Abstract
In herpesviruses, activation (or reactivation) of the virus lytic cycle initiates a temporally regulated cascade of gene expression, ultimately resulting in the release of infectious virions (Honess & Roizman, 1974 ). Lytic cycle genes can be categorized roughly into three classes: immediate-early (IE), delayed early (DE) and late genes. IE gene products direct the expression of DE genes, including components of the virus replication machinery. After replication of the viral genome, late genes, generally structural proteins, are expressed and virions are packaged and released. KSHV gene expression is no exception to this paradigm (Sun et al., 1999 ). In KSHV, the ORF50 protein (a homologue of the EBV IE R protein) has been shown to trigger reactivation from latency in B cell lines derived from PEL and direct expression of KSHV DE genes (Lukac et al., 1998 , 1999 ; Sun et al., 1998 ). KSHV assembly protein (ORF17.5) and small viral capsid antigen (ORF65), the homologues of which in herpes simplex virus (HSV) and EpsteinBarr virus (EBV) are classified as late genes, have been shown to behave with late kinetics in that they are induced by activators such as TPA but their induction is blocked by inhibitors of the viral polymerase (Lin et al., 1997 ; Unal et al., 1997 ). Thus, viral DNA replication seems to constitute an important temporal boundary between early and late gene expression in KSHV.
The prevailing model of herpesvirus late gene regulation is based on work done in HSV. Initial experiments, where late promoters were removed from the virus context to either plasmid vectors or the host genome, showed that such constructs were expressed with early kinetics (Dennis & Smiley, 1984 ; Homa et al., 1986 ; Silver & Roizman, 1985 ). Further experiments showed that unreplicated viral genomes cannot serve as templates for late gene expression, despite the probable presence of all trans-acting factors via a separate viral genome replicated in trans (Mavromara-Nazos & Roizman, 1987 ), highlighting the necessity for DNA replication in cis. Once a lytic origin was provided in cis to a late promoter on a plasmid vector, proper late gene regulation could be observed in infected cells (Johnson & Everett, 1986a ). Several groups subsequently demonstrated that minimal late promoter regions (TATA box+cap site) were sufficient to reproduce late gene regulation in infected cells when a lytic origin was present in cis (Flanagan et al., 1991 ; Homa et al., 1986 , 1988 ; Johnson & Everett, 1986b ). However, such a model is doubtless an oversimplification, as further studies have shown that structural features other than the TATA box are able to influence late gene expression (Kibler et al., 1991 ; Mavromara-Nazos & Roizman, 1989 ; Steffy & Weir, 1991 ).
The nature of the dependence upon viral DNA replication for late gene expression may vary between herpesviruses. Recent studies of EBV, a gammaherpesvirus more closely related to KSHV, showed that EBV late promoter regions driving a CAT reporter gene exhibited late kinetics in infected cells even when the plasmid lacked an oriLyt in cis (Serio et al., 1997 ). It was subsequently shown that the region responsible for conferring late gene regulation in this context was the minimal core promoter, bearing a unique TATA box variant (TATTAAA) (Serio et al., 1998 ). These results suggested that DNA replication in cis might not be a strict requirement for late gene expression in all herpesviruses.
Sparked by these results, we set out to define the sequence requirements for properly regulated expression of KSHV late genes. In this work, we show that KSHV late promoters, unlike their EBV counterparts, do not reproduce correct late gene regulation when removed from the context of the viral genome. KSHV late gene expression therefore seems likely to require replication of the viral genome in cis.
Plasmids.pAP and pAP rev were constructed by cloning the 696 nt SacIEcoRV fragment from genomic positions 31663 to 32359 in the forward or reverse orientations, respectively, into pGL3-basic that had been digested with SmaI. The SacI site was blunt-ended with Klenow polymerase.
pPr/AP and pPr/AP rev were constructed by cloning the 1313 nt HindIIIEcoRV fragment from genomic positions 31663 to 32976 in the forward or reverse orientations, respectively, into pGL3-basic that had been digested with SmaI. The HindIII site was blunt-ended with Klenow polymerase.
pAP TTG was constructed by changing the initiating ATG of the AP ORF (nt 31687) to TTG by PCR mutagenesis.
pGL3-gB has been described previously (Lukac et al., 1998 ). pGL3-MCP was constructed by cloning the 1935 nt XmaINcoI fragment from genomic positions 32362 to 31666 into pGL3-basic that had been digested with the same enzymes.
pGL3 -30 AP was constructed by PCR amplification of the pGL3 AP plasmid with primers AP -30 (5' GAGCCACGCGTATTTAAAGGCCAGC) and pGL3rev (5' CTTCATAGCCTTATGCAGTTGCTCTC). The PCR product was digested with MluI and NarI and cloned into the corresponding sites in pGL3-basic.
Cell lines and transfections.
BCBL-1 cells were propagated and maintained in RPMI 1640 medium as described by Renne et al. (1996) . Cells were diluted to a density of 2·5x106 cells/ml 1824 h prior to transfection. For Superfect transfection, cells were washed once with PBS and 1x107 cells were resuspended in 6 ml growth medium for each transfection. DNA was diluted in 150 µl unsupplemented RPMI 1640 medium and 20 µl Superfect (Qiagen) was added. Complexes were allowed to form for 10 min at room temperature and then 1 ml of growth medium was mixed with the DNASuperfect complexes which were then added to the cells. Twenty-four h post-transfection, cells were split for chemical treatment. Cells were harvested 48 h post-induction.
BJAB cells were propagated and maintained in RPMI 1640 medium as described by Renne et al. (1996) . For electroporation, cells were washed once with PBS and resuspended in unsupplemented medium. Cells (1x106) were aliquotted in 0·4 µl volumes to electroporation cuvettes (0·42 cm) containing 20 µg DNA. Cells were electroporated at 960 µF and 250 mV and subsequently transferred to 10 ml fresh medium. Superfect transfection was carried out as described above.
293 cells were maintained and propagated in Dulbeccos modified Eagles medium H16 supplemented with 10% FCS, 2 mM glutamine and antibiotics. For transfections, cells were plated at 2x105 cells per 60 mm dish and grown overnight. On the day of transfection, cells were fed 3 h before DNA addition. DNA was precipitated by using the calcium phosphate procedure. Twenty-four h after DNA addition, cells were washed with PBS and fresh medium with or without TPA was added. Cells were harvested 48 h after addition of DNA.
Preparation of RNA and cDNA cloning.
BCBL-1 cells were diluted to a density of 3x105 cells/ml and induced with 20 ng/ml TPA or mock treated. Twenty-four h post-induction, cells were harvested and RNA was isolated by using RNAzol B (Tel-Test) following the manufacturers directions.
mRNA from induced BCBL-1 cells was primed with poly(dT) and cloned into Lambda Zap (Stratagene) by R. Renne (UCSF, San Francisco, USA). The library was screened with a ClaISacI fragment from the assembly protein ORF by using a Random DNA Prime kit (Amersham).
RNase protection assay.
The riboprobe plasmid was constructed by PCR amplification of a 256 nt region spanning genomic positions 3151131736 with primers 5' TGGAATTCAACTGACAGAGGTGTGG and 5' TCGGGTACCGGGGAACATCTGGCC. The PCR product was digested with KpnI and EcoRI and cloned into the corresponding sites in pBSII SK-. The riboprobe plasmid was linearized with EcoRI and transcribed with T7 RNA polymerase in the presence of [32P]UTP. Gel-purified riboprobes (4x105 or 8x104 c.p.m.) were hybridized to 10 µg total RNA overnight at 42 °C. RNase digestion was performed with a 1:100 dilution of the RNase A/RNase T1 solution from the RPA II kit (Ambion). Digested RNAs were precipitated and separated on an 8% denaturing acrylamide gel. The gel was exposed to Kodak BioMax film for 18 h.
Primer extension.
Primer extension was performed as described by Zhong et al. (1996) . Ten µg total RNA from BCBL-1 cells, induced with TPA for 48 h or uninduced, was hybridized with primer PE1 (5' GGGATGGATATGATATCCTCTTGAC) or PE2 (5' GGATGCCGACCGGGAATTGGCTGGC). Samples were separated on an 8% denaturing acrylamide gel. The gel was exposed to Kodak BioMax film for 4 days.
Luciferase assay.
Cells were washed twice with 1 ml PBS. After the addition of 0·2 ml reporter lysis buffer (Promega), cells were harvested by scraping, vortexed and spun briefly to pellet cellular debris. Aliquots (20 and 50 µl) were analysed by luciferase or β-galactosidase assay, respectively, according to the manufacturers instructions (Promega).
We chose a classic late gene, AP, for our initial study of late gene regulation in KSHV. Visual inspection of the region upstream of the AP ORF revealed a likely TATA box at nt 31747, 60 nt upstream of the first potential start codon (Fig. 1a). We used the KSHV-infected B cell line BCBL-1 as a source of AP mRNA. BCBL-1 is latently infected with KSHV; treatment of these cells with phorbol esters induces lytic reactivation, viral DNA replication and subsequent late gene expression. A cDNA library derived from poly(dT)-primed, induced BCBL-1 mRNA was screened with a 774 bp ClaISacI fragment as probe, corresponding to a region within the AP ORF (genomic positions 3084031614). Four positive clones were isolated, representing three independent clones, as determined by sequence analysis. All three cDNA clones shared the same poly(A) addition signal, AAUAAA, at nt 30761. Although two of three cloned cDNAs started 12 nt upstream of the first AUG, the presence of a candidate TATA box suggested that the transcriptional start site might lie further upstream. To identify the start site of the AP transcript, we used RNase protection analysis (RPA) and primer extension analysis. For RPA, a 266 nt riboprobe was hybridized to BCBL-1 RNA and subjected to T2 ribonuclease digestion of unannealed, single-stranded regions. Two protected products were seen, of 166 and 171 bp, corresponding to genomic positions 31705 and 31710 (Fig. 1b).
|
The start site was confirmed independently by primer extension. We used a labelled oligonucleotide (PE1) located 12 nt downstream of the first potential initiating ATG for AP (Fig. 1a) and annealed it to induced and uninduced BCBL-1 RNA. Extension from the primer produced two products, of 66 and 71 bp, confirming our RPA results (Fig. 1c). Significantly, the major start site occurs 28 nt downstream of a possible TATA box.
KSHV late promoters taken out of the virus context are not dependent upon virus replication
In order to study the transcriptional regulation of KSHV late genes, we set out to identify regions of the AP promoter that could reproduce late gene regulation in a heterologous context. A 700 bp SacIEcoRV fragment and a 1·3 kb HindIIIEcoRV fragment were cloned into a luciferase reporter plasmid in both orientations (Fig. 2a) and tested for their ability to drive luciferase expression. When tested in 293 cells, both pPr/AP and pAP were able to direct the expression of luciferase up to 29·2- and 89·9-fold over the promoterless, parent reporter vector, pGL3-basic (Fig. 2b). This activity was dependent upon orientation, as the same fragments cloned in the reverse direction, pPr/AP rev and pAP rev, were much less active (1·8- and 15·4-fold) in the same assay.
|
In order to test these plasmids for their ability to be regulated as late genes, we planned to introduce them into BCBL-1 cells and then induce the lytic cycle with TPA and examine reporter (luciferase) expression. As a control, we first tested whether these promoters could be upregulated directly by TPA in the absence of virus replication. 293 cells, human embryonic kidney cells lacking the KSHV genome but semi-permissive for virus replication (Foreman et al., 1997 ; Renne et al., 1998 ), were transfected with the two plasmids in the absence or presence of TPA. As shown in Fig. 2(c), expression of neither plasmid was induced substantially by TPA, as judged by luciferase production (induction ratio 2). In contrast, when the same constructs were transfected into BCBL-1 cells, a context wherein viral activators and other cofactors necessary for lytic reactivation and replication are present, these reporters were modestly responsive to TPA (Fig. 2d). Given the precedents from EBV (Serio et al., 1997 , 1998 ), the relatively low level of TPA-induced activity in BCBL-1 cells was surprising. It concerned us that the initiating ATG from the AP ORF present in both pAP and pPr/AP might be causing initiation of translation upstream and out-of-frame of the luciferase ORF. To test this possibility, we used PCR mutagenesis to change the ATG to TTG in pAP, creating pAP TTG. When tested in BCBL-1 cells, the ablation of the upstream ATG resulted in a 12-fold induction of luciferase expression by TPA (Fig. 2e). All subsequent experiments were carried out with pAP TTG, as this construct provided us with greater dynamic range to detect inhibition of activation of this late promoter.
To determine whether this 12-fold TPA induction reflected faithful reproduction of late gene regulation, we transfected pAP TTG into BCBL-1 cells under four different conditions: chemical inducer alone (ionomycin or TPA), viral polymerase inhibitor ganciclovir (GCV) alone, inducer and inhibitor combined (ionomycin/GCV or TPA/GCV) or no treatment. Luciferase activity of untreated cells was set to 1. Fig. 3(b) shows that pAP TTG activation was not inhibited by GCV. Moreover, activation of this reporter construct was not entirely dependent upon viral cofactors, as pAP TTG was also activated modestly by TPA and ionomycin in BJAB cells, an uninfected B cell line (Fig. 3c), and behaved identically with regard to GCV in this background.
|
In order to confirm this result, we also tested the promoter regions of two other classic late genes: glycoprotein B (gB) and major capsid protein (MCP) (Fig. 3a). Fig. 3(d) shows that these reporters were likewise insensitive to the viral polymerase inhibitors GCV and phosphonoformic acid (PFA) in BCBL-1 cells. pPr/AP, which contains a larger region upstream of AP than pAP TTG, was similarly unaffected by both GCV and cidofovir (data not shown). The gB and MCP promoters could be activated by both TPA and ionomycin in BJAB cells, again confirming that the activation of gene expression produced by these inducers in BCBL-1 cells was not dependent upon products of the KSHV genome. These results suggest that late gene regulation in KSHV cannot be faithfully reproduced when late promoters are taken out of the virus context.
Minimal promoter constructs are also insufficient to direct gene expression with late gene kinetics
Serio et al. (1998) showed that, for EBV late gene regulation, the minimal core of a late promoter was able to confer late gene kinetics on a reporter construct. Their observation that upstream enhancers could override the temporal control provided by a core EBV late promoter led us to consider whether the KSHV promoter regions we tested may have been too large, encompassing enhancer regions that would mask the ability of a KSHV core late promoter to confer regulated late gene expression. Moreover, many of the EBV late promoters have an unusual TATA element (TATTAAA) (Serio et al., 1998 ). Inspection of the promoter regions of various KSHV late promoters showed that a subset of the late promoters, including AP, also had unusual TATA elements (TATTTAAA) reminiscent of the EBV late promoter TATA motif identified by the Miller group (Serio et al., 1998 ). To test this hypothesis, we created a deletion mutant of pAP TTG, truncating the upstream region to -30 from the start site. Fig. 4 shows that, unlike EBV, this minimal promoter region was unresponsive to viral polymerase inhibitors in BCBL-1 cells following lytic induction.
|
The presence of a candidate variant TATA motif, restricted to a subset of late promoters, suggested a possible explanation for our inability to reproduce late gene regulation; that our promoter regions incorporated upstream elements that do not normally play a role in the regulation of late genes but, in our assay, when the region is taken out of its native context, would override the genuine regulation that is directed by minimal late gene promoters during the natural virus lytic cycle. Our results, however, show that a core late gene promoter, while responsive to TPA, is not responsive to viral polymerase inhibitors, confirming our experience that late gene expression in KSHV differs from that in EBV.
Our data suggest that late gene expression in KSHV may follow more closely the HSV model of late gene regulationnamely a dependence upon virus replication in cis to facilitate control of late gene expression. Our results are reminiscent of early HSV experiments, which showed that HSV late promoters, when transferred to the host genome, behave as early promoters.
One possible model for the requirement of DNA synthesis in cis is that replication alters an inhibitory state such as methylation in promoter regions, restricted access of promoters packaged in nucleosomes or repression of transcription initiation by negative-regulatory proteins bound to the promoter. Replication of the viral genome would result in promoter regions free of inhibitory elements due either to the generation of DNA that has not been post-transcriptionally modified (i.e. methylated) or to the displacement of inhibitors (histones or negative-regulatory proteins) by the virus replication machinery. For any of these scenarios, the act of replication is central to the ability to express late genes. If this is so, further study of late gene regulation will be dependent upon the identification of the KSHV lytic origin.
References
Beral, V., Peterman, T. A., Berkelman, R. L. & Jaffe, H. W. (1990). Kaposis sarcoma among persons with AIDS: a sexually transmitted infection?Lancet 335, 123-128.[Medline]
Boshoff, C. & Weiss, R. A. (1998). Kaposis sarcoma-associated herpesvirus.Advances in Cancer Research 75, 57-86.[Medline]
Cesarman, E., Chang, Y., Moore, P. S., Said, J. W. & Knowles, D. M. (1995a). Kaposis sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.New England Journal of Medicine 332, 1186-1191.
Cesarman, E., Moore, P. S., Rao, P. H., Inghirami, G., Knowles, D. M. & Chang, Y. (1995b). In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposis sarcoma-associated herpesvirus-like (KSHV) DNA sequences.Blood 86, 2708-2714.
Dennis, D. & Smiley, J. R. (1984). Transactivation of a late herpes simplex virus promoter.Molecular and Cellular Biology 4, 544-551.
Flanagan, W. M., Papavassiliou, A. G., Rice, M., Hecht, L. B., Silverstein, S. & Wagner, E. K. (1991). Analysis of the herpes simplex virus type 1 promoter controlling the expression of UL38, a true late gene involved in capsid assembly.Journal of Virology 65, 769-786.
Foreman, K. E., Friborg, J.Jr, Kong, W. P., Woffendin, C., Polverini, P. J., Nickoloff, B. J. & Nabel, G. J. (1997). Propagation of a human herpesvirus from AIDS-associated Kaposis sarcoma.New England Journal of Medicine 336, 163-171.
Gao, S. J., Kingsley, L., Hoover, D. R., Spira, T. J., Rinaldo, C. R., Saah, A., Phair, J., Detels, R., Parry, P., Chang, Y. & Moore, P. S. (1996a). Seroconversion to antibodies against Kaposis sarcoma-associated herpesvirus-related latent nuclear antigens before the development of Kaposis sarcoma.New England Journal of Medicine 335, 233-241.
Gao, S. J., Kingsley, L., Li, M., Zheng, W., Parravicini, C., Ziegler, J., Newton, R., Rinaldo, C. R., Saah, A., Phair, J., Detels, R., Chang, Y. & Moore, P. S. (1996b). KSHV antibodies among Americans, Italians and Ugandans with and without Kaposis sarcoma.Nature Medicine 2, 925-928.[Medline]
Homa, F. L., Otal, T. M., Glorioso, J. C. & Levine, M. (1986). Transcriptional control signals of a herpes simplex virus type 1 late (γ2) gene lie within bases -34 to +124 relative to the 5' terminus of the mRNA.Molecular and Cellular Biology 6, 3652-3666.
Homa, F. L., Glorioso, J. C. & Levine, M. (1988). A specific 15-bp TATA box promoter element is required for expression of a herpes simplex virus type 1 late gene.Genes & Development 2, 40-53.
Honess, R. W. & Roizman, B. (1974). Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.Journal of Virology 14, 8-19.
Johnson, P. A. & Everett, R. D. (1986a). DNA replication is required for abundant expression of a plasmid-borne late US11 gene of herpes simplex virus type 1.Nucleic Acids Research 14, 3609-3625.
Johnson, P. A. & Everett, R. D. (1986b). The control of herpes simplex virus type-1 late gene transcription: a TATA-box/cap site region is sufficient for fully efficient regulated activity.Nucleic Acids Research 14, 8247-8264.
Kedes, D. H., Operskalski, E., Busch, M., Kohn, R., Flood, J. & Ganem, D. (1996). The seroepidemiology of human herpesvirus 8 (Kaposis sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.Nature Medicine 2, 918-924.[Medline]
Kibler, P. K., Duncan, J., Keith, B. D., Hupel, T. & Smiley, J. R. (1991). Regulation of herpes simplex virus true late gene expression: sequences downstream from the US11 TATA box inhibit expression from an unreplicated template.Journal of Virology 65, 6749-6760.
Lin, S. F., Sun, R., Heston, L., Gradoville, L., Shedd, D., Haglund, K., Rigsby, M. & Miller, G. (1997). Identification, expression, and immunogenicity of Kaposis sarcoma-associated herpesvirus-encoded small viral capsid antigen.Journal of Virology 71, 3069-3076.[Abstract]
Lukac, D. M., Renne, R., Kirshner, J. R. & Ganem, D. (1998). Reactivation of Kaposis sarcoma-associated herpesvirus infection from latency by expression of the ORF 50 transactivator, a homolog of the EBV R protein.Virology 252, 304-312.[Medline]
Lukac, D. M., Kirshner, J. R. & Ganem, D. (1999). Transcriptional activation by the product of open reading frame 50 of Kaposis sarcoma-associated herpesvirus is required for lytic viral reactivation in B cells.Journal of Virology 73, 9348-9361.
Martin, J. N., Ganem, D. E., Osmond, D. H., Page-Shafer, K. A., Macrae, D. & Kedes, D. H. (1998). Sexual transmission and the natural history of human herpesvirus 8 infection.New England Journal of Medicine 338, 948-954.
Mavromara-Nazos, P. & Roizman, B. (1987). Activation of herpes simplex virus 1 γ2 genes by viral DNA replication.Virology 161, 593-598.[Medline]
Mavromara-Nazos, P. & Roizman, B. (1989). Delineation of regulatory domains of early (β) and late (γ2) genes by construction of chimeric genes expressed in herpes simplex virus 1 genomes.Proceedings of the National Academy of Sciences, USA 86, 4071-4075.
Mesri, E. A., Cesarman, E., Arvanitakis, L., Rafii, S., Moore, M. A., Posnett, D. N., Knowles, D. M. & Asch, A. S. (1996). Human herpesvirus-8/Kaposis sarcoma-associated herpesvirus is a new transmissible virus that infects B cells.Journal of Experimental Medicine 183, 2385-2390.
Miller, G., Heston, L., Grogan, E., Gradoville, L., Rigsby, M., Sun, R., Shedd, D., Kushnaryov, V. M., Grossberg, S. & Chang, Y. (1997). Selective switch between latency and lytic replication of Kaposis sarcoma herpesvirus and EpsteinBarr virus in dually infected body cavity lymphoma cells.Journal of Virology 71, 314-324.[Abstract]
Moore, P. S. & Chang, Y. (1995). Detection of herpesvirus-like DNA sequences in Kaposis sarcoma in patients with and without HIV infection.New England Journal of Medicine 332, 1181-1185.
Moore, P. S., Gao, S. J., Dominguez, G., Cesarman, E., Lungu, O., Knowles, D. M., Garber, R., Pellett, P. E., McGeoch, D. J. & Chang, Y. (1996a). Primary characterization of a herpesvirus agent associated with Kaposis sarcomae.Journal of Virology 70, 549-558.[Abstract]
Moore, P. S., Kingsley, L. A., Holmberg, S. D., Spira, T., Gupta, P., Hoover, D. R., Parry, J. P., Conley, L. J., Jaffe, H. W. & Chang, Y. (1996b). Kaposis sarcoma-associated herpesvirus infection prior to onset of Kaposis sarcoma.AIDS 10, 175-180.[Medline]
Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D. & Ganem, D. (1996). Lytic growth of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8) in culture.Nature Medicine 2, 342-346.[Medline]
Renne, R., Blackbourn, D., Whitby, D., Levy, J. & Ganem, D. (1998). Limited transmission of Kaposis sarcoma-associated herpesvirus in cultured cells.Journal of Virology 72, 5182-5188.
Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y. & Moore, P. S. (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).Proceedings of the National Academy of Sciences, USA 93, 14862-14867.
Serio, T. R., Kolman, J. L. & Miller, G. (1997). Late gene expression from the EpsteinBarr virus BcLF1 and BFRF3 promoters does not require DNA replication in cis.Journal of Virology 71, 8726-8734.[Abstract]
Serio, T. R., Cahill, N., Prout, M. E. & Miller, G. (1998). A functionally distinct TATA box required for late progression through the EpsteinBarr virus life cycle.Journal of Virology 72, 8338-8343.
Silver, S. & Roizman, B. (1985). γ2Thymidine kinase chimeras are identically transcribed but regulated as γ2 genes in herpes simplex virus genomes and as β genes in cell genomes.Molecular and Cellular Biology 5, 518-528.
Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals-Hatem, D., Babinet, P., dAgay, M. F., Clauvel, J. P., Raphael, M., Degos, L. & Sigaux, F. (1995). Kaposis sarcoma-associated herpesvirus-like DNA sequences in multicentric Castlemans disease.Blood 86, 1276-1280.
Steffy, K. R. & Weir, J. P. (1991). Upstream promoter elements of the herpes simplex virus type 1 glycoprotein H gene.Journal of Virology 65, 972-975.
Sun, R., Lin, S. F., Gradoville, L., Yuan, Y., Zhu, F. & Miller, G. (1998). A viral gene that activates lytic cycle expression of Kaposis sarcoma-associated herpesvirus.Proceedings of the National Academy of Sciences, USA 95, 10866-10871.
Sun, R., Lin, S.-F., Staskus, K., Gradoville, L., Grogan, E., Haase, A. & Miller, G. (1999). Kinetics of Kaposis sarcoma-associated herpesvirus gene expression.Journal of Virology 73, 2232-2242.
Unal, A., Pray, T. R., Lagunoff, M., Pennington, M. W., Ganem, D. & Craik, C. S. (1997). The protease and the assembly protein of Kaposis sarcoma-associated herpesvirus (human herpesvirus 8).Journal of Virology 71, 7030-7038.[Abstract]
Whitby, D., Howard, M. R., Tenant-Flowers, M., Brink, N. S., Copas, A., Boshoff, C., Hatzioannou, T., Suggett, F. E., Aldam, D. M., Denton, A. S., Miller, R. F., Weller, I. V. D., Weiss, R. A. & Schulz, T. F. (1995). Detection of Kaposi sarcoma-associated herpesvirus in peripheral blood of HIV-infected individuals and progression to Kaposis sarcoma.Lancet 346, 799-802.[Medline]
Zhong, W., Wang, H., Herndier, B. & Ganem, D. (1996). Restricted expression of Kaposis sarcoma-associated herpesvirus genes in Kaposis sarcoma.Proceedings of the National Academy of Sciences, USA 93, 6641-6646.
Received 20 January 2000; accepted 14 April 2000.