Abstract
Little is known about the conservation of genome size, coding potential and terminal sequences in different isolates of BDV. Until now, the complete genetic information of only two closely related BDV strains, named He/80 and V, has been available (Briese et al., 1994 ; Cubitt et al., 1994a ). The two genomes show 95% sequence identity, and they have identical organization of transcription units and ORFs. However, the L protein of He/80 was reported to lack 24 amino acids at the C terminus, and the last 3 nt at the 5'-ends differ completely. Since genome ends are of critical importance for efficient replication and transcription of non-segmented negative-strand RNA viruses (Conzelmann, 1998 ), it remained possible that the unique end sequences may point to strain-specific differences in the 5'-promoter region.
To better differentiate between conserved and strain-specific features, we determined the complete genome sequences of two additional BDV strains. No/98 originates from a horse that acquired Borna disease outside the well-known endemic region of BDV in central Europe (Nowotny et al., 2000 ). Partial nucleotide sequence analysis indicated that No/98 differs from reference strains He/80 and V by about 15%. Strain H1766 (also known as MDCK-BDV) is frequently used for experiments in Japanese laboratories (Nakamura et al., 1999 ; Shoya et al., 1997 ). We show here that the two reference strains and the newly characterized strains harbour a 3'-terminal A residue and most likely a 5'-terminal G residue. We further show that the alternative intron 2 splice acceptor site is not conserved in strain No/98. Re-analysis of the L ORF revealed that the polymerase of strain He/80 has the same length as its counterparts in strains H1766, V and No/98.
BDV strains and cells.Vero and OL cells were cultured in Dulbeccos modified Eagles medium containing 10% foetal calf serum (FCS). OL cells were kindly provided by Georg Pauli (Robert Koch Institute, Berlin, Germany). Persistent BDV infections were established by infecting 105 cells with 104 focus-forming units of appropriate virus stock followed by continued passage for at least 5 weeks. Complete infection of the cultures was confirmed by indirect immunofluorescence as described (Formella et al., 2000 ).
Virus stock preparation and titration.
Virus stocks were prepared from OL cells persistently infected with either BDV strain He/80 (Cubitt et al., 1994a ), strain H1766 (Shoya et al., 1997 ) or strain V (Briese et al., 1994 ), and from Vero cells persistently infected with strain No/98 (Nowotny et al., 2000 ) essentially as described (Briese et al., 1992 ). Briefly, 25 confluent 90 mm dishes were washed with 20 mM HEPES (pH 7·4) and incubated with 10 ml of 20 mM HEPES (pH 7·4) containing 250 mM MgCl2 and 1% FCS for 1·5 h at 37 °C. Subsequently, supernatants were harvested and centrifuged twice at 2500 g for 5 min to remove cell debris. Virus particles were concentrated by ultra-centrifugation for 1 h at 20 °C at 80000 g onto a 20% sucrose cushion containing 20 mM HEPES (pH 7·4) and 1% FCS. Virus-containing pellets were either re-suspended in PBS to approximately 107 focus-forming units/ml or were directly used to prepare RNA.
Preparation of viral RNA.
Viral RNA was isolated with TRIzol (Gibco/BRL) according to the manufacturers instructions. Briefly, virus particles in 1 ml of a concentrated BDV stock (about 107 focus-forming units) were precipitated for 30 min at 4 °C in a TL120 centrifuge (Beckman) at 70000 r.p.m. The virus pellet was lysed by dissolving in 1 ml of TRIzol solution and incubating for 5 min at room temperature. The RNA was then extracted with chloroform, and precipitated from the aqueous phase with isopropanol and glycogen (Boehringer Mannheim/Roche). Finally, the RNA was washed with ethanol, dried and re-suspended in water.
Determination of 3'- and 5'-terminal sequences of BDV genomic RNA by RNA ligation.
RNA recovered from partially purified virus particles (1 µg) was self-ligated in a volume of 20 µl of ligation buffer (75 mM TrisHCl, pH 7·5; 0·1 mM ATP; 10 mM MgCl2; 5 mM dithiothreitol; 10%, v/v, dimethyl sulfoxide; 50 U RNasin) with 50 U of T4 RNA ligase (NEB). After incubation at 25 °C for 90 min, the volume was adjusted to 200 µl with TE buffer (10 mM TrisHCl, pH 8·0 and 1 mM EDTA). The RNA was then extracted once with phenol and chloroform, precipitated with isopropanol/glycogen and centrifuged for 15 min at 4 °C. Finally, the RNA was washed with ethanol, dried and re-suspended in 13 µl of water. The material was subjected to reverse transcription using Superscript II (GIBCO/BRL) as recommended by the manufacturer using 2·5 pmol of primer GSP1 (5' ATTATAGTTTTGTCATGGACCTC 3'). Primer GSP1/No98 (5' ATGGCTTCTTGATGGACTTGGTC 3') rather than GSP1 was used for RNA from BDV strain No/98. The reaction was stopped by incubation at 70 °C for 10 min. Then RNase H (GIBCO/BRL) was added and the sample was incubated at 37 °C for another 60 min. Samples (5 µl) were amplified using Taq polymerase (Boehringer Mannheim/Roche) and 0·4 pmol of primer GSP1 (for H1766, V and He/80) or GSP1/No98 (for No/98) and primer GSP3 (5' CGTGACTGGTCTAACAATGC 3'; for H1766, V, No/98 and He/80). Nested PCR was performed with 2 µl samples of PCR products using primer GSP2 (5' GCTTGTGGTAGGACAGCACATC 3'; for H1766, V and He/80) or GSP2/No98 (5' GTTGGTGGTAGGGCAGTACATC 3'; for No/98) and primer GSP4 (5' GAGCTTAGGGAGGCTCGCTG 3'; for H1766, V and He/80) or GSP4/No98 (5' GAAAGCTTGGGAAGGCTTGCTG 3'; for No/98). The final PCR products were cloned into vector pCR4 TOPO (Invitrogen) and sequenced using a MegaBASE 1000 sequencer (Amersham Pharmacia Biotech) and the PHRED base-calling algorithm (STATEN Software package). Sequences were analysed using the DNASTAR (Lasergene) software package.
3'-RACE analysis.
To determine the 3'-end of the BDV genome, 1 µg of RNA from partially purified BDV particles was tailed with A or C residues using poly(A) polymerase (Pharmacia) as recommended by the manufacturer. The A-tailing reaction was stopped after 15 min, whereas the C-tailing reaction was stopped after 1 h. RNA was purified by phenol and chloroform extraction, precipitated with isopropanol/glycogen, washed, dried and re-suspended in 11 µl of water. A-tailed RNA was reverse-transcribed with Superscript II (GIBCO/BRL) and oligo(dT) adapter primer from the 3'-RACE kit (GIBCO/BRL). C-tailed RNA was reverse-transcribed using the inosine/guanosine adapter primer provided with the 5'-RACE kit (GIBCO/BRL). PCR was performed with 5 µl of cDNA samples, adapter primer [oligo(dT) adapter primer from the 3'-RACE system for A-tailed RNA and inosine/guanosine adapter primer from the 5'-RACE system for C-tailed RNA] and primer GSP3 (for strain H1766, No/98, V and He/80). For semi-nested PCR, 2 µl samples of the first PCR were amplified a second time with the respective adapter primers described above and primer GSP4 (for strain H1766, V and He/80) or GSP4/No98 (for No/98). PCR products were cloned into vector pCR4 TOPO before sequencing.
Determination of the 5'-terminal sequences of BDV genomic RNA by 5'-RACE.
A standard 5'-RACE system (GIBCO/BRL) was used according to the manufacturers instructions. Briefly, reverse transcription was done with primer GSP1 (for strain H1766, V and He/80) or GSP1/No98 (for No/98) and Superscript II. RNA was then digested with RNase H, and the cDNA was purified with a Glass MAX kit (GIBCO/BRL). C-tails were added to the 3'-terminal end of the cDNAs with terminal deoxynucleotidyl transferase. The tailed cDNA was amplified by PCR using appropriate adapter primers and GSP2 (for H1766, V and He/80) or GSP2/No98 (for No/98). PCR products were cloned into vector pCR4 TOPO before sequencing. Determination of the 5'-terminal sequences of BDV genomic RNA of He/80 by ligation of RNA oligos and subsequent RTPCR was carried out with GeneRacer (Invitrogen) and primer GSP2 according to the manufacturers instructions. Tobacco acid pyrophosphatase (TAP) treatment was carried out as recommended by the manufacturer (Invitrogen). Amplification products were either cloned into vector pCR4 TOPO before sequencing or sequenced directly.
Cloning and sequencing of near-full-length cDNA of strain H1766.
PCR-amplified, near-full-length cDNA derived from BDV strain H1766 that had been grown in persistently infected MDCK cells (Shoya et al., 1997 ) was kindly provided by K. Tomonaga. The material was cloned into vector pCR-XL-TOPO (Invitrogen) according to the manufacturers instructions. Three independent plasmids were sequenced which (according to restriction analysis) seemed to contain the complete viral genome. Sequencing primers were designed from published BDV sequences (GenBank accession nos U04608 and L27077). Regions were chosen that showed no or only little variation. In order to identify and eliminate PCR-generated mutations, overlapping sequences of each plasmid were assembled, resulting in three complete contiguous sequences which were then used to generate a single consensus sequence. Sequences at the extreme ends of the viral RNA were determined by RNA ligation, 3'-RACE and 5'-RACE using RNA isolated from partially purified particles.
Sequencing of strain No/98.
The complete cDNA sequence of No/98 was determined by direct sequencing of overlapping RTPCR amplification products using a large number of different oligonucleotides as described previously (Nowotny et al., 2000 ). Briefly, RTPCR reactions were carried out in a single-step reaction using the Titan One Tube RTPCR kit, the Expand Reverse Transcriptase kit and the Expand Long Template PCR system (all Boehringer Mannheim/Roche). As template we used RNA from hippocampus and rhinencephalon of the diseased horse from which No/98 was originally isolated. PCR products were sequenced in both directions without subcloning using an automated sequencer (ABI Prisma 310 Genetic Analyser, Perkin Elmer). Sequences near the 3'- and 5'-ends were determined as described above using RNA from virus particles released from an infected Vero cell culture.
Cloning of a cDNA containing the L ORF of strain He/80FR.
Fragments of the L ORF were generated by RTPCR using RNA from C6 cells persistently infected with the Freiburg variant of strain He/80 (He/80FR). Reverse transcription was carried out with Superscript II (GIBCO/BRL) and strain-specific primers were derived from the published He/80 sequence (GenBank accession no. L27077). PCR was performed with Taq polymerase (Boehringer Mannheim/Roche) as described by the manufacturer. An RTPCR fragment corresponding to nt 23934229 of He/80FR (GenBank accession no. AJ311522) was cloned into the EcoRI and PstI sites of vector pBlue (Stratagene) followed by insertion of a second RTPCR fragment (nt 42294869) into the unique PstI and BamHI sites. Subsequently, a third RTPCR fragment corresponding to nt 48697870 was inserted between the BamHI and the XhoI sites. In a final step, a fourth RTPCR fragment containing nt 78708823 was cloned into the unique XbaI site, resulting in plasmid pBlue-L encoding the complete L ORF of He/80.
Sequencing of the L ORF of strain VFR.
The L ORF of the Freiburg variant of strain V (VFR) was determined by sequencing overlapping RTPCR fragments generated from RNA of strain V-infected Vero cells. Briefly, first-strand synthesis was carried out with Superscript II (GIBCO/BRL) as recommended by the supplier using different oligonucleotides derived from the published BDV strain V sequence (GenBank accession no. U04608). PCR was performed with Taq polymerase (Boehringer Mannheim/Roche) using a panel of suitable primers. Amplification products were gel-purified and sequenced without subcloning.
We sequenced the complete genomes of BDV isolates H1766 and No/98. Strain H1766 originates from a diseased horse in Germany. It is frequently used for experiments by Japanese laboratories. Strain No/98 represents the most distant BDV subtype known to date (Nowotny et al., 2000 ). When compared to published sequences of standard strains V and He/80 as well as to the Freiburg variants of these strains, designated VFR and He/80FR (which differ from the parental strains at several nucleotide positions), it became clear that all four BDV strains have identical genome lengths, except for strain No/98, which lacks a single residue in the U-rich region (nt 11681171) that follows the N gene. Due to a micro-heterogeneity of the 5'-end (see below), the exact number of nucleotides in the BDV genome was difficult to determine. If our longest sequence represents a correct copy of the viral RNA, the genomes of BDV strains V, H1766 and He/80 would consist of 8912 nt and that of strain No/98 of 8911 nt. Since neither of these numbers corresponds to genome lengths that are a multiple of six, the rule of six (Calain & Roux, 1993 ) does not seem to apply to members of the family Bornaviridae. Nevertheless, it is interesting to note that a 3 nt deletion in the N gene of strain No/98 is compensated for by a 3 nt insertion in the first intergenic region (Nowotny et al., 2000 ), suggesting that unknown mechanisms are operating that maintain a constant number of nucleotides in the BDV genome.
An overall comparison of the four BDV genomes allowed us to establish the exact phylogenetic relationship of these viruses. As shown in Fig. 1(A), strain H1766 is closely related but distinct from reference strain V. These two strains differ by only 1·8% (155 nt). Interestingly, strain V was isolated from a diseased horse in southern Germany more than 70 years ago (Schneider et al., 1994a ), whereas strain H1766 was isolated in 1994 (S. Herzog, personal communication). Our results thus confirm earlier observations that the genomes of European BDV field isolates show remarkably few changes over long periods of time. As expected from earlier comparisons of incomplete viral genomes (Nowotny et al., 2000 ), strain No/98 occupies a unique position in the phylogenetic tree (Fig. 1A). This may reflect the fact that it was isolated from a diseased horse that lived outside the classical endemic region in Europe (Nowotny et al., 2000 ).
|
The coding strategy of BDV strains No/98 and H1766 is virtually identical to that of the two reference strains (Fig. 1B). All sequences previously found to define the transcription start sites S1, S2 and S3 (Schneemann et al., 1994 ) are completely conserved. Similarly, the four transcription stop sites (Briese et al., 1994 ; Cubitt & de la Torre, 1994 ; Schneemann et al., 1994 ) are also present at corresponding positions in the genomes of strains No/98 and H1766. Similarly, the sequences flanking intron 1 and intron 2 are highly conserved (Cubitt et al., 1994b ; Schneider et al., 1994b ). The only notable difference between the various strains maps to a site, designated SA3, that was recently reported to define an alternative intron 2 splice acceptor site (Cubitt et al., 2001 ; Tomonaga et al., 2000 ). The consensus motif CAG, which is present in strains V, He/80 and H1766, is not present in strain No/98, indicating that the latter virus cannot generate the corresponding alternatively spliced mRNA. This suggests that the predicted products of this new mRNA may not serve essential functions in the BDV replication cycle. However, we cannot exclude the remote possibility that atypical splice donor sites are used.
A consensus transcription map of the BDV genome (Fig. 1B) shows that all four viruses are able to direct the synthesis of proteins designated N, X, P, P', M, G and L (Kobayashi et al., 2000 ; Schwemmle et al., 1999 ; Walker et al., 2000 ; Wehner et al., 1997 ). Interestingly, the coding regions for N and P in strain H1766 are completely identical to those of virus isolate BDVHuP2br, believed to have originated from a Japanese psychiatric patient (Nakamura et al., 2000 ). This unusual congruence and the fact that strain H1766 (also named MDCK-BDV) is being used by the Japanese laboratory for experiments (Nakamura et al., 1999 ; Shoya et al., 1997 ) support our previous notion that BDVHuP2br might represent a laboratory contamination (Staeheli et al., 2000 ). Intriguingly, all four viruses have one additional ORF generated by splicing of intron 2 that we designate ORF6. The putative product of ORF6 consists of the N-terminal 58 amino acids of viral protein G fused to a unique 21 residue polypeptide encoded by sequences immediately downstream of splice acceptor site 2. Since this putative protein carries the G-derived signal peptide but lacks a transmembrane anchor, it is expected to be secreted by BDV-infected cells. It thus seems to resemble sGP of Ebola virus (Sanchez et al., 1996 ), which was suggested to influence the host defence (Yang et al., 1998 ). It remains to be investigated whether the ORF6 product is indeed synthesized during BDV infection and whether it can modulate the antiviral response.
Primary structure of the BDV polymerase
The most striking difference between the published ORFs of the L proteins of He/80 and V is a sequence heterogeneity at the 3'-ends that would seem to result in an L protein of He/80 that lacks 24 amino acids at the C terminus (Fig. 2). Our analysis showed that the L protein of strain H1766 consists of 1711 amino acids as does the L protein of strain V (Fig. 2). Furthermore, we found that the L gene of strain No/98 encodes a protein of exactly the same length (Fig. 2), suggesting that the truncated version of L in He/80 does not reflect a true strain difference but rather errors in previous cDNA cloning and sequencing experiments. To investigate this point in more detail, we re-cloned and sequenced the complete L ORF of the Freiburg variant of strain He/80 (He/80FR) by RTPCR as described in Methods. As shown in Fig. 2, the predicted L ORF of He/80FR encodes a protein of 1711 residues, like all other BDV strains. Original He/80 differs from the He/80FR sequence by a deletion of 2 nt (positions 87178718), which results in a premature stop codon. Insertion of the two missing nucleotides into the published sequence of He/80 restores the L ORF. This new C terminus of He/80 L perfectly matches the C terminus of the He/80FR L protein, indicating that the deletion in the published L ORF of He/80 most likely represents a cloning or sequencing artefact. In fact, these errors in the He/80 sequence have recently been corrected (March 2001, accession no. L27077). Thus, the various strains of BDV appear to have L proteins of identical lengths.
|
A more complete comparison of the published L protein sequence of strain He/80 with sequence information from variant strain He/80FR revealed nine additional differences in the amino acid sequence (Fig. 2). In all of these cases, one of the two strains possesses a residue that matches the consensus sequence of all four viruses, while the other strain has a unique residue at the corresponding position. The most simple explanation for these findings is that cDNA cloning or sequencing errors occurred. It remains possible, however, that at least some of these amino acid exchanges reflect true differences between viruses with different passage history. We further observed seven amino acid differences in the L protein of strain V and the Freiburg variant (strain VFR) of this virus. As discussed above for strain He/80, these differences could represent cloning or sequencing errors or else might indicate true differences between viruses with different passage history.
Most differences between the L protein of strain No/98 and the reference strains map to the last third of the protein (Fig. 2). Within this region, three blocks of amino acids of No/98 (G1449LHRRA1454, L1643IQE1646 and G1656RGPVVSRSSRWVG1664) are particularly poorly conserved. Whether these amino acid differences have an impact on the polymerase activity remains to be shown.
The 5'- and 3'-termini of the BDV genome
To determine the 5'-end of the viral RNA, 5'-RACE experiments were performed with RNA extracted from partially purified virus particles obtained from persistently infected cells. In this procedure, viral cDNA is synthesized and 3'-ends are elongated artificially with C residues which later serve as annealing sites for oligo(dG/dI) primers that are used to amplify the adjacent region of the viral genome by PCR. The sequence of the viral RNA at the extreme 5' terminus is then deduced by combining the sequence information from the various cloned PCR products. Irrespective of strain origin (He/80, V, H1766 and No/98) all cDNA clones analysed were virtually identical except that they differed significantly at the fusion site that links the virus sequence to the C tail (Fig. 3 A, left panel), indicating that the viral RNA used for reverse transcription was heterogeneous at the 5'-end. A consensus derived from the majority of PCR fragments suggested that 5' GCGCUA... 3' is the most likely sequence at the extreme 5'-end of the viral genome, although it remains possible that additional nucleotides are present.
|
3'-RACE experiments were performed to define the sequence at the other end of the viral genome (Fig. 3A, right panel). Here, either A- or C-tails were added to the 3'-ends of viral RNA molecules before they were subjected to reverse transcription using oligo(dT) or oligo(dG/dI) primers. Products were amplified by PCR and cloned into a plasmid vector. Most of the resulting clones contained viral cDNA fragments that suggested that the most likely 3'-end of the viral genome might be 5'...CGCAACA 3'.
To confirm these data by an independent approach, we analysed a series of cDNA clones generated from viral RNA ends that were artificially fused by RNA ligase before the product was used for cDNA synthesis and PCR amplification. In this RNA-ligation/RTPCR procedure, primers for reverse transcription were designed to drive cDNA synthesis across the junction site. Analysis of resulting cDNA clones from strains V, He/80 and H1766 revealed a rather non-uniform picture in that most of the clones appeared to carry deletions of variable lengths that seemed to map to either side of the fusion site (Fig. 3B). To generate a consensus sequence, we decided to ignore all hypothetical deletions in order to deduce the putative sequence of the longest possible RNA template. The 3'-terminal sequence of this hypothetical molecule is identical to that determined by 3'-RACE. Its 5'-terminal sequence is identical to that determined by 5'-RACE except for an extension of 4 nt. Assuming that this hypothetical molecule indeed reflects a copy of the full-length viral RNA, the proper ends of the BDV genome would be 5' UGUUGCGCUACAACAAA... and ...UUUGUUGUUAACGCAACA 3'. These two sequences show a high degree of complementarity, indicating that the BDV genome can potentially form a panhandle (Fig. 4 A), as is the case for other members of the order Mononegavirales. However, the 5'-RACE data (Fig. 3A) do not fit this model well.
|
Since we cannot rule out the possibility that intrinsic problems associated with the 5'-RACE procedure were responsible for the failure to unambiguously identify the 5'-end sequence of the viral genome, we used an alternative technique for analysis that involves ligation of a defined RNA oligonucleotide to the 5'-terminus of the genomic RNA prior to performing RTPCR. To ensure that the genome ends were mono-phosphorylated, we treated the viral RNA with TAP before ligation of the RNA oligonucleotide. Analysis of the resulting cDNA clones revealed that 5' GCGCUA... 3' was the predominant sequence at the extreme 5'-end of the viral genome of He/80 (Fig. 3C, left panel). Identical results were obtained with viral RNA that was not treated with TAP (Fig. 3C, right panel), suggesting that the 5' end of the viral genome is not tri-phosphorylated but rather mono-phosphorylated. Direct sequencing of the amplification product revealed a single prominent sequence (Fig. 3D), indicating that the vast majority of viral RNAs carry no additional nucleotides at the 5'-end. It remains to be determined whether viral genomic RNAs with these non-complementary ends are replication-competent. It is possible that the 5'-end sequences determined here reflect terminally cleaved viral RNAs. This view is compatible with the observation that the viral RNAs seemed to carry a monophosphate at the 5'-end. If correct, this situation would be similar to that observed with Seoul virus (a hantavirus; Meyer & Schmaljohn, 2000 ), where terminally deleted genome ends were found to be abundantly present in persistently infected cells.
The end sequences of the BDV genome that we deduced from our experiments are in conflict with data from previous reports (Briese et al., 1994 ; Cubitt et al., 1994a ) in which the genome ends of strains V and He/80 were determined (Fig. 4 B). The most striking difference is that we find an A residue at the 3' terminus of the viral RNA, whereas the others did not (Fig. 4B). It is not entirely clear why our analysis yielded a different result. One reason might be that previous RNA-ligation/RTPCR studies were performed in combination with 3'-RACE of A-tailed RNA, but not with C-tailed viral RNA. Such restricted analysis can, by definition, not identify any terminal A residues at the 3'-end of the viral genome.
Assuming that the 3'-end of the BDV genome is indeed occupied by an A residue, the BDV polymerase has to initiate transcription with UTP. If true, this constellation would represent a unique case among non-segmented, negative-strand RNA viruses. The polymerases of viruses from the order Mononegavirales all seem to initiate transcription by employing either ATP or GTP. Among other negative-strand RNA viruses, Hantaan virus (Garcin et al., 1995 ) is known to carry an A residue at the 3'-end of the genome. However, transcription of the Hantaan virus genome is thought not to be initiated at the terminal A residue but rather at the C residue at position 3. After synthesis of a short nucleotide primer, a sophisticated prime-and-realign mechanism ensures that the polymerase will synthesize a complete copy of the viral genome (Garcin et al., 1995 ). It remains to be determined whether similar mechanisms are at work in BDV.
Closer inspection of sequences near the 3'- and 5'-ends of the genomes of various BDV strains revealed both non-conserved and highly conserved regions. Multiple copies of a highly conserved 5' CAA 3' motif are present near the 5'-end of the viral genome and are matched by an identical number of 5' UUG 3' motifs near the 3' end (Fig. 4C, D). These repeats could potentially help to stabilize an extended panhandle structure of the BDV genome. Furthermore, a well-conserved inverted repeat consisting of the elements 3' AACGCA 5' and 3' UGCGUU 5' is present near the 3'-end of the viral genome (Fig. 4C)s. These elements could easily fold into stemloop structures and thus influence the architecture of the genome ends. It is not known at present which functions these various motifs might have.
Conclusions and implications
Nucleotides located near the termini of the viral genome were previously found to play a critical role in establishing a technique that permits the genetic manipulation of negative-strand RNA viruses (Conzelmann, 1998 ). Of similar importance are cDNA clones used to reconstitute the functional viral polymerase complex (Conzelmann, 1998 ). Our new sequence information on the hypothetical structure of both ends of the BDV genome might explain why various artificial mini-replicons that were based on published sequence information did not replicate to detectable levels in previous experiments. Functional tests with native and reconstituted viral polymerase complexes will be necessary to determine whether artificial BDV RNA molecules with the new structural features are replication-competent.
This work was supported by grants from the Deutsche Forschungsgemeinschaft and the Austrian Federal State of Vorarlberg.
References
Briese, T., Schneemann, A., Lewis, A. J., Park, Y.-S., Kim, S., Ludwig, H. & Lipkin, W. I. (1994). Genomic organization of Borna disease virus. Proceedings of the National Academy of Sciences, USA 91, 4362-4366.
Calain, P. & Roux, L. (1993). The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. Journal of Virology 67, 4822-4830.
Conzelmann, K. (1998). Nonsegmented negative-strand RNA viruses: genetics and manipulation of viral genomes. Annual Review of Genetics 32, 123-162.[Medline]
Cubitt, B. & de la Torre, J. C. (1994). Borna disease virus (BDV), a nonsegmented RNA virus, replicates in the nuclei of infected cells where infectious BDV ribonucleoproteins are present. Journal of Virology 68, 1371-1381.
Cubitt, B., Oldstone, C. & de la Torre, J. C. (1994a). Sequence and genome organization of Borna disease virus. Journal of Virology 68, 1382-1396.
Cubitt, B., Oldstone, C., Valcarcel, J. & Carlos de la Torre, J. (1994b). RNA splicing contributes to the generation of mature mRNAs of Borna disease virus, a non-segmented negative strand RNA virus. Virus Research 34, 69-79.[Medline]
Cubitt, B., Ly, C. & de la Torre, J. C. (2001). Identification and characterization of a new intron in Borna disease virus. Journal of General Virology 82, 641-646.
Formella, S., Jehle, C., Sauder, C., Staeheli, P. & Schwemmle, M. (2000). Sequence variability of Borna disease virus: resistance to superinfection may contribute to high genome stability in persistently infected cells. Journal of Virology 74, 7878-7883.
Garcin, D., Lezzi, M., Dobbs, M., Elliott, R. M., Schmaljohn, C., Kang, C. Y. & Kolakofsky, D. (1995). The 5' ends of Hantaan virus (Bunyaviridae) RNAs suggest a prime-and-realign mechanism for the initiation of RNA synthesis. Journal of Virology 69, 5754-5762.[Abstract]
Jehle, C., Lipkin, W. I., Staeheli, P., Marion, R. M. & Schwemmle, M. (2000). Authentic Borna disease virus transcripts are spliced less efficiently than cDNA-derived viral RNAs. Journal of General Virology 81, 1947-1954.
Kobayashi, T., Watanabe, M., Kamitani, W., Tomonaga, K. & Ikuta, K. (2000). Translation initiation of a bicistronic mRNA of Borna disease virus: a 16-kDa phosphoprotein is initiated at an internal start codon. Virology 277, 296-305.[Medline]
Meyer, B. & Schmaljohn, C. (2000). Accumulation of terminally deleted RNAs may play a role in Seoul virus persistence. Journal of Virology 74, 1321-1331.
Nakamura, Y., Nakaya, T., Hagiwara, K., Momiyama, N., Kagawa, Y., Taniyama, H., Ishihara, C., Sata, T., Kurata, T. & Ikuta, K. (1999). High susceptibility of Mongolian gerbil (Meriones unguiculatus) to Borna disease virus. Vaccine 17, 480-489.[Medline]
Nakamura, Y., Takahashi, H., Shoya, Y., Nakaya, T., Watanabe, M., Tomonaga, K., Iwahashi, K., Ameno, K., Momiyama, N., Taniyama, H., Sata, T., Kurata, T., de la Torre, J. C. & Ikuta, K. (2000). Isolation of Borna disease virus from human brain tissue. Journal of Virology 74, 4601-4611.
Nowotny, N., Kolodziejek, J., Jehle, C., Suchy, A., Staeheli, P. & Schwemmle, M. (2000). Isolation of a new subtype of Borna disease virus. Journal of Virology 74, 5655-5658.
Richt, J. A. & Rott, R. (2001). Borna disease virus: a mystery as an emerging zoonotic pathogen. Veterinary Journal 161, 24-40.[Medline]
Rott, R. & Becht, H. (1995). Natural and experimental Borna disease in animals. Current Topics in Microbiology and Immunology 190, 17-30.[Medline]
Sanchez, A., Trappier, S. G., Mahy, B. W., Peters, C. J. & Nichol, S. T. (1996). The virion glycoproteins of Ebola viruses are encoded in two reading frames and are expressed through transcriptional editing. Proceedings of the National Academy of Sciences, USA 93, 3602-3607.
Schneemann, A., Schneider, P. A., Kim, S. & Lipkin, W. I. (1994). Identification of signal sequences that control transcription of Borna disease virus, a nonsegmented negative-strand RNA virus. Journal of Virology 68, 6514-6522.
Schneider, P. A., Briese, T., Zimmermann, W., Ludwig, H. & Lipkin, W. I. (1994a). Sequence conservation in field and experimental isolates of Borna disease virus. Journal of Virology 68, 63-68.
Schneider, P. A., Schneemann, A. & Lipkin, W. I. (1994b). RNA splicing in Borna disease virus, a nonsegmented, negative-strand RNA virus. Journal of Virology 68, 5007-5012.
Schneider, P. A., Kim, R. & Lipkin, W. I. (1997). Evidence for translation of the Borna disease virus G protein by leaky ribosomal scanning and ribosomal reinitiation. Journal of Virology 71, 5614-5619.[Abstract]
Schwemmle, M., Hatalski, C. G., Lewis, A. J. & Lipkin, W. I. (1999). Borna virus. In Persistent Viral Infections , pp. 559-573. Edited by R. Ahmed & I. Chen. Chichester:John Wiley & Sons.
Shoya, Y., Kobayashi, T., Koda, T., Lai, P. K., Tanaka, H., Koyama, T., Ikuta, K., Kakinuma, M. & Kishi, M. (1997). Amplification of a full-length Borna disease virus (BDV) cDNA from total RNA of cells persistently infected with BDV. Microbiology and Immunology 41, 481-486.[Medline]
Staeheli, P., Sauder, C., Hausmann, J., Ehrensberger, F. & Schwemmle, M. (2000). Epidemiology of Borna disease virus. Journal of General Virology 81, 2123-2135.
Stitz, L., Bilzer, T., Richt, J. A. & Rott, R. (1993). Pathogenesis of Borna disease. Archives of Virology, Suppl. 7, 135151.
Tomonaga, K., Kobayashi, T., Lee, B. J., Watanabe, M., Kamitani, W. & Ikuta, K. (2000). Identification of alternative splicing and negative splicing activity of a nonsegmented negative-strand RNA virus, Borna disease virus. Proceedings of the National Academy of Sciences, USA 97, 12788-12793.
Walker, M. P., Jordan, I., Briese, T., Fischer, N. & Lipkin, W. I. (2000). Expression and characterization of the Borna disease virus polymerase. Journal of Virology 74, 4425-4428.
Wehner, T., Ruppert, A., Herden, C., Frese, K., Becht, H. & Richt, J. A. (1997). Detection of a novel Borna disease virus-encoded 10 kDa protein in infected cells and tissues. Journal of General Virology 78, 2459-2466.[Abstract]
Yang, Z., Delgado, R., Xu, L., Todd, R. F., Nabel, E. G., Sanchez, A. & Nabel, G. J. (1998). Distinct cellular interactions of secreted and transmembrane Ebola virus glycoproteins. Science 279, 1034-1037.
Received 25 May 2001; accepted 31 July 2001.