and BamHI and inserted into the same sites of pET-NS3 wt. Automatic sequencing (Applied Biosystem 373 DNA sequencer) was used to confirm mutations and exclude other incidental variations.
Protein expression and purification.
The recombinant proteins containing an N-terminal hexahistidine tag were expressed in E. coli BL21 (DE3) cells (Studier et al., 1998 ) and purified as described (Paolini et al., 2000 ). Briefly, soluble proteins were purified by three subsequent chromatographic steps on a Ni2+-charged HiTrap metal-chelating column, a Superdex 200 26/60 gel filtration column and a poly(U)Sepharose affinity column (Pharmacia). Proteins were confirmed to be greater than 95% pure by SDSPAGE. Concentration was estimated by Bio-Rad assay and UV absorption spectroscopy at 280 nm by using a molar extinction coefficient of 64200 M-1 cm-1.
Protease assays.
Cleavage of the NS5A-NS5B peptide substrate (H-EAGDDIVPC/SMSYTWTGA-OH) was performed in 60 µl of a buffer containing 50 mM HEPES (pH 7·5), 0·1% Triton X-100, 50% glycerol and 10 mM DTT. Saturating amounts (50 µM) of a cofactor peptide spanning the central hydrophobic core (amino acids 2134) of NS4A and containing an N-terminal three-lysine tag (Pep4AK) were pre-incubated for 15 min at 23 °C with 2 nM enzyme. The reaction was started by addition of the substrate to the final desired concentrations. Incubation times at 23 °C were adjusted to obtain <10% conversion. Reactions were stopped by addition of 40 µl of 1% TFA to the reaction mixtures. Cleavage of the peptide substrate was determined by HPLC and quantified by integration of chromatograms with respect to appropriate standards, as described (Gallinari et al., 1999 ).
Helicase assays.
The partial dsRNA substrate was obtained by annealing the 45u RNA oligonucleotide (template strand) with both 15l/5' (release strand) and 15l/3' complementary RNA oligonucleotides, as described (Paolini et al., 2000 ). The release strand was 5'-end-labelled with [γ-32P]ATP by T4 polynucleotide kinase. The unwinding reactions were performed in 20 µl of helicase activity buffer [25 mM MOPS-NaOH (pH 7), 2·5 mM DTT, 2·5 U RNasin (Promega), 100 µg/ml BSA, 5% glycerol and 3 mM MgCl2] containing 32P-labelled RNA substrate and the enzymes at the indicated concentrations. After pre-incubation for 15 min at 23 °C, 5 mM ATP was added to start the reaction, which was carried out at 37 °C for 30 min, unless otherwise specified, and stopped by adding 5 µl of termination buffer. For analysis under single processive cycle conditions, assays were performed in the presence of 100 µg/ml of heparin, as described (Paolini et al., 2000 ). The helicase substrate was obtained by annealing the unlabelled 3a ssDNA oligonucleotide (35 nt, template strand) with the 5'-32P-labelled 4a ssDNA oligonucleotide (15 nt, release strand). Unlabelled dsDNA oligonucleotide 1 (20 nt) and 4a, both complementary to the template strand, were added together with ATP at a concentration 15-fold higher than substrate to prevent product re-annealing during the reaction in the presence of heparin. Aliquots (8 µl) were analysed on native 8% polyacrylamide/0·5x TBE gels. Strand separation was visualized by autoradiography, and the efficiency of unwinding was calculated by quantification of the radioactivity with PhosphorImager and ImageQuant software.
RNA binding and ATPase assays.
Gel retardation assays were performed in helicase activity buffer (20 µl) lacking MgCl2 and ATP and containing 1·25 nM of either 5'-32P-labelled 45u RNA oligonucleotide (ssRNA) or 32P-labelled partial dsRNA. After incubation for 20 min at 23 °C, aliquots were electrophoresed on native 6% polyacrylamide/0·25x TBE gels and quantification of the radioactivity was performed as for the helicase assays.
ATPase assays were performed in helicase activity buffer (10 µl) containing 1 mM ATP and 2 µCi of [γ-32P]ATP for 30 min at 37 °C in the absence or presence of 0·1 mM poly(U) (UMP). [γ-32P]ATP hydrolysis was determined by monitoring the released [32P]phosphoric acid by separation using thin layer chromatography, as described (Gallinari et al., 1998 ). Quantification was performed as above.
Molecular model of the NS3 helicase domain bound to ssDNAReplacement of the conserved residues in the ATPase/helicase motifs (I, II, III and VI) was shown to severely impair both NS3 functions (Kim et al., 1997 ; Wardell et al., 1999 ). However, no significant decrease of ssRNA binding activity has been observed with either of these mutations. Therefore, we attempted to identify and mutagenize NS3 residues that might be involved in binding the single-stranded region of the substrate in a molecular model of the NS3ssDNA complex (Fig. 1a). This model was constructed by combining data from the NS3 helicase domain (Yao et al., 1997 ) and the E. coli RepssDNA complex (Korolev et al., 1997 ) crystal structures. In fact, NS3 helicase domains 1 and 2 fold in a similar way to domains 1A and 2A of Rep helicase, but with a slightly different connectivity (Bird et al., 1998 ). The third domain has no structural similarity with Rep but sits in a position roughly equivalent to that occupied by domain 1B in the DNA helicase (Korolev et al., 1998 ). Since in the RepssDNA structure stacking of bases against aromatic residues such as Phe183 and Trp250 represented the most prominent feature of interaction, we sought to identify similarly exposed residues in NS3. While the completely exposed Trp501 was readily identified as a possible equivalent of Rep Phe183, the contact point equivalent to Trp250 was less obvious. However, assuming that the quite different domain architecture of the two helicases (Rep has two large insertions in the conserved helicase domain 1A and 2A, while NS3 has instead an additional C-terminal domain) was also reflected in a slightly different mode of binding to the substrate, we reasoned that the exposed Tyr392 of NS3 (Fig. 1a) could serve a similar function. Val432, albeit close to oligo(dT) in the model, was initially not mutagenized, since it seemed a less likely candidate for making contact with ssDNA. The recently determined crystal structure of the NS3 helicase domain in complex with a (dU)8 oligonucleotide (Kim et al., 1998 ) confirmed the role of Trp501 in anchoring the protein to DNA by stacking with the base of dU8, while Val432 was shown to interact with the dU4 base. Therefore, we have introduced in the FL-NS3 coding sequence point mutations to generate three single amino acid substitutions, Y(392)A, V(432)G in domain 2, and W(501)A in domain 3, together with a Y(392)A/W(501)A double substitution (Fig. 1b).
Expression and purification of FL-NS3 mutated forms
All FL-NS3 variants were expressed in E. coli and purified to homogeneity (Fig. 1b). An N-terminal hexahistidine tag was added to facilitate purification and a previously devised protocol for the production of soluble His-tagged FL-NS3 was used (Paolini et al., 2000 ). Normalized amounts of each purified protein were analysed by SDSPAGE and Coomassie blue staining to ensure that similar quantities of different NS3 variants were used in the comparative study of their enzymatic activities (Fig. 1 b). The purified wt and mutated proteins were homogeneous and obtained at very similar yields (510 mg/l of bacteria).
Analysis of NS4A-stimulated protease activity associated with FL-NS3 mutants
Kinetic analysis of the cleavage reaction of an NS5A-NS5B peptide substrate was performed under previously optimized conditions (see Methods) in the presence of saturating amounts of Pep4AK cofactor using 2 nM wt and mutant FL-NS3 enzymes. Eight data points at increasing substrate concentrations between 0·78 and 100 µM were determined to calculate the kinetic parameters shown in Table 1. The correct overall folding of the mutated proteins was confirmed by the result of this comparative analysis. Indeed, all mutant enzymes possessed a catalytic efficiency (kcat) and an affinity for the protease substrate (Km) (Table 1) and for Pep4AK cofactor (Kd=1 µM, not shown) identical to those exhibited by wt NS3. These data are consistent with our previous observation that the presence of the C-terminal helicase domain does not significantly influence the proteolytic activity associated with the N-terminal domain (Gallinari et al., 1998 ).
Table 1. Pep4AK-stimulated protease activity associated with FL-NS3 point mutants
RNA unwinding activities of FL-NS3 mutated forms
Fig. 2 shows the RNA helicase activities of the NS3 mutants. With wt and single-mutant NS3 proteins, the amount of unwound product increased as a function of protein concentration. However, all mutated enzymes showed a decreased unwinding activity compared to wt. Consistent with what was predicted on the basis of the three-dimensional structure, both V(432)G and W(501)A single-mutants showed a similar reduction of helicase efficiency to 30% and 40% of wt levels, respectively (Fig. 2b and Table 2). The affinity of these mutants for the helicase RNA substrate was also decreased to 27% and 21% of that shown by the wt enzyme. Interestingly, replacement of Tyr392 with Ala resulted in the most pronounced decrease both of the unwinding efficiency (60% reduction of wt activity) and of the affinity for the helicase substrate (15% of the wt value) (Fig. 2b and Table 2), although, different from V432 and W501, this tyrosine residue does not directly interact with ssDNA in the crystal structure. This result was corroborated by the complete loss of RNA helicase activity caused by the simultaneous substitution of both Y392 and W501 residues (Fig. 2).
|
Table 2. Comparison of unwinding, binding and RNA-stimulated ATPase activities associated with wt and mutant FL-NS3 enzymes
RNA binding activities of FL-NS3 mutated proteins
RNA binding activities of both wt and mutated proteins were measured by gel mobility shift assay using either a single-stranded (Fig. 3a, b and Table 2) or a partial double-stranded (Table 2) RNA probe. NS3 W(501)A mutant showed the most pronounced defect in the interaction with RNA. Different from the other mutated enzymes, W(501)A ssRNA binding activity did not reach a plateau up to 100 nM protein concentration (Fig. 3b). Furthermore, the residual binding activity associated with this mutant was 7% on ssRNA and 4% on partial dsRNA compared to the wt protein at the same concentration (12·5 nM and 50 nM, respectively) (Table 2). This result confirms the anticipated role of Trp501 in anchoring the protein to the single-stranded region of the nucleic acid substrate. Y392 and V432 residues were also shown to contribute to the overall affinity of the enzyme for RNA, but to a lesser extent. In fact, both Y(392)A and V(432)G mutated proteins were able to bind quantitatively the ssRNA probe at high protein concentrations (higher than 50 nM) (Fig. 3b). At a concentration of 12·5 nM, their residual binding activity on ssRNA was equal to 40% and 30% of wt, respectively, whereas at a concentration of 50 nM, the interaction with partial dsRNA was reduced to 7% and 10% of wt, respectively (Table 2). This latter result indicates that the reduction of binding activity measured with Y(392)A and V(432)G was more significant on partial dsRNA than on ssRNA, thus suggesting that additional contacts with the double-stranded region of the nucleic acid probe could be lost upon replacement of these residues. The simultaneous substitution of both Y392 and W501 (Fig. 3) completely impaired NS3 capacity to bind RNA, thus explaining the observed loss of RNA helicase activity.
|
ATPase activity of FL-NS3 mutated variants
The basal and poly(U)-stimulated ATPase activities of FL-NS3 and its mutated forms are shown in Fig. 4(a, b, respectively). Since all enzymes, including that containing the Y(392)A/W(501)A double substitution, possessed wt intrinsic ATPase activity (Fig. 4a), the mutations apparently had not altered the geometry of the ATP-binding site and the catalytic mechanism of ATP hydrolysis. This is an additional indication that the reduction or loss of the other NS3 enzymatic functions was unlikely to arise from gross disruption of protein structure caused by the amino acid substitutions. The ATPase activity of wt NS3 was stimulated more than tenfold in the presence of poly(U). The RNA-stimulated ATPase activity of Y(392)A and V(432)G mutants was only partially impaired (Fig. 4b and Table 2), whereas a more substantial decrease was observed with the W(501)A mutant, which correlated with the severe reduction of its RNA binding activity. The Y(392)A/W(501)A double-mutant showed the most pronounced decrease of poly(U)-induced ATP hydrolysis, as expected.
|
Notably, the defect in the RNA-mediated stimulation observed with all NS3 mutant forms did not result in a reduction of the Vmax of the ATPase reaction, but only in an increase of the apparent Km for ATP (Fig. 4b and Table 2).
Processivity of duplex unwinding by FL-NS3 mutated forms
Time-courses of duplex unwinding (Fig. 5) revealed that both wt and mutated NS3 enzymes reached the plateau of the reaction after only 5 min of incubation at the protein concentrations tested. Notably, eightfold more protein was needed with all mutants to reach the same plateau value obtained with wt NS3 during continuous unwinding, thus confirming the observed defect in their helicase activity. To analyse whether the differences in helicase activity shown by wt NS3 and its mutated forms could reflect a different processivity of duplex unwinding, their helicase efficiencies were compared in time-course experiments under single processive cycle conditions. To this aim, heparin was used to trap both free enzyme molecules as well as those dissociating from the substrate during the course of the reaction (Paolini et al., 2000 ). In these experiments, heparin was added either before the enzymes or together with ATP after pre-incubation of the proteins with the helicase substrate. Heparin completely inhibited the helicase activity of all NS3 variants when present in the reaction before the enzymes were added by fully preventing the formation of proteinsubstrate initiation complexes. Residual activity was instead observed when heparin was added together with ATP. In this latter case, only the activity of those enzyme molecules bound to the substrate before the addition of the trapping agent can be observed and re-initiation events are prevented. Therefore, the percentage of activity lost upon heparin addition is an indirect measure of the number of re-initiation events during continuous unwinding. As shown in Fig. 5, the maximal concentration of strand released in the presence of the trapping agent represented approximately 3040% of that measured in the absence of heparin with all NS3 variants. These data suggest that the mutations did not significantly alter the re-initiation rate of NS3 helicase. On the other hand, strand release measured in the presence of heparin is the result of a single processive cycle of unwinding and represents therefore an index of helicase processivity. As shown in Fig. 5, 0·04 nM ssDNA was released/nM wt NS3, whereas 0·0040·006 nM product was measured/nM mutated NS3. This result suggests that the mutant enzymes are substantially less processive than wt, producing a significantly smaller amount of unwound product before dissociating from the substrate and being trapped by heparin. However, a 20:1 protein:substrate ratio was required with all mutated forms to reach maximal activity under single cycle conditions, whereas only a fivefold excess of wt protein was needed to saturate the available substrate under the same conditions. These data indicate that the observed seven- to tenfold difference between wt and mutant NS3 processive unwinding activity might be explained, at least in part, by a reduction of the binding affinity of the mutant enzymes for the substrate single-stranded region. This would affect the number of proteinsubstrate initiation complexes formed prior to the addition of the trapping molecule, thus resulting in a lower level of helicase activity.
|
The production of native full-length forms of the mutated variants allowed us to analyse whether the amino acid substitutions had an influence not only on the enzymatic activities associated with the helicase domain, but also on the protease function associated with the N-terminal domain. The correct overall folding of the mutated proteins was confirmed by comparing their proteolytic activities with that of the wt enzyme. In fact, kinetic parameters of cleavage calculated with all mutant proteins were identical to those exhibited by wt NS3 (Table 1). Consistent with what was predicted on the basis of our three-dimensional model and the X-ray structure, both W(501)A and V(432)G showed a similar reduction of the helicase activity compared to wt. Unexpectedly, the Y(392)A substitution determined the most pronounced decrease of the unwinding efficiency and increase of the apparent Km for the helicase substrate (Fig. 2 and Table 2), although, different from W501 and V432, this tyrosine residue does not appear to directly interact with ssDNA in the crystal structure. On the contrary, the NS3 W(501)A mutant showed the most severe reduction in ssRNA (and partial dsRNA) binding activity (Fig. 3 and Table 2), which correlated with a significant decrease of its RNA-stimulated ATPase (Fig. 4b and Table 2). These observations are in agreement with those published in a recent report (Lin & Kim, 1999 ) where the same mutation was introduced in the isolated NS3 helicase domain, confirming the essential role of W501 in stabilizing the enzymessDNA complex. However, the reduction of unwinding activity caused by the W(501)A mutation in the context of the isolated helicase domain, reported by these authors, was significantly more pronounced than that observed in our study in the context of the full-length enzyme where only the introduction of a second substitution, Y(392)A, resulted in a complete loss of helicase activity (Fig. 2 and Table 2). This partial discrepancy could be explained assuming additional stabilization of the active helicase conformation of the enzyme mediated by the presence of the N-terminal domain. Interestingly, the Y(392)A/W(501)A double-mutant showed a strongly reduced ssRNA binding capacity and poly(U)-mediated stimulation of its ATPase activity (Figs 3 and 4b; Table 2) which fully correlates with the severe defect in unwinding activity. The interaction of V(432)G and Y(392)A mutants with ssRNA (Fig. 3 and Table 2) and their poly(U)-stimulated ATPase activity (Fig. 4b and Table 2) were only mildly impaired. Consistent with the X-ray structure (Kim et al., 1998 ), V432 could be anticipated to form less extensive interactions with the nucleic acid substrate than the aromatic ring of W501. The phenotype associated with the substitution of Tyr392 in the single- and double-mutants was instead less predictable. Replacement of Tyr392 with Ala may, however, cause a local conformational change that indirectly affects the interaction of neighbouring residues (R393, K371) with the substrate during translocation, thus explaining its significant defect in helicase activity. Notably, all mutated proteins showed wt levels of basal ATPase activity (Fig. 4 a), indicating that none of the introduced substitutions interferes with the structural requirements for the intrinsic catalytic mechanism of ATP hydrolysis and, more generally, with the overall structural integrity of the mutants. Furthermore, the defect in RNA-mediated stimulation did not result in a reduction of the turnover number for ATP hydrolysis, but only in a decrease of the affinity for ATP, which should be directly influenced by the interaction with ssRNA according to the mechanistic model recently proposed for helicase action (see below).
All single-mutated NS3 variants were shown to act processively, as implied by their unwinding activity under single processive cycle conditions (Fig. 5). The results obtained in the presence of heparin suggest that the mutant enzymes are substantially less processive than those of the wt. However, the observed difference between wt and mutant NS3 processive unwinding activity could be ascribed, at least in part, to a reduction in the number of proteinsubstrate initiation complexes formed prior to the addition of the trapping molecule and ATP. In fact, the evidence discussed above clearly demonstrates that high affinity binding to ssRNA is affected by the introduction of the single amino acid substitutions. On the other hand, comparison of unwinding under continuous and single processive cycle conditions revealed no significant differences among all NS3 variants in the percentage of residual activity measured upon addition of heparin, thus indicating that the re-initiation rate of unwinding is unaffected by the introduced mutations. This observation would imply that the reduction in RNA binding affinity observed with the mutants produces only a negligible effect, if any, on the re-association with the substrate in the presence of ATP during continuous unwinding. Preliminary data supporting this hypothesis indicate that addition of an ATP nonhydrolysable analogue (AMP-PCP; Paolini et al., 2000 ) increases the affinity of the mutant enzymes for the partial duplex helicase substrate at levels similar to wt NS3 (not shown).
Our mutational analysis of residues V432 and W501 is consistent with the mechanistic model accompanying the published NS3 helicaseDNA binary structure (Kim et al., 1998 ). In this model, binding of ATP to motif I and II of the polynucleotide-bound NS3 helicase determines a conformational change in the enzyme which results in the closure of the cleft between domains 1 and 2 through the stabilization of the ATPprotein complex via additional interactions with motif VI. Closure of the interdomain cleft leads to translocation of domains 1 and 3 as a rigid unit in the 3' to 5' direction along the bound polynucleotide strand. Hydrolysis of ATP then facilitates reopening of the cleft and release of ADP with a concomitant movement of domain 2 in the same direction. During this process, W501 and V432 alternatively disrupt base stacking at either end of the single-stranded region. The interactions mediated by these two residues are predicted to ensure a net translocation of the helicase in the 3' to 5' direction by preventing the bound polynucleotide from slipping back in the opposite direction. Nevertheless, most of the interactions between enzyme and bound oligonucleotide involve hydrogen bonds with the phosphate backbone and not the nucleotide bases (Kim et al., 1998 ; Lin & Kim, 1999 ).
Although our data show evidence of the roles of individual residues in the overall function of FL-NS3 helicase, more detailed functional and structural studies are required to completely elucidate the mechanism of duplex unwinding. For instance, in the proposed model, helicase activity is a passive process in that NS3 operates by simply translocating along ssRNA/DNA as it is produced by a transient fraying of the base pairs at the fork. However, additional interactions with the double-stranded region of the substrate might be required for active destabilization of the helix and strand separation, as proposed for oligomeric enzymes such as Rep (Lohman & Bjornson, 1996 ) and, more recently, also for the monomeric PcrA DNA helicase (Velankar et al., 1999 ). Second, the model hardly reconciles the footprint of eight bases observed in the enzymessDNA structure with the two nucleotide step size estimated for translocation and unwinding of the duplex region (Porter et al., 1998 ). Moreover, the path taken by the second single strand released from the duplex is very difficult to predict on the basis of the available information. Finally, no evidence has been produced to date to understand whether the association with other cellular and/or viral proteins might modulate the helicase activity of NS3. The role of NS3 unwinding activity in HCV replication remains obscure, but an RNA helicase function is thought to be necessary to achieve separation of the RNA positive- and negative-strands during replication of the viral genome. The availability of tissue culture systems permissive for HCV replication would allow elucidation of the biological role of NS3 unwinding function in the virus life-cycle.
We are indebted to L. Tomei and C. Steinkühler for critically reviewing this manuscript. We thank M. Emili for artwork.References
Bird, L. E., Subramanya, H. S. & Wingley, D. B. (1998). Helicases: a unifying structural theme? Current Opinion in Structural Biology 8, 14-18.[Medline]
Cho, H.-S., Ha, N.-C., Kang, L.-W., Chung, K. M., Back, S. H., Jang, S. K. & Oh, B.-H. (1998). Crystal structure of RNA helicase from genotype 1b hepatitis C virus. Journal of Biological Chemistry 273, 15045-15052.
Choo, Q.-L., Kuo, G., Weiner, A. J., Overby, L. R., Bradley, D. W. & Houghton, M. (1989). Isolation of a cDNA clone derived from a blood-borne non-A non-B viral hepatitis genome. Science 244, 359-362.
Clarke, B. (1997). Molecular virology of hepatitis C virus. Journal of General Virology 78, 2397-2410.[Medline]
De Francesco, R., Pessi, A. & Steinkühler, C. (1998). The hepatitis C virus NS3 proteinase: structure and function of a zinc-containing serine proteinase. In Therapies for Viral Hepatitis, pp. 235-245. Edited by R. F. Schinazi, J.-P. Sommadossi & H. C. Thomas. London: International Medical Press.
Gallinari, P., Brennan, D., Nardi, C., Brunetti, M., Tomei, L., Steinkühler, C. & De Francesco, R. (1998). Multiple enzymatic activities associated with recombinant NS3 protein of hepatitis C virus. Journal of Virology 72, 6758-6769.
Gallinari, P., Paolini, C., Brennan, D., Nardi, C., Steinkühler, C. & De Francesco, R. (1999). Modulation of hepatitis C virus NS3 protease and helicase activities through the interaction with NS4A. Biochemistry 38, 5620-5632.[Medline]
Gorbalenya, A. E. & Koonin, E. V. (1993). Helicases: amino acid sequence comparison and structurefunction relationship. Current Opinion in Structural Biology 3, 419-429.
Gorbalenya, A. E., Koonin, E. V., Donchenko, A. P. & Blinov, V. M. (1989). Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Research 17, 4713-4730.
Gorbalenya, A. E., Koonin, E. V. & Wolf, Y. I. (1990). A new family of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses. FEBS Letters 262, 145-148.[Medline]
Gwack, Y., Wook, D., Han, J. H. & Choe, J. (1995). NTPase activity of hepatitis C virus NS3 protein expressed in insect cells. Molecular Cell 5, 171-175.
Gwack, Y., Kim, D. W., Han, J. H. & Choe, J. (1996). Characterization of RNA binding activity and RNA helicase activity of the hepatitis C virus NS3 protein. Biochemical and Biophysical Research Communications 225, 654-659.[Medline]
Heilek, G. M. & Peterson, M. G. (1997). A point mutation abolishes the helicase but not the nucleoside triphosphatase activity of hepatitis C virus NS3 protein. Journal of Virology 71, 6264-6266.[Abstract]
Jin, L. & Peterson, D. L. (1995). Expression, isolation, and characterization of the hepatitis C virus ATPase/RNA helicase. Archives of Biochemistry and Biophysics 323, 47-53.[Medline]
Kadaré, G. & Haenni, A.-L. (1997). Virus-encoded RNA helicases.Journal of Virology 71, 2583-2590.[Medline]
Kanai, A., Tanabe, K. & Kohara, M. (1995). Poly(U) binding activity of hepatitis C virus NS3 protein, a putative RNA helicase. FEBS Letters 376, 221-224.[Medline]
Kim, D. W., Gwack, Y., Han, J. H. & Choe, J. (1995). C-terminal domain of the hepatitis C virus NS3 protein contains an RNA helicase activity. Biochemical and Biophysical Research Communications 215, 160-166.[Medline]
Kim, D. W., Kim, J., Gwack, Y., Han, J. H. & Choe, J. (1997). Mutational analysis of the hepatitis C virus RNA helicase. Journal of Virology 71, 9400-9409.[Abstract]
Kim, J. R., Morgernstern, K. A., Griffith, J. P., Dwyer, M. D., Thomson, J. A., Murcko, M. A., Lin, C. & Caron, P. R. (1998). Hepatitis C virus NS3 RNA helicase domain with a bound oligonucleotide: the crystal structure provides insights into the mode of unwinding. Structure 6, 89-100.[Medline]
Korolev, S., Hsieh, J., Gauss, G. H., Lohman, T. M. & Waksman, G. (1997). Major domain swivelling revealed by the crystal structures of complexes of E. coli Rep helicase bound to single-stranded DNA and ADP. Cell 90, 635-647.[Medline]
Korolev, S., Yao, N., Lohman, T. M., Weber, P. C. & Waksman, G. (1998). Comparisons between the structures of HCV and Rep helicases reveal structural similarities between SF1 and SF2 super-families of helicases. Protein Science 7, 605-610.[Abstract]
Kwong, A. D., Kim, J. L., Rao, G., Lipovsek, D. & Raybuck, S. A. (1998). Hepatitis C virus NS3/4A protease. Antiviral Research 40, 1-18.[Medline]
Lin, C. & Kim, J. L. (1999). Structure-based mutagenesis study of hepatitis C virus NS3 helicase. Journal of Virology 73, 8798-8807.
Lohman, T. M. & Bjornson, K. P. (1996). Mechanisms of helicase-catalyzed DNA unwinding. Annual Review of Biochemistry 65, 169-214.[Medline]
Lohmann, V., Koch, J. O. & Bartenschlager, R. (1996). Processing pathways of the hepatitis C virus proteins. Journal of Hepatology 24, 11-19.[Medline]
Lüking, A., Stahl, U. & Schmidt, U. (1998). The protein family of RNA helicases. Critical Reviews in Biochemistry and Molecular Biology 33, 259-296.[Medline]
Matson, S. W., Bean, D. W. & George, J. W. (1994). DNA helicases: enzymes with essential roles in all aspects of DNA metabolism. Bioassays 16, 13-22.[Medline]
Paolini, C., De Francesco, R. & Gallinari, P. (2000). Enzymatic properties of hepatitis C virus NS3-associated helicase. Journal of General Virology 81, 1335-1345.
Porter, D. J. T. (1998). A kinetic analysis of the oligonucleotide-modulated ATPase activity of the helicase domain of the NS3 protein from hepatitis C virus. Journal of Biological Chemistry 273, 14247-14253.
Porter, D. J. T., Short, S. A., Hanlon, M. H., Preugschat, F., Wilson, J. E., Willard, D. H.Jr & Consler, T. G. (1998). Product release is the major contributor to kcat for the hepatitis C virus helicase-catalyzed strand separation of short duplex DNA.Journal of Biological Chemistry 273, 18906-18914.
Preugschat, F., Averett, D. R., Clarke, B. E. & Porter, D. J. T. (1996). A steady-state and pre-steady state kinetic analysis of the NTPase activity associated with the hepatitis C virus NS3 helicase domain.Journal of Biological Chemistry 271, 24449-24457.
Rice, C. M. (1996). Flaviviridae: the viruses and their replication. In Fields Virology, pp. 931-960. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1998). Use of the T7 RNA polymerase to direct expression of cloned genes. Methods in Enzymology 185, 60-89.
Subramanya, H. S., Bird, L. E., Brannigan, J. A. & Wigley, D. B. (1996). Crystal structure of a DExx box helicase. Nature 384, 379-383.[Medline]
Suzich, J. A., Tamura, J. K., Palmer Hill, F., Warrener, P., Grakoui, A., Rice, C. M., Feinstone, S. M. & Collett, M. S. (1993). Hepatitis C virus NS3 protein polynucleotide-stimulated nucleoside triphosphatase and comparison with the related pestivirus and flavivirus enzymes. Journal of Virology 67, 6152-6158.
Tai, C.-L., Chi, W.-K., Chen, D.-S. & Hwang, L.-H. (1996). The helicase activity associated with hepatitis C virus nonstructural protein 3 (NS3). Journal of Virology 70, 8477-8484.[Abstract]
Velankar, S. S., Soultanas, P., Dillingham, M. S., Subramanya, H. S. & Wigley, D. B. (1999). Crystal structures of complexes of PcrA DNA helicase with a DNA substrate indicate an inchworm mechanism. Cell 97, 75-84.[Medline]
Wardell, A. D., Errington, W., Ciaramella, G., Merson, J. & McGarvey, M. J. (1999). Characterization and mutational analysis of the helicase and NTPase activities of hepatitis C virus full-length NS3 protein. Journal of General Virology 80, 701-709.[Abstract]
Yao, N., Hesson, T., Cable, M., Hong, Z., Kwong, A. D., Le, H. V. & Weber, P. C. (1997). Structure of the hepatitis C virus RNA helicase domain. Nature Structural Biology 4, 463-467.[Medline]
Received 14 January 2000; accepted 31 March 2000.