Research Article

Polyomavirus persistence in lymphocytes: prevalence in lymphocytes from blood donors and healthy personnel of a blood transfusion centre

Journal of General Virology 2000; 81(8):1967

PubMed

Abstract

BK and JC polyomaviruses (BKV and JCV) are widespread in humans and are thought to persist and reactivate under immune alterations. In addition to the kidney, lymphoid cells have been proposed as a site of latency. However, while this was shown to occur in immunocompromised patients, discordant data were published for healthy humans. To help to solve this issue, an extensive study (231 healthy subjects) was carried out on peripheral blood mononuclear cells (PBMC) from blood donors of two towns and from operators of a blood transfusion centre. To discriminate between past and recent infection, nested PCRs for BKV and JCV non-coding control region (NCCR) and VP1 DNA sequences were carried out. Twenty-two per cent of subjects had BKV NCCR, but only 7% also had BKV VP1, as detected by PCR assays of similar sensitivities; the latter positivity was found to decrease with age. In both towns, the BKV WW archetypal DDP strain, subtype I, was found. Only 0·9% of subjects contained JCV DNA, for both NCCR and VP1. Blood operators presented a statistically significant increased prevalence of BKV NCCR (3·0-fold) and BKV VP1 (9·4-fold) sequences with respect to blood donors of comparable ages, suggesting the possibility of occupational risk of BKV (re)infection or reactivation. Since the possibility of amplifying BKV VP1 sequences from PBMC of healthy humans is lost with age, this suggests that PBMC are not a site of polyomavirus persistence in healthy individuals and that detection of BKV VP1 DNA in PBMC is probably indicative of recent infection or reactivation.
BK and JC polyomaviruses (BKV and JCV) are widespread among humans, since >90% of 10-year-old children and >80% of adults have antibody to BKV and JCV, respectively. Primary infection is generally asymptomatic; both viruses are thought to persist lifelong in the vast majority of humans and may be reactivated under immune alterations (Barbanti-Brodano et al., 1998 ; Dorries, 1998 ; Gallia et al., 1997 ). BKV has been associated in immunocompetent subjects with mild upper respiratory tract symptoms, occasional pyrexia and transient cystitis; in immunosuppressed patients, it is predominantly associated with urogenital tract diseases, particularly with haemorrhagic cystitis. JCV causes chronic meningoencephalitis and progressive multifocal leukoencephalopathy; the latter was a rare disease before the AIDS pandemic, while more than 10 % of human immunodeficiency virus (HIV)-infected patients are now believed to develop the condition. Both BKV and JCV have been associated with human tumours: BKV has been found repeatedly in human brain tumours, in insulinomas and in osteosarcoma cell lines (Barbanti-Brodano et al., 1998 ; Dorries, 1998 ; De Mattei et al., 1995 ) and a role for BKV T antigen in human tumour formation was recently proposed (Harris et al., 1998 ). The relationship of JCV with human tumours is far from clear (Barbanti-Brodano et al., 1998 ; Dorries, 1998 ; De Mattei et al., 1995 ); however, its association with human tumours of the central nervous system has recently emerged (Gordon et al., 1998 ). Despite these pathologies, in the vast majority of humans, polyomaviruses are thought to persist lifelong in a latent state.

The main site of BKV and JCV persistence in healthy humans is the kidney (Barbanti-Brodano et al., 1998 ; Dorries, 1998 ). Lymphoid cells have been proposed as another site of latency, since polyomavirus sequences have frequently been detected in blood cells from immunocompromised patients, either HIV-infected or transplanted (Tornatore et al., 1992 ; Sundsfjord et al., 1994 ; Azzi et al., 1996 ; Degener et al., 1997 ; Dubois et al., 1997 ; Lafon et al., 1998 ). As for healthy humans, discordant data on polyomavirus DNA detection in lymphoid cells have been published. In various studies, blood BKV positivity has varied from 0 to >90%: 0% (Sundsfjord et al., 1994 ), 52·8% (Azzi et al., 1996 ), 71% (De Mattei et al., 1995 ) and 94% (Dorries et al., 1994 ). JCV positivities in blood ranged from 0 to >80%: 0% (Sundsfjord et al., 1994 ; Tornatore et al., 1992 ), 2·3% (Lafon et al., 1998 ), 10% (Ferrante et al., 1998 ), 38·8% (Azzi et al., 1996 ) and 83% (Dorries et al., 1994 ). These studies employed either single or nested PCRs, detecting only a single genomic region (either the non-coding control region, NCCR, or the T antigen), generally with limited numbers of subjects, without information on gender or age and often without the real health status of the subjects being examined.

To help to clarify this issue, we analysed by nested PCR peripheral blood mononuclear cells (PBMC) from blood donors attending two blood transfusion centres and from transfusion centre operators, for a total of 231 healthy individuals, for the presence of both NCCR and VP1 DNA sequences of BKV and JCV. Gender, age, town of provenance and donor/operator status were also considered, in relation to the presence of one or both of the NCCR and VP1 genes.

Study population.
Healthy donors (n=231), aged 1863 years, were recruited from blood donors attending the Immunohaematology Unit of the Sassari ASL1 Blood Transfusion Centre (SSTC) (n=150) and the Italian Red Cross Blood Transfusion Centre in Rome (RMTC) (n=55) and from operators of the Immunohaematology Unit of the SSTC (n=26). Blood operators were interviewed for their health status and only data from healthy persons are reported in the present paper. Sex and age distributions are reported in Table 1.


Table 1. Prevalence of BKV and JCV DNA sequences in PBMC from healthy blood donors and blood operators (all ages)


Sample collection, DNA preparation and PCR.
PBMC were isolated from blood samples as described previously (Degener et al., 1999 ). One µg total DNA was used for each PCR. Suitability of DNA for analysis was checked by amplification of the β-globin gene sequence. General precautions, conditions for PCR analysis and nested PCR procedures were as published previously (Degener et al., 1999 ; Pietropaolo et al., 1998 ). β-Globin-positive samples were amplified in a Gene-Amp PCR System 2400 (Perkin-Elmer Cetus) and all assays included positive and negative controls. The PCR products were detected by ethidium bromide staining after electrophoretic migration through 3% agarose gels.

Primers for the NCCR of BKV and JCV.
Nested PCRs employed two pairs of primers that anneal to the invariant regions flanking the NCCR of BKV and JCV (Pietropaolo et al., 1998 ; Degener et al., 1999 ). Primers BKTT1(+) and BKTT2(-) generated a DNA fragment of 748 bp for BKV and of 724 bp for JCV (Flaegstad et al., 1991 ). The second pair, BK1(+) and BK2(-) for BKV and JC1(-) and JC2(+) for JCV, amplified a portion of the first-round PCR product, generating fragments of 354 and 308 bp, respectively, for BKV and JCV.

Primers for the VP1 region of BKV and JCV.
The nested PCR for BKV employed primers annealing to the region flanking the VP1 subtype-specific region of BKV (Jin et al., 1995 ). Primers VP1-7(+) and VP1-2R(-) generated a 579 bp fragment; the second pair, 327-1(+) and 327-2(-), were used to amplify a portion of the first-round PCR product, generating a fragment of 327 bp. The nested JCV VP1 PCR employed a first pair of primers annealing to the VP1 region, JC(+), 5' GAAGCAGAAGACTCTGGACATGGA 3', and JC(-), 5' GAAGCAGAAGACTCTGGACATGGA 3', that generated a fragment of 766 bp. The second pair of primers, VP3(+) and VP4(-), generated a fragment of 394 bp (Boldorini et al., 1998 ).

Nested PCR sensitivities.
These were estimated by amplification of serial dilutions of virus-infected tissue-culture fluids, as described by Pietropaolo et al. (1998) . Both NCCR and VP1 PCR assays reached the same dilution points. By this method, it was possible to detect as little as 10 attograms (i.e. 10-17 g) DNA.

Sequencing of BKV NCCR.
PCR products corresponding to BKV NCCR were purified and sequenced (Degener et al., 1999 ). Briefly, amplified products were purified prior to sequencing to remove the excess primers by using a QIAquick PCR purification kit, according to the QIAGEN protocol. DNA sequencing was performed by automatic DNA sequencer (Applied Biosystems model 370A), according to the manufacturers specifications (Amplicycle kit, Perkin-Elmer). Sequences were organized and analysed by using the Genetics Computer Group sequence analysis software package on a VAX computer.

RFLP assay.
In order to subtype BKV, VP1 PCR products were subjected to RFLP assay, as described previously (Degener et al., 1999 ; Jin et al., 1995 ). Ten µl amplified product was digested with 12 U of the appropriate endonuclease for 2 h at 37 °C, in a total volume of 20 µl of the supplied buffer. A two-step approach was performed: an AluI digestion enabled us to distinguish BKV subtypes I and II from subtypes III and IV; subsequently, the digestion patterns produced by XmnI and AvaII were used respectively to distinguish strains of subtype I from II and subtype III from IV. The reaction mixtures were then submitted to electrophoretic migration through 3% agarose gels and products were detected by ethidium bromide staining.

Data analysis.
Statistical analysis was carried out with the aid of the Epi Info database and statistics software program, version 6 (CDC/WHO, Atlanta, GA, USA).

Presence of BKV sequences
PBMC samples were processed for DNA extraction and PCR amplification. Data for all the subjects studied are reported in Table 1. As shown, 231 healthy subjects were analysed (151 males and 80 females), with positivities for BKV NCCR and BKV VP1 of 21·6% and 7·3%, respectively. A statistically significantly higher prevalence of BKV was observed in blood donors from the RMTC with respect to those attending the SSTC. BKV prevalence among SSTC operators was even higher; this difference was highly significant, both in toto and when subjects were divided for sex. VP1 prevalence in BKV NCCR+ PBMC of SSTC operators and SSTC donors was 45·4 and 21·7%, respectively (Fishers two-tailed test, P=0·01; Pearsons χ2 test, P=0·005); the difference was particularly apparent in males (75·0% and 26·5%), even though the small numbers meant that the difference was not statistically significant.

Since polyomavirus infection of humans increases steadily with age and the three cohorts differed for their mean age, individuals aged 40 years or over were selected (n=110). The data are reported in Table 2. Even though the three groups were now similar for mean age and 25th percentile (25%ile), they maintained the different BKV prevalence already observed. In particular, when individuals aged 40 or over were compared, the BKV NCCR and BKV VP1 prevalence of blood operators with respect to blood donors of the same town was 45·8 and 20·8% versus 15·2 and 2·2%, with increases in blood operators of 3·0- and 9·4-fold, respectively (P=0·005 and 0·008). Of particular note was the higher percentage of BKV VP1-positivity of BKV NCCR+ individuals among SSTC operators with respect to SSTC donors (75·0, 28·6 and 45·4% versus 25·0, 0 and 14·3% for males, females and all subjects).


Table 2. Prevalence of BKV and JCV DNA sequences in PBMC from healthy blood donors and blood operators (aged 40 years)


When comparing individuals presenting BKV NCCR or BKV VP1 sequences in their PBMC, the latter sequence was present only in BKV NCCR+ samples, and its presence was age-dependent. In fact, when the SSTC blood donor cohort (with a larger number of subjects and wider age distribution) was stratified for age, the values of BKV VP1-positivity in BKV NCCR+ subjects decreased with age (Table 3), with a statistically significant linear trend (slope=-0·19; P=0·05). Since the age of SSTC operators ranged from 34 to 60, SSTC blood donors of the same age interval were also compared: BKV VP1-positivities of BKV NCCR+ SSTC operators and SSTC blood donors were 5/11 and 0/10, respectively (Fishers two-tailed test, P=0·03; Pearsons χ2 test, P=0·01).


Table 3. Prevalence of BKV VP1 DNA sequences in BKV NCCR+ subjects stratified for age


Sequencing of BKV NCCR and RFLP analysis of BKV VP1
In order to verify the specificity of the amplified products and to detect the possible occurrence of genomic variants, BKV NCCR PCR products were sequenced from PBMC of four SSTC blood donors, three SSTC blood operators and four RMTC blood donors. BKV NCCR sequences of all individuals showed identical structural organization. When compared with the nucleotide sequences available in GenBank, the highest identity was found to the DDP strain (accession no. U91605; Degener et al., 1999 ). This strain shows maximum identity to the WW archetypal strain, since the P, Q and S boxes were perfectly conserved, whereas the R box was deleted (Degener et al., 1999 ; Rubinstein et al., 1987 ; Sundsfjord et al., 1990 ). As shown in Fig. 1, point mutations were found in the different sequences at positions 113, 119, 185, 217, 225 and 278. However, they did not involve known binding sites for transcription factors.



(21K):

Fig. 1. Nucleotide sequences of the BKV NCCR determined directly from PBMC of healthy donors. (a) Nucleotide sequences of the BKV NCCR of the DDP strain (accession no. U91605; Degener et al., 1999 ); arrows indicate the first nucleotides of the P, Q and S regulatory boxes and the ATG initiation codon for the agnoprotein (AGNO). The numbering system is that used by Seif et al. (1979) . (b) Samples: 14, SSTC blood donors; 57, SSTC blood operators; 811, RMTC blood donors. Capital letters indicate nucleotides mutated with respect to the DDP sequence.

In order to subtype BKV, amplified products from all BKV VP1-positive individuals were subjected to RFLP assay. The results are not shown, for the sake of brevity, but they indicated that only subtype I was found in the three cohorts.

Presence of JCV sequences
When nested PCRs for JCV NCCR and JCV VP1 sequences were carried out, very few subjects were found to be positive. As shown in Table 1, only two of the 231 healthy individuals (0·9%) presented JCV sequences in their PBMC. The two positive individuals were both SSTC male blood donors, aged 25·3 and 48·1; their PBMC were positive for NCCR and VP1 of both JCV and BKV. Due to the small numbers, no statistical analysis was possible.

In addition to the kidney, lymphoid cells have been proposed as a site of latency of BKV and JCV. However, while this has been shown to occur in immunocompromised patients (Azzi et al., 1996 ; Degener et al., 1997 ; Dubois et al., 1997 ; Jin et al., 1995 ), the persistence of BKV and JCV polyomaviruses in lymphocytes of healthy humans is still debated. Discordant data have been published so far, varying from 0 to >90% for BKV and from 0 to >80% for JCV (Tornatore et al., 1992 ; Sundsfjord et al., 1994 ; Dorries et al., 1994 ; De Mattei et al., 1995 ; Azzi et al., 1996 ; Lafon et al., 1998 ; Ferrante et al., 1998 ), from studies that detected, by single or nested PCR, only one viral genomic region, generally with limited numbers of subjects, without information on gender, age or the real health status of the subjects examined.

To help to solve the issue of polyomavirus latency in PBMC, we evaluated the presence of BKV and JCV DNA in PBMC of blood donors attending the Sassari Blood Transfusion Centre, in comparison with that of the operators of the same unit and of blood donors attending the Italian Red Cross Transfusion Centre in Rome, to give a total of 231 healthy persons. Since the presence of VP1 sequences has been proposed to be related to recent infection (Degener et al., 1997 ), the prevalence of BKV and JCV NCCR and VP1 sequences was determined by nested PCRs of the same sensitivities and by characterization of the amplified products.

The present study is the most extensive to date on the detection of BKV and JCV DNA in blood cells of immunocompetent, healthy subjects, and the only one that has employed nested PCRs for both NCCR and VP1 DNA sequences for each virus. Moreover, no studies have been published that correlate the presence of polyomavirus DNA in PBMC with age and different categories of immunocompetent, healthy subjects. The results, obtained through detection of BKV and JCV NCCR and VP1 sequences by nested PCRs with the same sensitivities (10 attograms or 10-17 g) and characterization of the amplified products, indicated that only a minority of healthy individuals have BKV NCCR DNA in their PBMC and even fewer have BKV VP1 sequences, with no statistically significant differences between males and females (Table 1). When subjects were stratified for age of 40 years or over (Table 2), no statistically significant differences were observed in BKV VP1 and BKV NCCR prevalence among the two blood donor cohorts.

When the NCCR and VP1 sequences were characterized, the same subtype I BKV DDP strain was found in both towns (Fig. 1). Since the DDP strain definition comes from sequencing of a non-coding region, this is not a serotype; however, it cannot be excluded that BKV with this NCCR type have been selected in the area under study.

One-third of BKV NCCR+ PBMC samples were also BKV VP1+, as detected by nested PCRs with the same sensitivities. The presence of BKV VP1 sequences in BKV NCCR+ PBMC decreased with the age of donors (Table 3), suggesting that this part of the viral DNA may be lost with time during BKV persistence in PBMC, perhaps by the accumulation of BKV genome defects or by negative selection of BKV-infected PBMC by immune defences. Another possibility might be that BKV integrates into the host genome just within the VP1 coding region.

Our data suggest that, since PBMC of healthy humans lose BKV VP1 sequences with age, PBMC are not likely to be a site of lifelong virus persistence in immunocompetent, healthy individuals, as has been proposed for immunocompetent and immunocompromised subjects as a result of studies that monitored only BKV early region DNA sequences (Sundsfjord et al., 1994 ; Dorries et al., 1994 ; De Mattei et al., 1994 , 1995 ; Azzi et al., 1996 ; Barbanti-Brodano et al., 1998 ; Dorries, 1998 ). In addition, the detection of BKV VP1 DNA in blood cells is probably indicative of recent infection or reactivation. We hypothesize that blood cells do not host biologically active BKV for a long time after acute infection or reactivation. This does not in any way imply that this also occurs in other body sites, and complete BKV genomes must be present in the site(s) of virus persistence, such as the kidney.

In keeping with this hypothesis are the data for the SSTC blood operators cohort: these subjects, even when stratified for age of 40 years or over, presented a statistically significant increased prevalence of BKV VP1 and BKV NCCR with respect to SSTC blood donors (3·0- and 9·4-fold increases, respectively) and even more if only males were considered. Since the respiratory route of transmission has been postulated for BKV (Barbanti-Brodano et al., 1998 ; Dorries, 1998 ), it may be possible that the increased BKV prevalence in blood operators may simply reflect the higher frequency of respiratory contacts with other humans, rather than contamination from blood samples.

For JCV, PBMC of only a very few healthy subjects (0·9% of blood donors) contained viral DNA sequences, and they were positive for both NCCR and VP1 sequences. These values are close to those of the largest study so far (Lafon et al., 1998 ), which found JCV sequences in leukocytes of 2·3% of 88 blood donors. It seems unlikely that our values come from false negatives, since we used nested PCR assays with high sensitivity. Our conclusions are that PBMC are not a site of JCV persistence in healthy subjects and that, while there is the possibility for blood operators of an occupational risk of BKV reinfection or reactivation, this is not the case for JCV.

Since healthy controls in human polyomavirus studies are often chosen from among staff or immunocompetent patients, differences for the normal healthy population may be underestimated. This could help to explain the data that have been published so far, giving a prevalence of 0 to >90% of polyomavirus DNA in lymphoid cells (Tornatore et al., 1992 ; De Mattei et al., 1994 , 1995 ; Dorries et al., 1994 ; Sundsfjord et al., 1994 ; Azzi et al., 1996 ; Gallia et al., 1997 ; Barbanti-Brodano et al., 1998 ; Dorries, 1998 ; Ferrante et al., 1998 ; Lafon et al., 1998 ). Additional differences may derive from the assays used, which can differ in their sensitivity, cross-reactivity between polyomaviruses, contamination by cloning vectors and interactions with cell components (Volter et al., 1998 ).

Grant sponsor: Italian Ministry for University and Scientific Research (MURST), Funds ex40% and 60%.

References

Azzi, A., De Santis, R., Ciappi, S., Leoncini, F., Sterrantino, G., Marino, N., Mazzotta, F., Laszlo, D., Fanci, R. & Bosi, A. (1996). Human polyomavirus DNA detection in peripheral blood leukocytes from immunocompetent and immunocompromised individuals.Journal of Neurovirology2, 411-416.[Medline]

Barbanti-Brodano, G., Martini, F., De Mattei, M., Lazzarin, L., Corallini, A. & Tognon, M. (1998). BK and JC human polyomaviruses and simian virus 40: natural history of infection in humans, experimental oncogenicity, and association with human tumors.Advances in Virus Research50, 69-99.[Medline]

Boldorini, R., Caldarelli-Stefano, R., Monga, G., Zocchi, M., Mediati, M., Tosoni, A. & Ferrante, P. (1998). PCR detection of JC virus DNA in the brain tissue of a 9-year-old child with pleomorphic xanthoastrocytoma.Journal of Neurovirology4, 242-245.[Medline]

De Mattei, M., Martini, F., Tognon, M., Serra, M., Baldini, N. & Barbanti-Brodano, G. (1994). Polyomavirus latency and human tumors.Journal of Infectious Diseases169, 1175-1176.[Medline]

De Mattei, M., Martini, F., Corallini, A., Gerosa, M., Scotlandi, K., Carinci, P., Barbanti-Brodano, G. & Tognon, M. (1995). High incidence of BK virus large-T-antigen-coding sequences in normal human tissues and tumors of different histotypes.International Journal of Cancer61, 756-760.

Degener, A. M., Pietropaolo, V., Di Taranto, C., Rizzuti, V., Ameglio, F., Cordiali Fei, P., Caprilli, F., Capitanio, B., Sinibaldi, L. & Orsi, N. (1997). Detection of JC and BK viral genome in specimens of HIV-1 infected subjects.New Microbiologica20, 115-122.

Degener, A. M., Pietropaolo, V., Di Taranto, C., Jin, L., Ameglio, F., Cordiali-Fei, P., Trento, E., Sinibaldi, L. & Orsi, N. (1999). Identification of a new control region in the genome of the DDP strain of BK virus isolated from PBMC.Journal of Medical Virology58, 413-419.[Medline]

Dorries, K. (1998). Molecular biology and pathogenesis of human polyomavirus infections.Developments in Biological Standardization 94, 71-79.[Medline]

Dorries, K., Vogel, E., Gunther, S. & Czub, S. (1994). Infection of human polyomaviruses JC and BK in peripheral blood leukocytes from immunocompetent individuals.Virology198, 59-70.[Medline]

Dubois, V., Dutronc, H., Lafon, M. E., Poinsot, V., Pellegrin, J. L., Ragnaud, J. M., Ferrer, A. M. & Fleury, H. J. (1997). Latency and reactivation of JC virus in peripheral blood of human immunodeficiency virus type 1-infected patients.Journal of Clinical Microbiology35, 2288-2292.[Abstract]

Ferrante, P., Omodeo-Zorini, E., Caldarelli-Stefano, R., Mediati, M., Fainardi, E., Granieri, E. & Caputo, D. (1998). Detection of JC virus DNA in cerebrospinal fluid from multiple sclerosis patients.Multiple Sclerosis4, 49-54.[Abstract/Free Full Text]

Flaegstad, T., Sundsfjord, A., Arthur, R. R., Pedersen, M., Traavik, T. & Subramani, S. (1991). Amplification and sequencing of the control regions of BK and JC virus from human urine by polymerase chain reaction.Virology180, 553-560.[Medline]

Gallia, G. L., Houff, S. A., Major, E. O. & Khalili, K. (1997). Review: JC virus infection of lymphocytes revisited.Journal of Infectious Diseases176, 1603-1609.[Medline]

Gordon, J., Krynska, B., Otte, J., Houff, S. A. & Khalili, K. (1998). Oncogenic potential of human neurotropic papovavirus, JCV, in CNS.Developments in Biological Standardization 94, 93-101.[Medline]

Harris, K. F., Chang, E., Christensen, J. B. & Imperiale, M. J. (1998). BK virus as a potential co-factor in human cancer.Developments in Biological Standardization 94, 81-91.[Medline]

Jin, L., Pietropaolo, V., Booth, J. C., Ward, H. K. & Brown, D. B. (1995). Prevalence and distribution of BKV in healthy people and immunocompromised patients detected by PCR-restriction enzyme analysis.Clinical and Diagnostic Virology3, 285-295.[Medline]

Lafon, M. E., Dutronc, H., Dubois, V., Pellegrin, I., Barbeau, P., Ragnaud, J. M., Pellegrin, J. L. & Fleury, H. J. (1998). JC virus remains latent in peripheral blood B lymphocytes but replicates actively in urine from AIDS patients.Journal of Infectious Diseases177, 1502-1505.[Medline]

Pietropaolo, V., Di Taranto, C., Degener, A. M., Jin, L., Sinibaldi, L., Baiocchini, A., Melis, M. & Orsi, N. (1998). Transplacental transmission of human polyomavirus BK.Journal of Medical Virology56, 372-376.[Medline]

Rubinstein, R., Pare, N. & Harley, E. H. (1987). Structure and function of the transcriptional control region of nonpassaged BK virus.Journal of Virology61, 1747-1750.[Abstract/Free Full Text]

Seif, I., Khoury, G. & Dhar, R. (1979). The genome of human papovavirus BKV.Cell18, 963-977.[Medline]

Sundsfjord, A., Johansen, T., Flaegstad, T., Moens, U., Villand, P., Subramani, S. & Traavik, T. (1990). At least two types of control regions can be found among naturally occurring BK virus strains.Journal of Virology64, 3864-3871.[Abstract/Free Full Text]

Sundsfjord, A., Flaegstad, T., Flø, R., Spein, A. R., Pedersen, M., Permin, H., Julsrud, J. & Traavik, T. (1994). BK and JC viruses in human immunodeficiency virus type 1-infected persons: prevalence, excretion, viremia, and viral regulatory regions.Journal of Infectious Diseases169, 485-490.[Medline]

Tornatore, C., Berger, J. R., Houff, S. A., Curfman, B., Meyers, K., Winfield, D. & Major, E. O. (1992). Detection of JC virus DNA in peripheral lymphocytes from patients with and without progressive multifocal leukoencephalopathy.Annals of Neurology31, 454-462.[Medline]

Volter, C., zur Hausen, H., Alber, D. & de Villiers, E. M. (1998). A broad spectrum PCR method for the detection of polyomaviruses and avoidance of contamination by cloning vectors.Developments in Biological Standardization 94, 137-142.[Medline]

Received 25 February 2000; accepted 26 April 2000.