Abstract
Likewise, the cell-species restriction for vif-defective virus had originally led to the conclusion that cellular factors(s) could complement in trans the absence of vif functions. However, recent data suggest that Vif can counteract an inhibitory function present in non-permissive cell lines such as human T cells that interferes at late stages in the virus life cycle (Madani & Kabat, 1998 ; Simon et al., 1998a , b ). Thus, Hck, a tyrosine kinase of the Src family, has been shown to be able to inhibit the production and infectivity of vif-deleted virus, but not that of wild-type (WT) virus. The negative effect of Hck on HIV-1 replication is overcome by Vif (Hassaïne et al., 2001 ). Vif has also been shown to interact with cytoskeleton elements (Karczewski & Strebel, 1996 ) and to inhibit the proteolytic activity of HIV-1 protease (PR) in vitro and in bacteria, a function assigned to its N-terminal domain (Baraz et al., 1998 ; Friedler et al., 1999 ; Kotler et al., 1997 ; Potash et al., 1998 ).
Vif has been found to co-localize with Gag protein in human T cells (Simon et al., 1997 , 1999 ) and to be associated with HIV-1 particles (Borman et al., 1995 ; Goncalves et al., 1995 ) as a genuine constitutive element of the virus core (Liu et al., 1995 ). In good agreement with these data, co-precipitation experiments performed with HIV-infected H9 cell lysates suggested that a specific GagVif interaction occurred in human cells in vivo and that the NC domain was an essential determinant for the binding of Gag to Vif (Bouyac et al., 1997b ). Likewise, in insect cells that expressed both HIV-1 Gag precursor (Pr55Gag) and Vif protein, significant amounts of Vif were found to be co-encapsidated with Pr55Gag into membrane-enveloped Gag particles budding at the plasma membrane (Huvent et al., 1998 ). Major Vif-interacting sites in Gag were mapped to two regions: (i) the C-terminal domain of Pr55Gag, spanning the second zinc finger of the NC domain, the spacer peptide (sp) 1 and the sp1p6 junction as far as the N-terminal proline-rich motif of the p6 domain (Huvent et al., 1998 ); and (ii) the MACA junction (Bouyac et al., 1997b ). In Vif, the basic C-terminal domain and a discrete central region within residues 68100 were identified as major Gag-binding sites (Huvent et al., 1998 ). Interestingly, mutations affecting the C-terminal domain of Vif and the central Gag-binding sites resulted in a vif- phenotype of HIV-1 virions produced by human cells (Bouyac et al., 1997b ).
Conflicting reports have concluded that Vif is associated with (Liu et al., 1995 ; Y. Sun, J. Van Velkinburg and C. Aiken, personal communication) or is absent from (Dettenhofer & Yu, 1999 ) highly purified HIV-1 virions and that the presence of Vif within the virion correlates with the level of the protein within the infected cells, rather than relating to specific viral incorporation of Vif (Simon et al., 1998c ). However, Vif has been shown to increase the stability of the virus core (Öhagen & Gabuzda, 2000 ), suggesting that some core component could be a target for Vif function. Consistent with this, Vif has been characterized as an RNA-binding protein (Dettenhofer et al., 2000 ; Zhang et al., 2000 ) that might be involved in intracellular trafficking and packaging of HIV-1 genomic RNA (Zhang et al., 2000 ).
The aim of the present study was to investigate further the mechanism of interaction of Vif with Gag and GagPol precursors and their co-encapsidation into retrovirus-like particles (VLP). We found that Vif, expressed as a recombinant protein in insect cells, was efficiently co-encapsidated with non-N-myristoylated, budding-defective, p6-deleted Gag precursor into intracytoplasmic VLP, suggesting that the presence of the p6 domain, the addressing of Gag to the plasma membrane and VLP budding were not required for Vif encapsidation. We also found that Vif was encapsidated with significantly higher efficiency into extracellular VLP formed from N-myristoylated GagPol precursor harbouring an inactive PR domain compared with Pr55Gag or into chimaeric VLP composed of two different precursor species, Gag and GagPol. Vif exerted an inhibitory effect on Gag proteolytic processing, mainly shown by protection of the cleavage sites at the MACA and CANC junctions. However, no direct interaction between Vif and PR could be detected in vivo by electron microscopy or in vitro in co-precipitation assays, and Vif showed complete resistance to PR action in vitro. Although a transient interaction of Vif with PR could not be excluded, this suggests that the Vif-mediated inhibition of Gag processing resulted from direct binding of Vif to the Gag substrate. Moreover, our data suggest that the enhancement of Vif encapsidation efficiency by GagPol precursor was not mediated by p6* or the GagPol-embedded PR domain, but resulted from a more favourable conformation of the Gag domain when expressed as a GagPol precursor.
Insect cells, recombinant baculoviruses and virus infections.Spodoptera frugiperda cells (Sf9 subclone) were maintained as monolayers in Graces insect medium supplemented with L-amino acids (Gibco BRL) and 10% foetal calf serum. The construction and phenotypes of recombinant baculoviruses used in the present study have been described in detail elsewhere (Carrière et al., 1995 ; Chazal et al., 1994 , 1995 ; Gay et al., 1998 ; Hong & Boulanger, 1993 ; Huvent et al., 1998 ; Royer et al., 1991 , 1992 , 1997 ). Sf9 cells were infected at an m.o.i. ranging from 2 to 10 p.f.u. per cell for single infections. In double- or triple-infection experiments, cells were infected simultaneously with 10 p.f.u. per cell of each recombinant baculovirus. Expression of recombinant proteins was verified by SDSPAGE and immunoblotting analysis of cell lysates and immunofluorescence (IF) analysis of fixed cells, performed on cultures infected in parallel, using the appropriate antibodies.
Gag and GagPol clones.
The Gag precursors used consisted of full-length Pr55Gag (WT precursor of 55 kDa), C-terminal deletion mutants (amber; amb) Gag-amb462 (p6 C-terminal moiety deleted), Gag-amb438 (p6 deleted), Gag-amb426 (p6+sp1 deleted) and the L-to-P substitution mutant GagL268P (Fig. 1). They were expressed as N-myristoylated (myr+), budding-competent, or non-N-myristoylated (myr-), budding-defective recombinant proteins. N-myristoylated GagPol precursors consisted of Gag(FS)p6*Pol and Gagp6Pol. Gag(FS)p6*Pol (originally named AcH7fs; Hughes et al., 1993 ) is a frameshift mutant with constitutively frameshifted translation of the gagpol mRNA. In Gagp6Pol, the PR domain was fused to the C-terminal p6 domain (Royer et al., 1997 ). Both GagPol precursors were PR-defective, by the double substitution GR86→EF in the PR domain of Gag(FS)p6*Pol (Göttlinger et al., 1989 ; Hughes et al., 1993 ), or by the PR active-site mutation D25→G in Gagp6Pol (Royer et al., 1997 ).
|
Vif.
The recombinant HIV-1 Vif-expressing baculovirus, derived from the pNDK molecular clone (Spire et al., 1989 ), has been described previously (Huvent et al., 1998 ).
Protease (PR).
PR was expressed in baculovirus-infected cells in three polyhedrin-tagged versions, active PR58-107 (full-length), inactive PR58-D33G (full-length, catalytic-site mutant) and inactive PR58-77 (C-terminally truncated mutant) (Fig. 1). They all carried the N-terminal 58 amino acid residues from the baculovirus polyhedrin sequence at their N termini (Royer et al., 1997 ).
Control vector.
MR15 was an empty baculovirus vector used as a negative control in single or double infections. MR15 harboured an out-of-phase PR sequence in the locus of the deleted polyhedrin gene.
Isotopic labelling and immunoprecipitation.
Sf9 cells were infected simultaneously with equal m.o.i. of two recombinant baculoviruses (10 p.f.u. per cell), one expressing Vif, the other expressing the PR58-D33G or PR58-77 mutant protease. Cells were labelled (Redivue PRO-MIX, Amersham Pharmacia Biotech; 37 TBq/mmol; 5·3 MBq/ml of methionine-free medium) at 16 h after infection (p.i.). At 48 h p.i., cells were harvested and lysed and cell lysates were clarified and used for co-immunoprecipitation using anti-polyhedrin, anti-PR or anti-Vif rabbit antibodies. Immune precipitates were collected by selection on Protein ASepharose CL-4B affinity gel (Sigma) as described previously (Karayan et al., 1994 ). Proteins retained on the affinity gel were analysed by SDSPAGE and autoradiography, or blotted and analysed with anti-Vif (diluted 1:3000) and anti-PR (1:2000) antibodies. To avoid the masking of the Vif band (23 kDa) on blots by the undesirable reaction of the secondary anti-rabbit IgG with the IgG light chain (22 kDa) present in the immunoprecipitate, the alkaline phosphatase (or peroxidase) conjugate used was a monoclonal anti-rabbit IgG (γ-chain specific, clone RG-96, Sigma; diluted 1:5000) and the portion of the membranes where the IgG heavy chains had blotted was excised prior to antibody reaction.
Bacterial clones and bacterially expressed recombinant proteins
Recombinant protease.
Recombinant HIV-1 PR107 was an active protease form of 107 residues containing 7 residues from the p6* domain at its N terminus plus the methionine initiator (Valverde et al., 1992 ). Both PR107 and its inactive version PRD33G (mutated at the catalytic site) were expressed in bacterial cells (E. coli strain MC1061) using the inducible araB promoter (Valverde et al., 1992 ).
Nucleocapsid (NC) protein.
The cDNA of NCp15 (NCp7+p6 domain) was obtained by PCR amplification of the corresponding HIV-1Lai gag sequence, and cloned into the pKK233-3 vector (Amersham Pharmacia Biotech) according to conventional methods. Recombinant NCp15, starting at Met-378, was overproduced in E. coli strain JM105 by induction with IPTG, as described below.
Recombinant Vif.
The pD10Vif bacterial expression plasmid, carrying the vif gene from the HIV-1 proviral clone pHXB2, was obtained from D. Gabuzda (Yang et al., 1996 ). In plasmid pD10Vif, a 6xHis tag was fused to the Vif N terminus lacking the initiation methionine codon (MRGSHHHHHHGSVif). Vif protein was purified essentially according to the method of Yang et al. (1996) . The plasmid was transformed into E. coli MC1061 and expression of Vif was induced by addition of 0·5 mM IPTG to exponential-phase bacterial cultures (OD600=0·60·8). After induction for 4 h at 37 °C, the bacterial cells were lysed in 6 M guanidineHCl, 0·1 M sodium phosphate, pH 8·0, at room temperature with overnight stirring. Insoluble cell debris was removed by centrifugation at 15000 r.p.m. in an SS-34 rotor for 30 min and the supernatant was loaded onto a NiNTAagarose column (Qiagen). The column was washed extensively with lysis buffer and eluted sequentially with the same solution at decreasing pH (pH 6·5, 6·0, 5·8, 5·5 and 5·0). The Vif-containing fractions that eluted at pH 5·5 were pooled, diluted to 200 µg/ml and dialysed successively against 50 mM MOPSNaOH, pH 6·5, containing 150 mM NaCl and 3·0, 1·5, 0·75, 0·42, 0·21 and 0 M guanidineHCl. The protein was then concentrated with a Centriprep-10 concentrator (Amicon) and insoluble aggregates were removed by centrifugation at 100000 g for 30 min at 4 °C. The soluble fraction was adjusted to 10% glycerol and stored in aliquots at -70 °C.
Glutathione-S-transferase (GST)-fused Vif.
The construction of GSTVif from the NL4.3 strain of HIV-1 has been described elsewhere (Bouyac et al., 1997b ).
GST-fused protease.
The protease was inactivated (PR*) by mutagenesis (D25G substitution) by a two-step recombinant PCR method with the following primers: PR-7-GAV-EcoRI-(s), PR-PQI-EcoRI-(s), PR-D25G-(s/as), PR-Stop-LNF-NotI-(as) (see below). GSTPR*-7, containing 7 residues from p6* at its N terminus, as in PR107, and GSTPR* (99 residues) were obtained by digestion of the PCR products with EcoRI/NotI and cloning into the pGEX-5X2 expression vector. The cloning oligonucleotides used were: PR-7-GAV-EcoRI-(s), 5' AAAGGAATTCTTGGAACTGTATCCTTTAACTTC 3'; PR-PQI-EcoRI-(s), 5' AAAGGAATTCCTCAGATCACTCTTTGGCAACG 3'; PR-D25G-(s/as), 5' GCTCTATTAGGTACAGGAGCAG 3' and 5' CTGCTCCTGTACCTAATAGAGC 3'; and PR-Stop-LNF-NotI-(as), 5' TCACGATGCGGCCGCCTAAAAATTTAAAGTGCAACCAATC 3'.
Expression and purification of GST-fusion proteins.
E. coli Top10 cells (Invitrogen), transformed with fusion protein-expression plasmids, were grown at 30 °C and protein expression was induced by IPTG, as described above. The bacteria were lysed by sonication (3x30 s) on ice and the lysate was incubated for 30 min at 4 °C in the presence of 1% Triton X-100 with shaking. Insoluble material was pelleted for 30 min at 14000 g and the supernatant was incubated overnight at 4 °C with 20 µl 50% (v/v) glutathione (GSH)agarose beads (Sigma) per ml of lysate. After three successive washes with 1 M NaCl and PBS, the GST-fusion proteins immobilized on GSHagarose beads were quantified by SDSPAGE. The beads were stored at 4 °C in the presence of a protease inhibitor cocktail (1 mg/ml aprotinin, 1 mg/ml leupeptin, 2 mg/ml pepstatin and 1 mg/ml antipain) for further analysis.
In vitro transcriptiontranslation.
For in vitro protein synthesis, appropriate genes were amplified by PCR with 5'-oligonucleotides that contained the T3 RNA polymerase promoter upstream of the initiation position and 3'-oligonucleotides that contained a stop codon. Amplified DNAs were subjected to in vitro transcriptiontranslation using the TNT coupled wheat germ extract system (Promega) as recommended by the manufacturer. Proteins were translated in the presence of [35S]methionine (37 TBq/mmol; Amersham Pharmacia Biotech), analysed by SDSPAGE and quantified by autoradiography and phosphorimager analysis. The oligonucleotides used for protein in vitro translation were 5' GTTATTAACCCTCACTAAAGGGAAGATTATGGAAAACAGATGGCAGGTGATG 3', referred to as T3 Vif-1-(s), and 5' ATTCTGCTATGTTGACAC 3', referred to as Vif-stop-192-(as).
GST-pull down assays.
Binding reactions were performed overnight at 4 °C in TBST binding buffer containing 50 mM TrisHCl, pH 7·0, 0·2% Tween 20 and appropriate concentrations of NaCl (150350 mM) in the presence of BSA (200 µg/ml) in a total volume of 300 µl. GSHagarose beads bound to GST-fusion protein were incubated overnight with either 8 µl in vitro-translated 35S-labelled proteins or 200 µl cytoplasmic extract and then washed extensively in TBST buffer. Samples were resuspended in 25 µl SDS sample buffer and bound proteins were analysed by SDSPAGE and autoradiography or Western blotting (Huvent et al., 1998 ).
VLP analysis.
Membrane-enveloped VLP formed from N-myristoylated Gag or GagPol polyproteins and released by extracellular budding were analysed by ultracentrifugation in sucroseD2O gradients (Liu et al., 1995 ) after proteolytic digestion with subtilisin, aimed at hydrolysing soluble or membrane-bound Vif protein, which would not be truly Gag-encapsidated and could contaminate the VLP fractions (Goncalves et al., 1995 ; Huvent et al., 1998 ; Simon et al., 1997 ). Linear gradients (10 ml total volume, 3050% w/v) were centrifuged for 18 h at 28000 r.p.m. in a Beckman SW41 rotor. The 50% sucrose solution was made in D2O buffered to pH 7·2 with NaOH and the 30% sucrose solution was made in 10 mM TrisHCl, pH 7·2, 150 mM NaCl, 5·7 mM disodium EDTA. Aliquots of 0·4 ml were collected from the bottom and proteins were analysed by SDSPAGE and immunoblotting.
EM and immunoelectron microscopy (IEM).
For conventional EM, baculovirus-infected Sf9 cells were harvested at 40 h p.i., pelleted, fixed with 2·5% glutaraldehyde in 0·1 M phosphate buffer, pH 7·5, post-fixed with osmium tetroxide (2% in H2O) and treated with 0·5% tannic acid solution in H2O. The specimens were dehydrated and embedded in Epon (Epon-812). Sections were stained with 2·6% alkaline lead citrate and 0·5% uranyl acetate in 50% ethanol and post-stained with 0·5% uranyl acetate solution in H2O. For IEM and antibodyimmunogold labelling (Gay et al., 1998 ; Huvent et al., 1998 ), cell specimens were embedded in hydrophilic metacrylic resin (Lowicryl K4M; Chemische Werke Lowi) and sections were reacted with anti-CAp24 and anti-MAp17 mouse MAbs and anti-Vif rabbit antibody, both diluted 1:100 in Tris-buffered saline (TBS) overnight at 4 °C. For double labelling, the reaction with gold-labelled secondary antibody was carried out at room temperature for 1 h, using anti-mouse IgG labelled with 5 nm colloidal gold particles and 10 nm gold-tagged anti-rabbit IgG (EM-GAM5 and EM-GAM10, respectively; BioCell Research Lab) diluted 1:100 in TBS. For single labelling, 5 nm gold-labelled secondary antibody was used. Sections were post-stained with 0·5% uranyl acetate. Specimens were examined under a Hitachi-H7100 electron microscope.
PR activity in vitro on Pr55Gag and Vif substrates
Recombinant Gag substrate.
Proteolytic processing of Gag was assayed using the soluble, assembly-defective, non-N-myristoylated full-length polyprotein mutant of 55 kDa, Gag-G2A (Chazal et al., 1995 ), as the protein substrate of viral PR. Sf9 cells were infected with Gag-G2A-expressing baculovirus and infection was allowed to proceed for 48 h. Cells were pelleted, resuspended in hypotonic buffer (10 mM TrisHCl, pH 7·0, 1 mM disodium EDTA) containing a cocktail of protease inhibitors (Complete protease inhibitor cocktail tablets; Boehringer) at 1 tablet for 50 ml and lysed in a tight-pestle Dounce homogenizer. The cell lysate was clarified by centrifugation at 12000 g for 20 min. Soluble Gag-G2A polyprotein was recovered in the cytosolic fraction and stored frozen at a total protein concentration of 0·40·5 mg/ml. As Gag-G2A represented 510% of the cytosolic protein (Royer et al., 1992 ), the cytosolic fraction was used as protease substrate without further purification (Valverde et al., 1992 ).
Recombinant PR.
Bacterially expressed protease PR107 and its mutant PRD33G were isolated as described previously (Valverde et al., 1992 ) with minor modifications. Briefly, bacterial cells (E. coli MC1061, 5 ml aliquots) taken at an OD600 of 0·5 were treated with L-arabinose at 20% for 4 h to induce PR expression and lysed in 0·1 ml 50 mM TrisHCl, pH 7·0, containing 1 mM DTT, 0·01% lysozyme and the complete protease inhibitor cocktail described above. After standing on ice for 10 min, the samples were treated with 0·1% NP40 and DNase I at a final concentration of 1 mg/ml in the presence of 10 mM MgCl2. The lysates were clarified by centrifugation at 12000 g for 20 min and the supernatant was used as the source of PR. The amount of PR was estimated by Coomassie blue staining of SDSpolyacrylamide gels by comparison with a range of titrated lysozyme samples. In some experiments, recombinant, affinity-purified PR (expressed in E. coli; Bachem AG) was also used.
Standard PR assays.
In standard reactions, 5 µl aliquots of Sf9 cytosolic fraction containing Gag-G2A substrate (0·51·0 pmol) were mixed with 10 µl aliquots of PR sample (0·050·01 pmol PR107) and 5 µl buffer containing 50 mM MOPSNaOH, pH 6·5, 150 mM NaCl and increasing amounts of recombinant Vif protein, ranging from 4 to 40 pmol (0·11·0 µg) per sample. Digestion was conducted for 1 h at 37 °C and the enzymatic reaction was stopped by addition of 20 µl SDSPAGE sample buffer. In negative-control samples, the inactive PR mutant PRD33G was used in place of PR107 or PR107 was used in the presence of the inhibitor Saquinavir (Bragman, 1996 ). Saquinavir was kindly supplied by F. Mammano (INSERM-Hôpital Bichat, Paris) and used at concentrations ranging from 0 to 2·0 mM.
PR assays using nascent Gag and Vif substrates.
In typical reactions, 2·5 µl [35S]methionine-labelled Pr55Gag or Vif protein, obtained by in vitro translation as described above, was brought to a final volume of 35 µl with 50 mM TrisHCl, pH 6·8, 150 mM NaCl, 1 mM disodium EDTA, 10% glycerol. An aliquot of 1 µl of bacterially expressed, purified HIV-1 PR (H 1256; Bachem) at a concentration of 540 ng/µl was added to the mixture and digestion was allowed to proceed at 37 °C for 4 h. Digestion was stopped by heating in SDSPAGE loading buffer and samples were analysed by SDSPAGE and autoradiography.
Immunoblot analysis and antibodies.
Proteins were analysed by SDSPAGE and immunoblotted, as described previously (Huvent et al., 1998 ). Anti-HIV-1 MA protein rabbit polyclonal antibody (laboratory-made; Huvent et al., 1998 ) was raised in a rabbit by injection of GST-fused, bacterially expressed and affinity chromatography-purified MAp17. Mouse MAbs against MAp17 (Epiclone 5003) and against CAp24 (Epiclone 5001) were obtained from Cylex Inc. and a MAb against HIV-1 reverse transcriptase was obtained from IntraCell. Mouse MAb HH3 directed against NCp7 was obtained from R. Benarous (Tanchou et al., 1994 ). Anti-p6 rat MAb M35/2F8 was kindly provided by M. G. Sarngadharan (Veronese et al., 1987 ; Carrière et al., 1995 ) and the rabbit anti-Vif serum was provided by D. Gabuzda. Anti-HIV-1 PR and anti-polyhedrin rabbit sera were both laboratory-made (Royer et al., 1997 ). Phosphatase-labelled anti-rabbit, -mouse and -rat IgG conjugates were purchased from Sigma and horseradish peroxidase-labelled conjugates were purchased from Boehringer. For luminograms, chemiluminescent peroxidase substrate Supersignal (Pierce) was used. For immunological quantification of Gag and Vif proteins, blots were reacted with 125I-labelled anti-rabbit or anti-mouse whole IgG antibody (Amersham Pharmacia Biotech; 6·9 mCi/mg; 3 µCi per blot) and exposed to radiographic film (Hyperfilm-βmax, Amersham Pharmacia Biotech). Autoradiographs were scanned at 610 nm using an automatic densitometer (REP-EDC, Helena Laboratories) or protein bands were excised from blots and radioactivity was measured in a scintillation counter (Beckman LS-6500) as described previously (Huvent et al., 1998 ).
We have shown previously that Gag particles formed from Gag-amb438myr+, a Gag precursor lacking the p6 domain, were more homogeneous in size and shape than VLP composed of full-length Pr55Gag (Gay et al., 1998 ; Wilk et al., 2001 ). Its non-N-myristoylated counterpart, Gag-amb438myr-, assembled intracytoplasmic VLP efficiently in insect cells (Royer et al., 1991 , 1992 ; Carrière et al., 1995 ). Gag-amb438myr- was therefore co-expressed with Vif in Sf9 cells and cell sections were examined under the EM after single immunogold labelling of Vif protein or differential immunogold labelling of both Vif and Gag proteins (Huvent et al., 1998 ). Rabbit anti-Vif antibody was detected with 10 nm gold-tagged anti-rabbit IgG antibody and mouse anti-CAp24 and anti-MAp17 MAbs were detected with 5 nm gold-tagged anti-mouse IgG antibody (Fig. 2).
|
In single Vif-labelling experiments, gold grains were mostly found to be associated with intracytoplasmic VLP and frequently delineated the VLP contours (Fig. 2a). In double immunogold labelling, gold grains of 5 nm (Gag) and 10 nm (Vif) diameter accumulated mostly in section areas that showed VLP, whereas areas devoid of VLP were poorly labelled (Fig. 2b). Gold grains of both diameters were observed in close association with intracytoplasmic VLP and the EM pattern suggested a co-assembly of Gag and Vif proteins into VLP (Fig. 2bd). However, it is noteworthy that patches with double Vif and Gag labelling showed more intense Vif labelling at the periphery than in the centre, where VLP with clear contours were most abundant (Fig. 2b). In the peripheral zones, Vif labelling was associated with electron-dense, amorphous material with less Gag labelling. Although some degree of mutual exclusion between Vif and Gag antibodies could not be ruled out, the EM pattern would be compatible with Gag particles seen at different stages of assembly, and would suggest that the affinity of Vif for the Gag molecules varied during the course of the Gag assembly process and decreased in properly assembled particles, as suggested recently (Sova et al., 2001 ).
These EM data thus confirmed that the VifGag interaction could occur intracellularly, as suggested previously (Bouyac et al., 1997a ; Huvent et al., 1998 ). The observation that co-encapsidation of Vif and the myristoylation-defective, C-terminal deletion mutant Gag-amb438myr- could take place within the cytoplasm implied that the interaction between Gag and Vif did not depend upon the presence of the p6 domain in the Gag precursor. It also implied that Vif and Gag co-packaging did not result simply from the addressing of Gag and Vif to the cell surface, their co-localization at the plasma membrane and the extracellular budding of Gag particles.
Co-encapsidation of Vif with Gag or GagPol precursors into extracellular VLP
Before maturation, HIV-1 particles are composed transiently of two Gag precursor species, the Gag polyprotein of 55 kDa (Pr55Gag) and the GagPol polyprotein of 160 kDa (Pr160GagPol), the latter precursor containing the p6* and PR domains upstream of the RTIN domain (Fig. 1). Since direct interactions between Vif-derived peptides and viral PR (Friedler et al., 1999 ) have been reported, we investigated the possible influence of PR on Vif encapsidation efficiency in an assay in which PR was provided as an inactivated, constitutive domain of the GagPol precursor. Vif was co-expressed with a single Gag (WT Pr55Gag) or GagPol precursor species and their VLP Vif contents were compared by quantitative immunoblot analysis of VLP isolated by velocity gradient ultracentrifugation (Huvent et al., 1998 ) and estimated semi-quantitatively by IEM analysis of budding VLP in EM sections (Carrière et al., 1995 ). As shown in Fig. 3(a, b) and Table 1, Gag(FS)p6*Pol, a budding-competent, N-myristoylated GagPol precursor containing a mutant PR, encapsidated 6-fold more copies of Vif per Gag molecule than did Pr55Gag. This was confirmed by IEM analysis of VLP (Fig. 4). Sections of VLP composed of Gag(FS)p6*Pol were labelled with Vif antibody at significantly higher levels than VLP formed from Pr55Gag: the mean number of Vif-associated gold grains per VLP was found to be 17·52 (SEM=2·69; SD=13·26; n=93) for Gag(FS)p6*Pol (Fig. 4b) versus 2·62 (SEM=0·60; SD=2·60; n=72) for Pr55Gag (Fig. 4a). The background anti-Vif labelling of Pr55Gag VLP assembled in the absence of Vif expression was 0·13 grains per VLP (SEM=0·08; SD=0·56; n=176). The difference was therefore significant at the P=0·05 confidence level.
|
Table 2. Bars, 100 nm.
Table 1. Co-encapsidation of Vif protein with various Gag and GagPol precursors
Table 2. Morphological parameters of VLP released by Sf9 cells expressing Gag or/and GagPol precursors
In order to evaluate the possible role of the p6* domain in the enhancement of Vif packaging efficiency, encapsidation was next studied by using another GagPol precursor, Gagp6Pol. In the Gagp6Pol fusion construct, the mutant PR domain has been artificially fused to the C terminus of the p6 domain (Royer et al., 1997 ) whereas, in the permanently frameshifted Gag(FS)p6*Pol, the PR domain was located at the C terminus of the natural p6* domain (Hughes et al., 1993 ). Thus, the major difference between Gagp6Pol and Gag(FS)p6*Pol resided in their p6 and p6* domains, respectively (Fig. 1). The molar ratio of Vif to Gag copies found in VLP formed from Gagp6Pol precursor was 4-fold higher than in Pr55Gag VLP (Fig. 3c; Table 1), a value not significantly different from that obtained with Gag(FS)p6*Pol at the P=0·05 confidence level. This would imply that the occurrence of p6* in place of p6 in the GagPol precursor did not affect the VifGag co-encapsidation process significantly, confirming our EM observation of the dispensability of p6 for Vif packaging into intracellular VLP (Fig. 2). This would also suggest that the sequences responsible for the higher Vif encapsidation level were located downstream of the Gag domains and acted either directly, via extra Vif-binding sites in the Pol domain, or indirectly, via Pol-mediated conformational modifications of the Gag domains.
Morphology of VLP and Vif encapsidation
It has been reported recently that Vif was packaged at significantly higher levels in HIV-1 particles composed of Gag CA deletion mutants with aberrant morphology (Sova et al., 2001 ). This was confirmed by our own observation that GagL268Pmyr+ encapsidated 10-fold more Vif per Gag molecule than did Pr55Gag (Table 1). GagL268Pmyr+ is a CA substitution mutant that self-assembles with low efficiency and releases large, membrane-enveloped Gag particles (Hong & Boulanger, 1993 ). We then analysed the influence of VLP morphology on Vif encapsidation using chimaeric VLP composed of two Gag precursor species, as occurs in immature virus particles. Co-expression of N-myristoylated Gag(FS)p6*Pol (or Gagp6Pol) and p6-deleted GagPr47 (or Gag-amb438myr+, our Δp6 equivalent of Pr47) in insect cells has been found to result in chimaeric VLP that appear to be more homogeneous in size and shape under the EM than VLP formed from single Gag(FS)p6*Pol molecules (Hughes et al., 1993 ) or Gagp6Pol (Royer et al., 1997 ). The same effect was observed in co-expression of Gag(FS)p6*Pol with Gag-amb426myr+ (Fig. 4; Table 2). Gag(FS)p6*Pol molecules assembled into VLP with a diameter 2-fold larger (mean 242 nm) than that of WT Pr55Gag VLP (125 nm). Moreover, their heterogeneity and lack of sphericity, as estimated respectively by the value of the SD of the mean diameter and the ratio of their minimum to maximum diameters (d:D), were significantly greater than those of WT VLP (Table 2). By contrast, the morphology of chimaeric VLP composed of Gag-amb426myr++Gagp6Pol or of Gag-amb426myr++Gag(FS)p6*Pol (with or without Vif) was similar to that of WT Pr55Gag VLP (Fig. 4c, d; Table 2).
Gag-amb426myr+, which lacks p6 and the sp1 spacer peptide between the NC and p6 domains, has been shown to be defective in Vif packaging, with a 5- to 10-fold reduction of the Vif content of VLP formed from Gag-amb426myr+ compared with WT Pr55Gag VLP (Huvent et al., 1998 ; Table 1). Thus, when assayed in triple-infection experiments involving GagPol and Gag-amb426myr+, packaging of Vif into chimaeric VLP would essentially depend upon the GagPol precursor species. Sf9 cells were thus infected simultaneously with three recombinant baculoviruses expressing Vif, Gag-amb426myr+ and Gag(FS)p6*Pol (or Gagp6Pol) and the expression of the three recombinant proteins was verified in situ by IF microscopy and by SDSPAGE analysis and immunoblotting of Sf9 cell lysates (not shown). The VLP released from the co-infected cells were isolated in velocity gradients and assayed for Vif and Gag content (Table 1). The results showed that Vif was encapsidated at significantly higher levels in chimaeric VLP than in VLP constituted of the single Pr55Gag species (Table 1; Fig. 3, compare a and d), although the VLP showed similar size and morphology under the EM (Table 2; Fig. 4, compare a with c and d). Interestingly, the number of copies of Vif was larger in mixed VLP containing the natural Gag(FS)p6*Pol precursor than in mixed VLP containing the Gagp6Pol fusion construct, 5- and 3-fold, respectively, over the Pr55Gag VLP content (Table 1). These data suggested that Vif encapsidation into Gag particles was not a simple consequence of an aberrant morphology of these particles, but would favour the hypothesis of a conformational role of the GagPol precursor in VifGag interaction and co-encapsidation, e.g. dimerization induced or/and stabilized by the PRPol domains. However, since a direct interaction between Vif and PR could not be excluded at this stage, the next experiments were designed to address this point.
Absence of detectable VifPR interaction in vivo and in vitro
The possible direct interaction between Vif and PR was examined in vivo under the EM on sections of Sf9 cells co-infected by a baculovirus expressing Vif and a high-expresser of polyhedrin-tagged, inactive PR* (PR58-D33G or PR58-77; Fig. 1). No pattern of co-localization of the PR* and Vif protein inclusions was visible in the cytoplasm and nucleus of Sf9 cells in EM and IEM (not shown). In co-immunoprecipitation assays of Sf9 cell lysates, neither of the individual proteins, Vif or PR*, was found to co-precipitate with the other with any of the specific antibodies used, anti-PR, anti-polyhedrin or anti-Vif (not shown). Likewise in vitro, in GST-pull down assays, no significant amount of Vif protein was found to bind GSTPR* (inactivated by a D→G substitution at its catalytic site) using full-length Vif or its isolated N-terminal or C-terminal moieties. In reverse experiments using GSTVif, no detectable PR* was pelleted from PR58-D33G- or PR58-77-expressing Sf9 lysates (not shown). Moreover, pull down of active recombinant PR (commercially available from Bachem) by GSTVif was also unsuccessful (not shown).
Altogether, these data apparently argued against a stable interaction between Vif and the viral PR, although a transient interaction between Vif and PR, which would account for the Vif-mediated inhibition of PR activity (Kotler et al., 1997 ;Potash et al., 1998 ), could not be excluded. Similarly, PR-mediated proteolytic degradation of Vif within maturing virus particles could explain its absence or quasi-absence from mature virions, as reported previously (Dettenhofer & Yu, 1999 ). To test this hypothesis, in vitro-translated nascent Vif and Gag proteins were incubated with chromatographically purified, recombinant HIV-1 PR (Bachem) and cleavage products were analysed by SDSPAGE and autoradiography. As shown in Fig. 5(a), PR was capable of processing Pr55Gag precursor, as shown by the occurrence of a major p24 protein species. In contrast, Vif appeared to be totally resistant to viral PR in vitro, at least under conditions that allowed efficient cleavage of Pr55Gag.
|
Influence of Vif protein on PR-mediated Gag processing in vitro
To determine whether Vif could affect the proteolytic activity of PR, we developed an in vitro-processing assay using a soluble, non-N-myristoylated, budding-defective Gag precursor mutant (Gag-G2A) as the viral substrate and bacterially expressed recombinant PR (PR107; Valverde et al., 1992 ) as the enzyme under conditions defined previously (Valverde et al., 1992 ). Negative-control samples contained active-site mutant protease PRD33G (Valverde et al., 1992 ) or PR107 with the inhibitor Saquinavir. With Gag and PR alone, discrete bands corresponding to the expected cleavage products migrating as MAp17, the doublet band of CAp24CAp25 (CAp24±sp2) and NCp15 were observed on Western blots (not shown; see Royer et al., 1997 ). However, special attention was aimed at three major intermediate Gag-cleavage products, migrating with apparent molecular masses of 4041 (P41), 39 (P39) and 17·5 (P17.5) kDa. These proteolytic products were identified by using three parameters: (i) their molecular mass in SDSPAGE, (ii) their reactivity to antibodies directed towards specific domains of Gag (Fig. 5b, d) and (iii) the proteolytic pattern of Gag amber mutants (Fig. 6). P41, which reacted with both anti-MA and anti-CA antibodies but not with anti-p6 antibody, corresponded to the N-terminal moiety of the Gag precursor, MAp17CAp24 or MAp17CAp25 (Mervis et al., 1988 ) (Fig. 5b). As P39 reacted with both anti-CA and anti-p6 antibodies but not with anti-MA antibody, it corresponded to the Gag C-terminal moiety. P39 resulted from the hydrolysis of the major processing site at the MACA junction and was composed of the CAp24, sp2, NCp7, sp1 and p6 domains (Pettit et al., 1994 ) (Fig. 5d). The Gag fragment P17.5, which reacted with both anti-p6 and anti-NC antibodies, spans sp2, NC and p6 (Fig. 5d). Both P41 and P17.5 resulted from the cleavage of Gag at the CANC junction on either side of the sp2 spacing peptide (Henderson et al., 1992 ; Pettit et al., 1994 ) (Fig. 5b, d).
|
A significant change was observed in the proteolytic pattern of Gag precursor in the presence of Vif and more particularly in the occurrence of the intermediate cleavage product P41 detected by anti-MA antibody, which decreased progressively in a Vif-dependent manner (Fig. 5b). A similar effect was obtained with the PR-inhibitor Saquinavir, over the range 1·0 to 1·7 mM (Fig. 5c). As the decrease in the P41 signal was not accompanied by the occurrence of smaller products, the data implied inhibition of Gag processing, with selective protection of the cleavage site at the CAsp2 junction. The effect on the Gag proteolytic pattern was only visible over 816 pmol Vif for 1 pmol Gag substrate and 0·1 pmol PR, and this apparent threshold suggested that oligomeric forms of Vif might be involved. This is consistent with recent data showing that Vif oligomerization is required for its function (Yang et al., 2001 ).
Non-N-myristoylated Gag precursors of various lengths (Gag-amb462, Gag-amb438 and Gag-amb426), carrying amber stop codons at different positions in the C-terminal p6 or sp1 domain (Fig. 1), were incubated with PR in the presence or absence of Vif. The same anti-MA-reacting P41 band appeared to be attenuated in the presence of Vif in all Gag mutant patterns (Fig. 6), indicating that P41 corresponded to the N-terminal moiety of the Gag precursor. This also suggested that the absence of p6 and p6+sp1 domains apparently did not modify the negative influence of Vif on PR-mediated cleavage of the upstream sites bounding the sp2 domain.
The proteolytic pattern of Gag in immunoblots using anti-p6 antibody confirmed the negative effect of Vif on PR-mediated Gag processing: almost complete extinction of the P17.5 signal was observed in the presence of Vif, suggesting inhibition of cleavage at the CAsp2 junction (Fig. 5d; compare lanes 4 and 5). It also showed a simultaneous decrease in the intensity of the cleavage product P39, which implied protection of the cleavage site at the MACA junction. The negative effect on Gag processing of 40 pmol Vif mimicked the anti-PR activity of Saquinavir at 1·7 mM (Fig. 5d, lanes 5 and 6).
The molecular mechanisms of the regulatory functions of Vif in the HIV-1 life cycle and the biochemical basis for the possible association of Vif protein with the virus core remain matters of controversy. In this study, we investigated by in vivo and in vitro assays the interactions between Vif and Gag precursor and between Vif and PR, which represents a structural domain of the GagPol precursor as well as an enzyme essential for virion maturation and infectivity. We observed efficient co-encapsidation of Vif with Gag precursor into intracellular VLP assembled by the non-N-myristoylated, budding-defective, Δp6 mutant Gag-amb438myr-, confirming previous results on direct GagVif interaction (Bouyac et al., 1997b ; Huvent et al., 1998 ). Our results implied that Vif encapsidation did not depend on Gag addressing to the plasma membrane and could also occur independently of Gag N-myristoylation and VLP budding and did not require the presence of the p6 domain in the Gag precursor.GagVif co-encapsidation into budding VLP released by Gag+Vif-co-expressing cells was also assayed using budding-competent, N-myristoylated Gag and GagPol precursors. Vif was found to be encapsidated into extracellular VLP with significantly higher efficiency when co-expressed with GagPol precursors harbouring an inactive PR domain compared with Pr55Gag. Furthermore, Vif was encapsidated at higher levels into chimaeric VLP composed of GagPol precursor and p6+sp1-deleted Gag-amb426myr+ compared with single Pr55Gag VLP (Fig. 3; Table 1). The chimaeric VLP showed mean size, sphericity and homogeneity in shape similar to those of Pr55Gag VLP (Fig. 4; Table 2), which seemed to exclude the possibility that Vif encapsidation efficiency was simply related to the morphology of VLP, as hypothesized recently (Sova et al., 2001 ), or to the amount of cytoplasmic material or plasma membrane enclosed in VLP. This rather suggested that Vif had some affinity for a downstream domain(s) of the GagPol precursor and/or that the presence of the PRPol domains at the Gag C terminus positively affected the binding of Vif to the upstream regions of Pr55Gag identified previously (Bouyac et al., 1997b ; Huvent et al., 1998 ). Co-encapsidation of Vif with a naturally frameshifted GagPol precursor containing the p6* domain, compared with a GagPol fusion construct containing the p6 domain in place of p6*, suggested that the effect on Vif encapsidation was not due directly to p6* but to further downstream sequences. Since we were unable to detect any significant interaction in vivo or in vitro between Vif and PR, direct participation of the PR domain of GagPol precursor in Vif packaging was unlikely. Although some binding of Vif to regions of the Pol domain could not be totally excluded, the results of our encapsidation assays suggested that the conformation of the Gag domain was more favourable to GagVif interaction in the GagPol precursor than in Pr55Gag.
Vif was also analysed with respect to its possible influence on the proteolytic activity of PR in vitro, using soluble Pr55Gag precursor as the substrate. We found that Vif was totally resistant to PR action in vitro (Fig. 5a), but exerted an inhibitory effect on PR-mediated Gag processing (Figs 5bd and 6). Although some subtle mechanism of PR inactivation by Vif could not be excluded, the data suggested that Vif-mediated inhibition of Gag processing resulted from binding of Vif to the Gag substrate rather than to the PR enzyme. The proteolytic pattern suggested preferential protection by Vif of two major cleavage sites, at the MACA and CANC junctions (Figs 5 and 6). Interestingly, these two junction regions were revealed previously as the preferential binding sites of Vif (Bouyac et al., 1997b ; Huvent et al., 1998 ). The peptide bond at the sp2NC junction is cleaved at the highest rate by the viral PR (Pettit et al., 1994 ). In addition, sp2 is not only essential for sequential processing of Pr55Gag (Pettit et al., 1994 ), but is also a major determinant of Gag particle assembly (Campbell & Vogt, 1997 ; Gay et al., 1998 ; Gross et al., 2000 ). This suggested that Vif preferentially inhibited the cleavage of peptide bonds integrity of which is crucial for temporal regulation and correct assembly of HIV-1 virions.
We therefore hypothesize that Vif could regulate negatively the proteolytic activity of PR by interacting with the Gag/GagPol substrate in the cytoplasm of infected cells, as suggested previously (Bouyac et al., 1997b ; Huvent et al., 1998 ). This interaction would be transient and would maintain the integrity of the Gag and GagPol molecules during their addressing to the plasma membrane and their assembly into immature particles. At later stages of assembly, a majority of Vif molecules would be excluded from the particles, as suggested recently (Sova et al., 2001 ). The molecular mechanism of Vif exclusion is still unknown, but it could occur via a conformational change of Gag, probably resulting from Gag proteolysis, that lowered its affinity for Vif, or/and by exchange of Vif with a viral or cellular ligand(s) acting as a competitor(s) for Gag binding. Two lines of evidence support this Vif ligand-switching hypothesis. (i) Vif interacts with the cytoplasmic side of the plasma membrane, an association mediated by intrinsic membrane components and the C-terminal domain of Vif (Goncalves et al., 1994 , 1995 ; Simon et al., 1997 ). (ii) The affinity of Vif for RNA decreased in the presence of Gag precursors, while the latter still bound RNA, suggesting a displacement and exchange of RNA-bound proteins during genome packaging (Zhang et al., 2000 ).
It must be considered that our results might apply only to insect cells, which could lack some crucial mammalian cell factors. It is noteworthy that, in our system of baculovirus infection, we probably favoured incorporation of Vif into VLP for at least two reasons: (i) the Gag and GagPol precursors were not cleaved, since the GagPol constructs were defective in PR activity, and (ii) insect cells lack certain cellular factors such as some tyrosine kinases of the Src family that may retain Vif at the cell membrane (Hassaïne et al., 2001 ). Further analyses are needed to reunite the multiple functions assigned to Vif. Several of them, e.g. the role of Vif in RNA folding and packaging and its role in virus core morphology and stability (Höglund et al., 1994 ; Öhagen & Gabuzda, 2000 ) and in regulation of Gag/GagPol processing during capsid assembly, would be compatible with a function as a viral chaperone in virus morphogenesis and genome encapsidation.
This work was supported in part by the Fondation pour la Recherche Médicale, the Ligue du Cancer, the Association pour la Recherche sur le Cancer (ARC) and the Agence Nationale de Recherche contre le SIDA (ANRS Program AC-14-2), the Institute National de la Santé et de la Recherche Médicale (INSERM dotation globale) and the Centre National de la Recherche Scientifique (CNRS dotation globale). N.C. was supported financially by the French ARC and SIDACTION foundations and E.D. was the recipient of a fellowship from the Belgian FNRS. M.B. and B.G. contributed equally to this work.Footnotes
b Present address: Laboratoire Infections Rétrovirales et Signalization Cellulaire, CNRS-EP 2104, Institut de Biologie, 4 Bd Henri IV, 34060 Montpellier, France.References
Borman, A. M., Quillent, C., Charneau, P., Dauguet, C. & Clavel, F. (1995). Human immunodeficiency virus type 1 Vif- mutant particles from restrictive cells: role of Vif in correct particle assembly and infectivity. Journal of Virology 69, 2058-2067.[Abstract]
Bouyac, M., Rey, F., Nascimbeni, M., Courcoul, M., Sire, J., Blanc, D., Clavel, F., Vigne, R. & Spire, B. (1997a). Phenotypically Vif- human immunodeficiency virus type 1 is produced by chronically infected restrictive cells. Journal of Virology 71, 2473-2477.[Abstract]
Bouyac, M., Courcoul, M., Bertoia, G., Baudat, Y., Gabuzda, D., Blanc, D., Chazal, N., Boulanger, P., Sire, J., Vigne, R. & Spire, B. (1997b). Human immunodeficiency virus type 1 Vif protein binds to the Pr55Gag precursor. Journal of Virology 71, 9358-9365.[Abstract]
Bragman, K. (1996). Saquinavir: an HIV proteinase inhibitor. Advances in Experimental Medicine and Biology 394, 305-317.[Medline]
Camaur, D. & Trono, D. (1996). Characterization of human immunodeficiency virus type 1 Vif particle incorporation. Journal of Virology 70, 6106-6111.[Abstract]
Campbell, S. & Vogt, V. M. (1997). In vitro assembly of virus-like particles with Rous sarcoma vir