Research Article

Rapid identification of a tobacco mosaic virus epitope by using a coat protein gene-fragment-pVIII fusion library

Journal of General Virology 2001; 82(1):9

PubMed

With thanks to our partners for supporting this archive.

Abstract

This study describes the identification of the epitope recognized by the tobacco mosaic virus (TMV) coat protein (CP)-specific monoclonal antibody 29 (MAb29) by displaying a CP gene-fragment library on pVIII of filamentous phage M13. More than 80% of the clones isolated after one round of panning bound specifically to MAb29. DNA sequencing of ten randomly chosen MAb29-specific clones and subsequent sequence comparison revealed a common seven amino acid epitope (ELIRGTG) representing amino acids 131137 of the TMV CP. The reactivity of MAb29 in competition ELISA towards glutathione S-transferase fused to this epitope was stronger than that towards full-length wild-type TMV CP, confirming the epitope sequence determined by gene-fragment phage display. This demonstrated that gene-fragment libraries displayed on the phage surface as fusion proteins with the filamentous bacteriophage gene VIII are useful tools for rapid identification of linear epitopes recognized by MAbs.
The antigenic structure of the tobacco mosaic virus (TMV) coat protein (CP) has been studied extensively (van Regenmortel, 1981 , 1999 ). Various serological techniques including precipitation, complement fixation, haemagglutination and ELISA have been used to identify epitopes recognized by monoclonal antibodies (MAbs). Studies using synthetic peptides indicate that almost the entire sequence of the TMV CP is antigenic and that the CP contains more than 13 continuous epitopes (Al Moudallal et al., 1982 ; Dore et al., 1987 ). The majority of the epitopes are composed of fewer than ten amino acid residues and correspond to regions found in CP surface projections, such as loops and turns (Altschuh et al., 1987 ; Dore et al., 1988 ). On the basis of these findings, and in order to evaluate the source of the biological effects of transgenically expressed MAbs in Nicotiana tabacum (Tavladoraki et al., 1993 ), the TMV CP was used to generate a panel of MAbs. One of these was the high-affinity MAb29 (Kd>1x10-9), generated by standard hybridoma technology using TMV vulgare CP as the antigen. Since the recombinant full-size antibody rAb29 and its derivative scFv29 can be functionally expressed in N. tabacum (Schillberg et al., 1999 ), we were interested in mapping the CP epitope recognized by MAb29 and its derivatives. Detailed knowledge of the epitope would help to elucidate structurefunction relationships in vivo by using rAb29- or scFv29-expressing plants.

Current epitope-mapping techniques are based on the scanning of solid-phase peptide libraries or screening of random peptide libraries displayed on the filamentous bacteriophage pIII and pVIII surface proteins (Lane & Stephen, 1993 ; Smith, 1991 ). Display of linear or constrained random peptide sequences on filamentous bacteriophages has led to the identification of many epitopes recognized by MAbs (Sibille & Strosberg, 1997 ; Stephen et al., 1995 ) and has become an important technique for the evaluation of proteinprotein interactions (Burritt et al., 1996 ). However, these epitope-mapping methods are tedious and have certain limitations. In random peptide library panning, selection is based on the affinity between the antibody and the library peptides, most of which do not share sequence similarity with the antigen. This can lead to identification of peptides that have high affinity but only little sequence similarity to the original protein (mimotopes) (Böttger et al., 1995 ). As a result, high-affinity antibody-binding peptides identified from random combinatorial libraries may not be useful for identifying the recognized epitope within the antigen. A second limitation of random peptide display in identifying actual epitopes is the time required to enrich specific phage clones. Typically, three or more rounds of panning are needed to derive a consensus amino acid sequence and to deduce the epitope. This is costly and labour intensive, typically requiring 3 to 4 weeks. Additionally, a random peptide library, despite a theoretical size of >1012 peptides, may not include all possible amino acid combinations and therefore may not contain specific binding-peptide motifs.

Displaying gene fragments of the antigen on phage is a promising alternative for rapid identification of the actual epitopes recognized by antibodies. This approach has the advantage that antigen-derived peptides are affinity-selected by the corresponding MAb and these peptides are subsequently used to identify the epitope. Additionally, the number of non-specific peptides included in a gene-fragment library is much smaller compared with random peptide libraries. These advantages can permit the identification of epitope motifs after only one round of affinity selection with the respective MAb. Most gene-fragment libraries displayed on bacteriophage described to date have been based on fusion to the gene III protein (Fack et al., 1997 ; Gupta et al., 1999 ; Jacobsson & Frykberg, 1995 ; Jacobsson et al., 1997 ), which is present in only three to five copies per phage. In contrast, the bacteriophage gene VIII protein is present at ∼2700 copies per phage particle and has also been used successfully to display random peptide libraries on a phage surface (Felici et al., 1991 ). Peptide display using the filamentous bacteriophage gene VIII product (Jacobsson & Frykberg, 1996 ) also increases the number of displayed peptides to up to 1000 copies per phage particle (Cesareni, 1992 ).

In this study, the feasibility of panning a gene-fragment library displaying short sequence motifs derived from the TMV CP as pVIIIpeptide fusions on filamentous phage was investigated. Our rationale was to develop a method for the rapid identification of the TMV CP epitope recognized by MAb29 that could subsequently be used for determination of other epitopes recognized by TMV CP-specific MAbs. Identification of the MAb29 epitope would also help to define MAb specificity amongst different tobamovirus strains and could be used to confirm binding data obtained from standard ELISA with this antibody. Furthermore, an approach is discussed whereby gene-fragment libraries are used for evaluation of MAb epitopes, in comparison with established epitope-mapping technologies such as peptide scanning.

Production and purification of MAbs.
Immunization, fusion and hybridoma generation were performed according to standard protocols (Coligan et al., 2000 ) with 100 µg TMV vulgare CP per boost as antigen. The serum titre from immunized mice was determined by ELISA. Only mice showing a TMV CP-specific antibody titre greater than 1:500000 were subsequently used for generation of hybridoma clones. The fusion of myeloma and spleen cells was done as described previously (Westerwoudt, 1985 ). After two limiting-dilution cloning steps, ELISA-positive clones were expanded from 96-well microculture plates (Nunc) into suspension mass cultures. The determination of TMV CP-specific MAb production, reactivity, affinity, isotype and specificity was performed as described previously (Hämmerling & Hämmerling, 1981 ). MAb29, an IgG1/kappa isotype, was purified from the culture supernatant by affinity chromatography on Prosep-A HC (Bioprocessing). The purity of the MAb29 preparation was confirmed by SDSPAGE and silver staining.

Construction of the TMV CP gene-fragment library in pC89.
All standard molecular biology techniques used in this study were performed according to standard protocols (Ausubel et al., 2000 ). Peptide display techniques were performed as described previously (Felici et al., 1991 ). The phagemid pC89 (Felici et al., 1991 ) was isolated from a clone of a linear 9-mer peptide display library (pVIII 9aa), which was kindly provided by R. Cortese (IRBM, Rome; Fig. 1). The TMV-RT vector (Verch et al., 1998 ) is a pUC18-based plasmid containing the complete TMV genome and was used to amplify the TMV CP gene by PCR prior to subsequent DNase I fragmentation. The plasmid pGEX-5x-3 (Pharmacia) was used to clone a glutathione S-transferase (GST)-fusion peptide containing the determined TMV CP epitope of MAb29 and a MAb29-non-reactive TMV CP domain as a negative control. E. coli strain TG1 (Stratagene) was used for the construction of the TMV CP gene-fragment library. E. coli strain BL21 (Stratagene) was used to express GST-fusion peptides. The TMV CP gene was amplified by PCR from the TMV-RT vector by using the following oligonucleotides: CP3, 5' CCGTCAGACGTCAGAACCTCCACCTCCACTTCCGCCGCCTCCAGTTGCAGGACCAGAGGTCCAAACCAAACC 3'; and CP5, 5' ACTGCGCCATGGCTTACAGTATCACT 3'. DNase I fragmentation of the PCR product was carried out as described previously (Anderson, 1981 ) by using 90 µg of the PCR product, generating DNA fragments of ∼25150 bp. DNA fragments were blunt-ended with T4 DNA polymerase, separated on a 5% (w/v) polyacrylamide gel and then recovered from the gel. The phagemid pC89 (Fig. 1) was digested with EcoRI and BamHI, blunt ends were generated by T4 DNA polymerase treatment and the vector was dephosphorylated with shrimp alkaline phosphatase (AP). The ligation reaction contained 75 ng gel-purified TMV CP gene-fragment DNA and 20 ng vector DNA and was used to transform E. coli TG1 by electroporation. Recombinant phages were collected upon M13KO7 helper phage (Life Technologies) infection (Vieira & Messing, 1987 ) and PEG6000 precipitation. The transforming unit (TU) titre of the library was determined as described previously (Vieira & Messing, 1987 ).



(33K):

Fig. 1. Construction of the TMV CP gene-fragment display library in phagemid pC89. (a) pC89 phagemid design for gene VIII fragment peptide display. Blunt-ended TMV CP gene fragments (850 amino acids) were ligated into the blunt-ended EcoRI and BamHI restriction sites to replace the 27 bp coding random peptide insert. LP, Leader peptide; PS, peptide sequence insert; ColE1 ORI, E. coli origin of replication; pLac, pLac promoter; pVIII, bacteriophage gene VIII; AmpR, β-lactamase gene; f1 ORI, bacteriophage f1 origin of replication. (b) Sequence of the filamentous bacteriophage gene VIII showing the cloning sites and site of insertion for gene-fragment display. Blunt-ended TMV CP gene fragments encoding 850 amino acids were ligated between the filled-in EcoRI and BamHI restriction sites to replace an existing random peptide library sequence in the pC89 phagemid (boxed codons NNN).

Panning of the gene-fragment library.
Biopanning of the gene-fragment library was conducted according to Fack et al. (1997) with 20 µg affinity-purified MAb29. For the first round of panning, 5x1012 TU in 1 ml PBS+ was used and bound phage was eluted with 1 ml glycineHCl, pH 2·2, 0·1% (w/v) BSA (10 min, 20 °C). The titre of eluted phage was determined by plating 100 µl of the infected bacteria on 2xTY-Amp plates and counting the colony forming units (c.f.u.). Enrichment factors were calculated by comparison with a control panning of the TMV CP library screened without MAb29. Monoclonal phages from the first round of panning were tested for reactivity with MAb29 by phage-ELISA (Valadon & Scharff, 1996 ) with 100 ng of TMV CP coated to each well of the ELISA plate. Antibody-bound phages were detected with an anti-M13 antibodyhorseradish peroxidase conjugate (Pharmacia) followed by incubation with 100 µl of 1 mg/ml ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid)] in ABTS buffer (Roche Diagnostics). A405 values were determined after incubation with substrate for 60 min and were measured by using a SpectraMax 340 spectrophotometer (Molecular Devices).

Cloning, expression and competition ELISA using GST-fusion proteins.
Two regions of the TMV CP, one containing aa 5375 as a negative control and one containing aa 126139, which is the epitope recognized by MAb29 as identified by peptide display, were cloned as C-terminal fusions to GST. The nucleotide sequences for each peptide, a Gly4Ser linker and an NcoI restriction site were fused by PCR to the C terminus of the GST gene by using pGEX-5x-3 (Pharmacia) as template. Primer length was minimized by using two nested backward primers for each reaction: pr126TMV1 (5' TTTCTCGAGGATCAGGTTGTTTCCATGGGAACCACCACCACCCTGGATCCCACGACCTTCGAT 3') and pr126TMV2 (5' TTTCTCGAGTCAGTAGGAACCGGTACCACGGATCAGTTCAACGATCAGGTTGTTTCCATGGGA 3') for GST-126 and pr157TMV1 (5' AAACTCGAGACGGTAACTTGCGGGGACGGTTTCCATCCATGGGAACCACCACCACCCTGGATCCCACGACCTTCGAT 3') and pr157TMV2 (5' AAACTCGAGTCAAGCGTTGTAACGGTAAACTTTGAAGTCGGAGTCCGGGAAACGAACGGTAACTTGCGGGGACGGT 3') for GST-157 in combination with the common forward primer GST-BspM1 (5' CATCGGAAGCTGTGGTATGG 3'). After cloning the GST-126 and GST-157 fusion proteins, the correct product was verified by DNA sequencing of plasmid DNA obtained from recombinant bacteria. Upon expression in E. coli BL21 and affinity purification on glutathioneSepharose 4B columns (Pharmacia), the yield and purity of the recombinant GST-fusion proteins were determined by SDSPAGE.

Competition ELISA was carried out as described with 1 µg/ml GST-126 in PBS per well. Serial dilutions ranging from 5·47 µM to 0·03 nM of GST-126 and TMV CP were prepared in PBS, pH 9·0. MAb29 was added to a final concentration of 1·25 nM. Competition of soluble GST-126 or TMV CP against immobilized GST-126 for binding to MAb29 was carried out for 2 h at 22 °C. Bound MAb29 was detected with an AP-conjugated goat anti-mouse antibody (Dianova) followed by incubation with 100 µl of 1 mg/ml AP substrate (Sigma). A405 values were measured 60 min after substrate addition by using a SpectraMax 340 spectrophotometer (Molecular Devices). Intermediate washing steps were carried out three times with PBST. IC50 values were derived by fitting the data to the equation R=Abg+(Amax-Abg)/(1+Asample/IC50) (where Abg is the background, Amax the reactivity of MAb29 without competitor and Asample the reactivity of MAb29 in the samples; R is the reactivity of the sample and IC50 represents the dilution at which the reactivity of MAb29 is reduced to 50%) by using Microcal Origin 5.0.

DNA sequencing.
Plasmid DNA from ELISA-positive clones was isolated from recombinant E. coli DH5α or TG1 cultures by using the Qiagen Mini Spinprep kit and sequenced by using specific primers in combination with the Thermo-sequenase fluorescence-labelled primer cycle sequencing kit (Amersham-Pharmacia). Sequencing reactions were run on a LiCor-4200L DNA sequencer (MWG-Biotech). Sequences were analysed using the Wisconsin package (GCG, Madison, WI, USA).

The gene-fragment phage display library was constructed by ligating blunt-ended DNA fragments of the TMV CP gene into the blunt-ended EcoRI/BamHI-restricted phagemid pC89 (Fig. 1). The TMV CP sequence was amplified by PCR from the TMV-RT vector, which contains a full-length infectious cDNA clone of TMV. After separation by PAGE, ∼25150 bp DNase I fragments of the 527 bp TMV CP PCR product were ligated into the phagemid pC89. This resulted in the surface display of a library presenting 850 amino acid long peptides of the TMV CP gene fused to pVIII.

The TMV CP gene-fragment library consisted of ∼6x104 primary transformants, resulting in 5x1014 TU after overnight amplification of phage in a 200 ml E. coli TG1 culture. Only clones that are in-frame at both junctions (signal peptide/gene fragment and gene fragment/pVIII) and show the correct orientation will display peptide fragments corresponding to the original TMV CP amino acid sequence. This represents a statistical maximum of 5·5% of the primary transformants being capable of displaying TMV CP-derived peptides.

Approximately 5x1012 TU were used for the first round of panning with 20 µg MAb29 immobilized on the solid phase. In the first round of panning, 1·1x106 TU were eluted, which corresponds to a 35-fold enrichment compared with a control panning of the TMV CPgene VIII library without MAb29. More than 80% of the monoclonal phages amplified after the first round of panning showed strong specific signals (A405>0·5) in phage ELISA, using MAb29 as the capturing antibody (Fig. 2a, b).



(71K):

Fig. 2. Reactivity of enriched monoclonal phages with MAb29 in phage ELISA. (a) Phages binding to MAb29 were eluted from the antibody and amplified in E. coli. Eighty phage clones were selected randomly and their reactivity with MAb29 was quantified by phage ELISA. MAb29 was used as the capturing antibody and bound phages were detected with a horseradish peroxidase-conjugated anti-M13 secondary antibody followed by substrate reaction. A405 values after 60 min substrate reaction are shown for each phage clone. (b) Frequency distribution of phage ELISA data. The data are shown as the frequency of phage clones (%) against reactivity in phage ELISA, grouped according to their A405 values (<0·5; 0·52; >2).

Sequencing of phagemid DNA from ten randomly chosen ELISA-positive clones from the first round of panning revealed eight highly similar and overlapping inserts. The insert sizes varied from 24 bp (8 amino acids) to 114 bp (38 amino acids) and a common region of seven amino acids was deduced (Fig. 3). This seven amino acid sequence corresponded exactly to amino acid residues 131137 (131ELIRGTG137) of the TMV CP sequence. A single clone contained two fragments of the TMV CP sequence. The first contained the seven amino acid epitope, but the second fragment of the TMV CP gene was inversely inserted, so that amino acid residues not available in the TMV CP were displayed (Fig. 3, clone 31).



(23K):

Fig. 3. Amino acid alignment of the peptides presented by ten phage clones selected with MAb29 from the TMV CP gene-fragment library. The deduced amino sequences of ten randomly chosen monoclonal phages isolated after one round of panning and their alignment with the TMV CP sequence are shown. Amino acid residues that did not reveal a TMV CP sequence were introduced by inverse ligation of a second TMV CP fragment and are shown in bold italics (clone 31). The bottom line shows the amino acid residues common to all sequenced clones and the deduced consensus epitope recognized by MAb29.

Based on the highly specific ELISA signals and the high degree of similarity between the sequenced clones, a consensus sequence (amino acid residues ELIRGTG) was deduced as the actual linear epitope recognized by MAb29. Amino acids that flanked the common seven amino acids were not conserved in all ten clones analysed. Amino acid residues V130 and S138N140 were not necessary for MAb29 binding. Although present in nine of ten clones each, ELISA-positive clones were identified that were missing at least one of these amino acids (Fig. 3, clones 21 and 44).

In order to verify the results obtained by screening the gene-fragment library, two regions of the TMV CP were cloned as C-terminal fusions to GST by using the pGEX expression system: GST-126 (Fig. 4a), covering the MAb29 epitope identified by panning the gene-fragment library with MAb29, and GST-157 (Fig. 4a), covering amino acids 5375, which form an immunodominant loop structure on the native TMV CP. After expression of both sequences in E. coli BL21 and subsequent purification by GST-affinity chromatography of the recombinant proteins, strong reactivity of MAb29 against GST-126 was observed in ELISA and in Western blotting, while no reactivity was detected with GST-157 or native GST (data not shown). Furthermore, a competition ELISA was carried out, which revealed that soluble GST-126 was a better competitor for binding of MAb29 to GST-126 (Fig. 4b) or TMV CP (data not shown) than soluble TMV CP. With soluble TMV CP, 50% of the colorimetric reaction was inhibited at a concentration of 918 nM (IC50). In contrast, GST-126 was at least 25-fold more active and inhibited 50% of the MAb29 reactivity at 33·6 nM.



(22K):

Fig. 4. Competition ELISA. (a) Nucleotide and amino acid sequences of the C-terminal regions of the GST-126 and GST-157 fusion proteins. Amino acid residues of the epitope identified by gene-fragment display are shown in bold. (b) Binding of MAb29 to GST-126 (•) and TMV CP () was assayed by competition ELISA. Serial dilutions of GST-126 and TMV CP were combined with MAb29 to a final concentration of 1·25 nM MAb29 and incubated for 2 h on GST-126-coated plates. Bound MAb29 was detected with GAMAP and AP substrate. The inhibition curve was obtained by plotting A405 against the concentration of the competitor.
The construction of the gene-fragment library was straightforward. The cloning procedure utilized blunt-end ligations and did not require any adapters or linkers. The epitope recognized by MAb29 was determined rapidly in a single round of panning of the TMV CP gene-fragment library (Fig. 2). By aligning the deduced amino acid residues of the eight different inserts (Fig. 3), a common region of seven amino acids in the TMV CP sequence (131ELIRGTG137) was identified as the epitope recognized by MAb29. This was confirmed by expression and binding-assay evaluation of the identified epitope as a C-terminal fusion to GST (GST-126; Fig. 4a). Competition ELISA revealed a more than 25-fold higher IC50 for TMV CP compared with GST-126. This might be due to the strong tendency of TMV CP to aggregate and to form trimers or polymeric discs (Bloomer & Butler, 1986 ), even under competition ELISA conditions (pH 9). Inspection of the 3D structure of TMV CP indicated that aggregation leads to inaccessibility of the epitope recognized by MAb29. This also agrees with the observation that MAb29 does not react with intact virions. GST-126 presents the epitope as a C-terminal fusion tail, which is very accessible for MAb29. This makes GST-126 suitable for affinity purification of MAb29 and its derivatives (Fischer et al., 1999 ).

The time taken for the identification of the MAb29 epitope and the cost incurred were low compared with other techniques suitable for epitope mapping, such as the screening of random peptide display phage libraries (Scott & Smith, 1990 ) or synthetic peptide scanning analysis (PEPSCAN) (Geysen et al., 1984 ). Furthermore, the libraries generated can be reused, thus enabling the cost-effective screening of a panel of MAbs that have been raised against the same antigen. The primary advantage of epitope mapping by gene-fragment libraries compared with random peptide libraries is that the content of specific target peptides is initially much higher. By cloning the library by using a cDNA encoding the antigen, a sufficient diversity can be several orders of magnitude smaller compared with a random peptide library and one single round of panning still results in epitope identification. The TMV CP gene-fragment library used in this study consisted of ∼6x104 primary transformants, of which 3·3x103 (5·5%) displayed inserts in the correct reading frame. With an average peptide size of ∼25 amino acids, this easily covered the 159 amino acids of the TMV CP with overlapping inserts. This is also demonstrated by the fact that one round of panning resulted in >80% MAb29-reactive clones, from which ten randomly chosen clones had eight different gene fragments inserted, but all contained the seven amino acid epitope, as deduced by sequencing. Considering these results, it even seems possible to adopt an epitope-mapping approach whereby any kind of biopanning is avoided, simply by identifying epitope-bearing clones from the initial gene-fragment library by phage ELISA.

While display of peptides on pIII of filamentous phage gives one to three recombinant copies per phage particle, the fusion of gene fragments to gene VIII results in the display of recombinant peptides at up to ∼1000 copies per phage (Cesareni, 1992 ), thus covering the entire phage with a large number of identical peptides. This increases the efficiency of the panning process compared with pIII libraries for peptide display and enables a more efficient enrichment of phages, as long as the displayed peptide does not interfere with bacteriophage assembly. The use of the target gene for setting up the library permitted rapid identification of the actual linear epitope recognized by MAb29, as shown by sequence comparison with the TMV CP sequence. Panning of random peptide libraries often leads to the identification of so-called mimotopes, which are specific binding peptides with little or no sequence similarity to the original target sequence, but which adopt a 3D structure that resembles the epitope and are recognized by the MAb. Since these mimotopes cannot be used to define the actual epitope, screening of random peptide libraries has limitations for mapping actual epitopes recognized within the antigen sequence. Moreover, panning random peptide libraries with MAbs can result in only a few independent specific clones with low sequence similarity (Böttger et al., 1995 ).

Gene-fragment libraries have been successfully used for the mapping of epitopes where other epitope-mapping techniques have failed (Fack et al., 1997 ). For the construction of the TMV CP gene-fragment library, we chose a peptide length of 850 amino acids, which increases the likelihood that a longer epitope or an epitope adopting a particular structural conformation will be recognized by the MAb. The screening of fully synthetic libraries by PEPSCAN analysis (Geysen et al., 1984 ) can be labour- and time-intensive and requires expensive materials or special equipment. In PEPSCAN analysis, the complete antigen sequence is represented by overlapping synthetic peptides of 615 amino acids. Screening for reactivity is usually performed by ELISA or dot blotting. Identification of specific peptides in this way depends strongly on the size of the recognized epitope and can be influenced by the solubility of the synthetic peptides. It has been reported that conformational or large linear epitopes are unlikely to be identified by this technique (Fack et al., 1997 ).

A limitation of gene-fragment display as discussed here is that only linear epitopes are likely to be identified. The mapping of conformational epitopes is not usually possible, although variation of the gene-fragment insert length might narrow the epitope to certain regions or distinct protein domains. It has been observed that, whenever a MAb is capable of recognizing its antigen in Western blotting, it also selects specific clones from gene-fragment display libraries of the target protein (Fack et al., 1997 ). For the identification of mimotopes, thus mimicking a conformational epitope with a linear peptide, the screening of disulphide bond-constrained random peptide libraries is a more promising alternative (Cortese et al., 1995 ; Lane & Stephen, 1993 ; Luzzago et al., 1993 ), although this will rarely lead to the identification of the actual epitope sequence.

The screening of gene-fragment libraries as described here is a rapid, reliable and convenient technique for the identification of actual, linear epitopes recognized by sets of MAbs raised against the same antigen. It is highly efficient, less time-consuming and less expensive when compared with other methods and does not involve expensive or dedicated material or equipment. Due to the possibility of mapping back the identified binding sequence to the sequence of the antigen, this technique is particularly useful in the process of evaluating MAbs that bind to conserved epitopes as deduced from sequence comparisons. In the case of the TMV CP, which has been isolated from many strains that differ mainly in their CP sequence (van Regenmortel, 1981 ), this may lead to the identification of conserved CP motifs that can be used for subsequent studies (Schillberg et al., 1999 ).

This work was supported in part by an EC grant (FAIR-CT95-1039) awarded to R.F. The authors would like to thank M. Sack, Dr G. Hughes and Dr P. van der Logt for helpful comments as well as Professor Dr R. Cortese and Dr A. Luzzago for providing the peptide display vector used for the construction of the gene-fragment library.

References

Al Moudallal, Z., Briand, J. P. & Van Regenmortel, M. H. V. (1982). Monoclonal antibodies as probes of the antigenic structure of tobacco mosaic virus. EMBO Journal 1, 1005-1010.[Medline]

Altschuh, D., Lesk, A. M., Bloomer, A. C. & Klug, A.(1987). Correlation of co-ordinated amino acid substitutions with function in viruses related to tobacco mosaic virus. Journal of Molecular Biology 193, 693-707.[Medline]

Anderson, S.(1981). Shotgun DNA sequencing using cloned DNase I-generated fragments. Nucleic Acids Research 9, 3015-3027.[Abstract/Free Full Text]

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (2000). Current Protocols in Molecular Biology. New York: John Wiley.

Bloomer, A. C. & Butler, P. J. G. (1986). Tobacco mosaic virus structure and self-assembly. In The Plant Viruses, vol. 2, pp. 457. New York: Plenum.

Böttger, V., Stasiak, P. C., Harrison, D. L., Mellerick, D. M. & Lane, E. B.(1995). Epitope mapping of monoclonal antibodies to keratin 19 using keratin fragments, synthetic peptides and phage peptide libraries. European Journal of Biochemistry 231, 475-485.[Medline]

Burritt, J. B., Bond, C. W., Doss, K. W. & Jesaitis, A. J.(1996). Filamentous phage display of oligopeptide libraries. Analytical Biochemistry 238, 1-13.[Medline]

Cesareni, G.(1992). Peptide display on filamentous phage capsids. A new powerful tool to study proteinligand interaction. FEBS Letters 307, 66-70.[Medline]

Coligan, J. E., Kruisbeek, A. M., Margulies, D. H., Shevach, E. M. & Strober, W. (2000). Current Protocols in Immunology. New York: John Wiley.

Cortese, R., Monaci, P., Nicosia, A., Luzzago, A., Felici, F., Galfre, G., Pessi, A., Tramontano, A. & Sollazzo, M.(1995). Identification of biologically active peptides using random libraries displayed on phage. Current Opinion in Biotechnology 6, 73-80.[Medline]

Dore, I., Altschuh, D., Al Moudallal, Z. & Van Regenmortel, M. H.(1987). Immunochemical studies of tobacco mosaic virus. VII. Use of comparative surface accessibility of residues in antigenically related viruses for delineating epitopes recognized by monoclonal antibodies. Molecular Immunology 24, 1351-1358.[Medline]

Dore, I., Weiss, E., Altschuh, D. & Van Regenmortel, M. H.(1988). Visualization by electron microscopy of the location of tobacco mosaic virus epitopes reacting with monoclonal antibodies in enzyme immunoassay. Virology 162, 279-289.[Medline]

Fack, F., Hugle-Dorr, B., Song, D., Queitsch, I., Petersen, G. & Bautz, E. K.(1997). Epitope mapping by phage display: random versus gene-fragment libraries. Journal of Immunology Methods 206, 43-52.[Medline]

Felici, F., Castagnoli, L., Musacchio, A., Jappelli, R. & Cesareni, G.(1991). Selection of antibody ligands from a large library of oligopeptides expressed on a multivalent exposition vector. Journal of Molecular Biology 222, 301-310.[Medline]

Fischer, R., Schumann, D., Zimmermann, S., Drossard, J., Sack, M. & Schillberg, S.(1999). Expression and characterization of bispecific single-chain Fv fragments produced in transgenic plants. European Journal of Biochemistry 262, 810-816.[Medline]

Geysen, H. M., Meloen, R. H. & Barteling, S. J.(1984). Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. Proceedings of the National Academy of Sciences, USA 81, 3998-4002.[Abstract/Free Full Text]

Gupta, S., Arora, K., Sampath, A., Khurana, S., Singh, S. S., Gupta, A. & Chaudhary, V. K.(1999). Simplified gene-fragment phage display system for epitope mapping. Biotechniques 27, 328-334.[Medline]

Hämmerling, G. J. & Hämmerling, U.(1981). Production of antibody-producing hybridomas in the rodent system. Research Monographs in Immunology 3, 563-587.

Jacobsson, K. & Frykberg, L.(1995). Cloning of ligand-binding domains of bacterial receptors by phage display. Biotechniques 18, 878-885.[Medline]

Jacobsson, K. & Frykberg, L.(1996). Phage display shot-gun cloning of ligand-binding domains of prokaryotic receptors approaches 100% correct clones. Biotechniques 20, 1070-1081.[Medline]

Jacobsson, K., Jonsson, H., Lindmark, H., Guss, B., Lindberg, M. & Frykberg, L.(1997). Shot-gun phage display mapping of two streptococcal cell-surface proteins. Microbiological Research 152, 121-128.[Medline]

Lane, D. P. & Stephen, C. W.(1993). Epitope mapping using bacteriophage peptide libraries. Current Opinion in Immunology 5, 268-271.[Medline]

Luzzago, A., Felici, F., Tramontano, A., Pessi, A. & Cortese, R.(1993). Mimicking of discontinuous epitopes by phage-displayed peptides. I. Epitope mapping of human H ferritin using a phage library of constrained peptides. Gene 128, 51-57.[Medline]

Schillberg, S., Zimmermann, S., Voss, A. & Fischer, R.(1999). Apoplastic and cytosolic expression of full-size antibodies and antibody fragments in Nicotiana tabacum. Transgenic Research 8, 255-263.[Medline]

Scott, J. K. & Smith, G. P.(1990). Searching for peptide ligands with an epitope library. Science 249, 386-390.[Abstract/Free Full Text]

Sibille, P. & Strosberg, A. D.(1997). A FIV epitope defined by a phage peptide library screened with a monoclonal anti-FIV antibody. Immunology Letters 59, 133-137.[Medline]

Smith, G. P.(1991). Surface presentation of protein epitopes using bacteriophage expression systems. Current Opinion in Biotechnology 2, 668-673.[Medline]

Stephen, C. W., Helminen, P. & Lane, D. P.(1995). Characterisation of epitopes on human p53 using phage-displayed peptide libraries: insights into antibodypeptide interactions. Journal of Molecular Biology 248, 58-78.[Medline]

Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. & Galeffi, P.(1993). Transgenic plants expressing a functional single-chain Fv antibody are specifically protected from virus attack. Nature 366, 469-472.[Medline]

Valadon, P. & Scharff, M. D.(1996). Enhancement of ELISAs for screening peptides in epitope phage display libraries. Journal of Immunology Methods 197, 171-179.[Medline]

Van Regenmortel, M. H. V. (1981). Tobamoviruses. In Handbook of Plant Virus Infections and Comparative Diagnosis , pp. 541-564. Edited by E. Kurstak. Amsterdam:Elsevier/North Holland.

Van Regenmortel, M. H.(1999). The antigenicity of tobacco mosaic virus. Philosophical Transactions of the Royal Society of London Series B 354, 559-568.[Medline]

Verch, T., Yusibov, V. & Koprowski, H.(1998). Expression and assembly of a full-length monoclonal antibody in plants using a plant virus vector. Journal of Immunology Methods 220, 69-75.[Medline]

Vieira, J. & Messing, J.(1987). Production of single-stranded plasmid DNA. Methods in Enzymology 153, 3-11.[Medline]

Westerwoudt, R. J.(1985). Improved fusion methods. IV. Technical aspects. Journal of Immunology Methods 77, 181-196.[Medline]

Received 25 April 2000; accepted 17 August 2000.